ID: 903510831

View in Genome Browser
Species Human (GRCh38)
Location 1:23873873-23873895
Sequence CTGGAAATACAGAGGAGGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 341}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903510831_903510844 20 Left 903510831 1:23873873-23873895 CCCAGCCTCCTCTGTATTTCCAG 0: 1
1: 0
2: 1
3: 46
4: 341
Right 903510844 1:23873916-23873938 GGATTATCAGAATATCAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 145
903510831_903510842 -1 Left 903510831 1:23873873-23873895 CCCAGCCTCCTCTGTATTTCCAG 0: 1
1: 0
2: 1
3: 46
4: 341
Right 903510842 1:23873895-23873917 GGGACCTGAGGTTACAGGTGGGG 0: 1
1: 0
2: 1
3: 13
4: 291
903510831_903510841 -2 Left 903510831 1:23873873-23873895 CCCAGCCTCCTCTGTATTTCCAG 0: 1
1: 0
2: 1
3: 46
4: 341
Right 903510841 1:23873894-23873916 AGGGACCTGAGGTTACAGGTGGG 0: 1
1: 0
2: 0
3: 24
4: 227
903510831_903510845 21 Left 903510831 1:23873873-23873895 CCCAGCCTCCTCTGTATTTCCAG 0: 1
1: 0
2: 1
3: 46
4: 341
Right 903510845 1:23873917-23873939 GATTATCAGAATATCAGAGAGGG 0: 1
1: 1
2: 0
3: 18
4: 241
903510831_903510840 -3 Left 903510831 1:23873873-23873895 CCCAGCCTCCTCTGTATTTCCAG 0: 1
1: 0
2: 1
3: 46
4: 341
Right 903510840 1:23873893-23873915 CAGGGACCTGAGGTTACAGGTGG 0: 1
1: 0
2: 3
3: 29
4: 364
903510831_903510838 -6 Left 903510831 1:23873873-23873895 CCCAGCCTCCTCTGTATTTCCAG 0: 1
1: 0
2: 1
3: 46
4: 341
Right 903510838 1:23873890-23873912 TTCCAGGGACCTGAGGTTACAGG 0: 1
1: 0
2: 0
3: 58
4: 1207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903510831 Original CRISPR CTGGAAATACAGAGGAGGCT GGG (reversed) Exonic
900571823 1:3362421-3362443 AAGGAAATATAAAGGAGGCTGGG + Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG + Intergenic
901174362 1:7287940-7287962 GTCTAACTACAGAGGAGGCTGGG + Intronic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
902603549 1:17556122-17556144 CTGGAAACACAGGGGGGCCTGGG + Intronic
902653914 1:17854444-17854466 CTGGACACACAGAGGAGGCGGGG + Intergenic
902890284 1:19438368-19438390 AAGGAAATACAGAGGAAGCTGGG + Intronic
902972276 1:20062496-20062518 CTGAAAACTCAGAGCAGGCTGGG + Intronic
903300563 1:22375765-22375787 CTGGGAACACAGTGGATGCTCGG + Intergenic
903434207 1:23334207-23334229 CTAGAAAGACAGTGGGGGCTGGG - Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
904470432 1:30732428-30732450 CTGGAAATACAGTGTAGGGAGGG - Intergenic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905884462 1:41484373-41484395 CTGCAAATACAGAGGTGCCCAGG - Intronic
906360274 1:45150928-45150950 CTGGAATTACAGAGAATCCTGGG - Intronic
906705060 1:47888673-47888695 CTCTACCTACAGAGGAGGCTAGG - Intronic
906903616 1:49864912-49864934 CTGGCAGTGCTGAGGAGGCTGGG + Intronic
907445661 1:54506269-54506291 CAGAAAATACAGAGGAAACTGGG - Intergenic
907923222 1:58932108-58932130 CTGGAGATGCAGAGGTGACTTGG - Intergenic
908796845 1:67838557-67838579 CCAGATATACAGAGGAGGTTTGG + Intergenic
912544827 1:110443130-110443152 CTGGGGATACAGAGGATCCTTGG + Intergenic
914858593 1:151369442-151369464 CTGGCAATACTGGGGAGACTTGG + Exonic
916341508 1:163741432-163741454 CTGAAAAAACAGAGGAGGAGGGG - Intergenic
916801622 1:168221497-168221519 CTGGAAGTAGAGGGGAGGCCTGG + Intergenic
916818151 1:168372982-168373004 CTGGCCATACAGAGGTGGCCTGG + Intergenic
917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG + Intronic
918136859 1:181681457-181681479 CTGGAAATAAACAGGAGGATGGG - Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
919938662 1:202271509-202271531 CAGAAAATACAGGGGAGGCTGGG + Intronic
919990513 1:202705899-202705921 CAGGAATTCCAGAGCAGGCTGGG - Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
921695541 1:218204899-218204921 TTGGAAATACAGAAGAAGTTTGG - Intergenic
922025928 1:221748791-221748813 CTGGAAATAAAGTGGAGGTCTGG - Intergenic
922747593 1:228053775-228053797 CTGGAAAGAGAGAGGAGGATGGG + Intronic
922854831 1:228765907-228765929 CAGGAGATAGAGATGAGGCTGGG + Intergenic
922997108 1:229973025-229973047 TTGGAATTGCAGAGGGGGCTAGG + Intergenic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
924509213 1:244714837-244714859 CTTGAAAGACAGATGAGGCCAGG + Intergenic
924670626 1:246120757-246120779 CTGGAAACACACAGGAGGGATGG - Intronic
924709071 1:246519355-246519377 ATGGAAAGACAGAGGACCCTGGG - Intergenic
1065563888 10:26989860-26989882 CAGGAAGTTCAGAGGAGGCGGGG + Intergenic
1066226286 10:33386735-33386757 CTAGAAATTAAGATGAGGCTGGG - Intergenic
1067426803 10:46216927-46216949 CTGGAACTCAAGAGGAGGATGGG + Intergenic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1068595197 10:58895674-58895696 CTGGAGAGACAGAGGTGGCCAGG + Intergenic
1068853132 10:61767760-61767782 GTGGAGAGACAGAGAAGGCTCGG - Intergenic
1069996115 10:72343125-72343147 CAGGAAATGCAGAGGAAGCAGGG + Intronic
1071427628 10:85575300-85575322 CTGGAAAGACAGAGCAGGACTGG - Intergenic
1072723074 10:97792634-97792656 AAGGAAATAAACAGGAGGCTGGG + Intergenic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1075046907 10:119153632-119153654 CTGTAAGTGCAGAGCAGGCTGGG + Intronic
1075561312 10:123470585-123470607 CAGGAAATCCAAAGGGGGCTAGG - Intergenic
1075924804 10:126242736-126242758 CTTGAAATCCTGAGGAGCCTGGG - Intronic
1075962284 10:126579534-126579556 CAGGAAATACAGATTTGGCTGGG - Intronic
1076362141 10:129896910-129896932 CAGGCAATAAAGAGGAGGCCTGG - Intronic
1076432668 10:130417261-130417283 TTAGAAATACAGAGGAAGGTTGG - Intergenic
1078294083 11:10047999-10048021 AGGGAAATATAGAGGAGGATAGG - Intronic
1080454730 11:32407925-32407947 TAGGAAATACAGGGGAGGCCAGG + Intronic
1081676903 11:44975314-44975336 CAGGAAACACAGAGGCGTCTGGG + Intergenic
1081851073 11:46275670-46275692 CTCTAATTACAGAGCAGGCTGGG + Intergenic
1084264825 11:67999455-67999477 TTGGCAATAAAGTGGAGGCTTGG + Intronic
1084275988 11:68051228-68051250 CTGGAAGTACAGAGCAGTGTGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1087328907 11:96755407-96755429 CTGGAAAAACCGAGGTGACTAGG - Intergenic
1088905150 11:114149850-114149872 CTGGAACCACAAAGGAGGCCTGG - Intronic
1090477204 11:127034130-127034152 ATGAAAATACAGAGTAGGGTGGG - Intergenic
1091094412 11:132806157-132806179 CTGGATTAACATAGGAGGCTGGG + Intronic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1092153401 12:6266706-6266728 CTGGGAATAGGGAGGTGGCTGGG + Intergenic
1096504609 12:52084855-52084877 CTGGAAGTAGAGAGGAGGCAAGG + Intergenic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097229556 12:57501522-57501544 CTGAAAATACAGAAATGGCTAGG + Intronic
1099089686 12:78290285-78290307 CTGGGACTACAGAGAAGGCATGG + Intergenic
1101731535 12:107431266-107431288 CTGGGAGTGCAGAGGTGGCTAGG - Intronic
1102275651 12:111580179-111580201 ATGGGAAGAAAGAGGAGGCTGGG + Intronic
1103259275 12:119572631-119572653 AAAGAAAAACAGAGGAGGCTGGG + Intergenic
1106482410 13:30146865-30146887 CAGGAAATACACGGAAGGCTCGG + Intergenic
1107037835 13:35919586-35919608 CTGGAAAAAGAGAGGAGTCTGGG - Intronic
1107712741 13:43166748-43166770 CTGAAAATACAGAGGATGGATGG + Intergenic
1109738379 13:66518172-66518194 CAGGAAAAACAGAGGAGGGGAGG + Intronic
1110290711 13:73803708-73803730 CTGGAGACACAAAGAAGGCTAGG + Intronic
1110613636 13:77517082-77517104 CTGGAAATATGGAGGAGGAGTGG + Intergenic
1112407382 13:99133371-99133393 CTGTCAAGCCAGAGGAGGCTTGG + Intergenic
1112483511 13:99799115-99799137 AGGGAAAGACAGTGGAGGCTGGG + Intronic
1113052005 13:106222801-106222823 CTAGAAATTCAGAGAAGTCTGGG - Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1114321664 14:21551711-21551733 CTGGAATTCAAGACGAGGCTGGG + Intergenic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1116625513 14:47257744-47257766 CAGGAAGAACAGAGGAGTCTGGG + Intronic
1116801363 14:49447369-49447391 CAGCAAATGCAGAGGATGCTTGG - Intergenic
1116805182 14:49487520-49487542 CTCTAATTACAGAAGAGGCTAGG - Intergenic
1116814346 14:49569742-49569764 CAGGAGATACAAATGAGGCTTGG + Intergenic
1117225519 14:53654350-53654372 CTAGGAATACAGAGGAGACTTGG + Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118280937 14:64427961-64427983 CTGGGACTTCAGAGGTGGCTTGG + Intronic
1118291922 14:64534577-64534599 CTGTAGATACACAGTAGGCTGGG - Intergenic
1119427511 14:74545457-74545479 CTGGAGATACAGAGGGCCCTGGG + Intronic
1120019362 14:79510897-79510919 ATGGGAATACAGATGAGGCAGGG - Intronic
1121131992 14:91455993-91456015 TTGGAAATGCAGGGGAGGCATGG - Intergenic
1121647924 14:95534085-95534107 CTGGAAACTCAGAGGCGGCCGGG + Intronic
1125440597 15:39698992-39699014 TCGGAAAGACAGAGGAGGCTAGG - Intronic
1125883596 15:43212742-43212764 CTGGAAATCATGAGGAGGGTGGG + Intronic
1126264266 15:46734031-46734053 CTGGAAATATAAAGGAGGGAAGG + Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127820002 15:62646455-62646477 CAGAAAATACACAGGTGGCTGGG - Intronic
1128045543 15:64614526-64614548 CTTGAAATACAGAAAAGGCCAGG - Intronic
1129339015 15:74872999-74873021 GTGGAACTGCAGAGGAGGCGGGG - Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129893884 15:79089923-79089945 CTGGAGATGCAGAGGAAGATGGG - Intronic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1132492582 16:241371-241393 CAGGAGTTACAGAGGAGCCTGGG + Intronic
1132856819 16:2048787-2048809 AGGGAAATGCAGAGAAGGCTGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133476883 16:6132243-6132265 CTGGAAATAGAGAAGAGCCAAGG - Intronic
1133594611 16:7279607-7279629 CTGGGAATAGAGAGGAGGGATGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1136428840 16:30185700-30185722 ATGGAAACACAGAGGGGGTTGGG + Intronic
1137273510 16:46918488-46918510 CTGGAATGGCACAGGAGGCTGGG + Intronic
1140043311 16:71423942-71423964 CTGGGGAGACAGAGAAGGCTTGG + Intergenic
1140229327 16:73104523-73104545 ATTGAAATCCACAGGAGGCTGGG - Intergenic
1141285853 16:82670921-82670943 TAGGAAATACAGAGAAGCCTCGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142429343 16:90018212-90018234 CTGGGAATACCCAGGAGCCTGGG + Intronic
1143016763 17:3894924-3894946 CTTGACTCACAGAGGAGGCTTGG + Intergenic
1143276014 17:5711406-5711428 CTGGAAAGACACTGGAGTCTTGG + Intergenic
1145267269 17:21385833-21385855 CAGGTAATAGAGAGGAGACTGGG + Intronic
1145976723 17:28988222-28988244 ATGGATCTCCAGAGGAGGCTAGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146643884 17:34563549-34563571 ATGGAAATACACAAGAGGCAAGG - Intergenic
1147248482 17:39138240-39138262 CTGGAATTACATTTGAGGCTAGG + Intronic
1148465221 17:47860992-47861014 GGGGAATTAGAGAGGAGGCTGGG + Intergenic
1148613119 17:48978152-48978174 CAGGAGTTACAGAGGAGCCTGGG + Intergenic
1148732419 17:49845569-49845591 CTGGGAATAGGGAGGGGGCTGGG + Intronic
1149458908 17:56811443-56811465 CTGGAAGGAAAGGGGAGGCTGGG - Intronic
1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG + Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151263030 17:72931560-72931582 CCAGATAGACAGAGGAGGCTGGG + Intronic
1151361757 17:73593269-73593291 CTTGAATTACAGAGGTGTCTGGG - Intronic
1152110361 17:78354370-78354392 GTGGAAAGACAGAGGAAGGTTGG + Intergenic
1152344699 17:79743879-79743901 CTGGATTTACAGAGGAGGACAGG - Intergenic
1152425901 17:80218526-80218548 ATGGATGGACAGAGGAGGCTGGG + Intronic
1152664380 17:81558886-81558908 CTGAAAATAAAGAGAAGGCTGGG + Exonic
1152895730 17:82910058-82910080 CTGGAAACCCAGATGAGCCTGGG - Intronic
1152945710 17:83196384-83196406 TTGGAGACACAGAGGAGGCTGGG + Intergenic
1153828287 18:8897286-8897308 CTGGGAACACAGAGGAGACGTGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1157419103 18:47530680-47530702 CTGGAAATGCACAAGAGTCTTGG - Intergenic
1157449538 18:47774788-47774810 CTGCCAATACAGAGGACGATGGG + Intergenic
1158365789 18:56734202-56734224 CTGATAATACAGAGAAGGCAAGG - Intronic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158448061 18:57538206-57538228 CTACAAAGACAGAGGTGGCTGGG + Intergenic
1158547524 18:58408826-58408848 TTGGAAATACGGAGGAGGAGAGG - Intergenic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1159112916 18:64081074-64081096 CTGGAAAAGAAGAGCAGGCTTGG + Intergenic
1159988542 18:74874611-74874633 CTGGAAATGCAGAGCTAGCTGGG - Intronic
1160754112 19:748694-748716 TGGGAAATACACAGGAGGCCTGG + Intergenic
1161280796 19:3444484-3444506 CTGAACAGACAGAGGATGCTTGG + Intronic
1162696663 19:12482028-12482050 CTGGGATTACAGATGTGGCTTGG - Intronic
1162805021 19:13133270-13133292 ATAGAATTACAGAGGAGGCCGGG + Intronic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1164145072 19:22507449-22507471 CTGGAGTTTCAGAGCAGGCTGGG - Intronic
1165038560 19:33052665-33052687 CTGGAGATTCAGGGCAGGCTGGG + Intronic
1165619817 19:37236279-37236301 CTTGAAATTAAGAGGAGGATTGG - Intronic
1165709888 19:38003586-38003608 CTGTAAATACAGACGTGGCAGGG + Intronic
1166738987 19:45102896-45102918 CTGGAGCCACACAGGAGGCTGGG + Intronic
1167353130 19:48988095-48988117 CAGGAATTAAACAGGAGGCTGGG - Intronic
1167436193 19:49480275-49480297 CTGGGGAGAAAGAGGAGGCTGGG - Intronic
1167460990 19:49624694-49624716 CTCAAAGGACAGAGGAGGCTGGG - Intronic
1167518340 19:49936741-49936763 CTGGAATTCCAGAGCAGCCTGGG + Intronic
1167530549 19:50013322-50013344 GTGCAAAGACAGAGGAGCCTGGG + Intronic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
925387151 2:3469955-3469977 ATGGAGATACAAGGGAGGCTCGG + Intronic
926913306 2:17871278-17871300 CTGGAAATATTGAGGAGTGTTGG - Intergenic
927710486 2:25322707-25322729 CTGAAGATGGAGAGGAGGCTTGG - Intronic
928016493 2:27662994-27663016 CAGGAGTTCCAGAGGAGGCTGGG - Intronic
928109050 2:28491816-28491838 TTGGAAATACACAGGAGCCCTGG + Intronic
928330102 2:30351213-30351235 CTGCAAACCGAGAGGAGGCTTGG - Intergenic
928483760 2:31708851-31708873 AAGGAAACACAGTGGAGGCTGGG + Intergenic
929992347 2:46800938-46800960 CTGCAAAGACAGAGAAGGCCAGG + Intergenic
930054843 2:47244052-47244074 CTGGAAACACTGAGCAGGCTTGG - Intergenic
930213547 2:48669107-48669129 CTGGAAATACAGAGTGGGGATGG - Intronic
932596523 2:73096981-73097003 CAGGGAAGACTGAGGAGGCTTGG - Intronic
932702569 2:74001809-74001831 CTGGAAAGGCAGAGGAGGGGAGG - Intronic
932703302 2:74004976-74004998 CTGGAGATACAGAGGAGAGAGGG - Intronic
932891243 2:75598825-75598847 AGGGAAATGCAGAGGAGCCTGGG - Intergenic
935579988 2:104748324-104748346 ATGGAAATATAGAGGCGGCACGG - Intergenic
936646471 2:114377850-114377872 CTTTAAATGAAGAGGAGGCTGGG - Intergenic
936878288 2:117218862-117218884 CTGGAAGAGCAGAGGAGGGTGGG + Intergenic
936920904 2:117687463-117687485 CTGGAAATACTGATGAGGGCAGG + Intergenic
937326939 2:120995387-120995409 GAGGAAATACAGAGGCGGCTGGG - Intergenic
938575638 2:132600947-132600969 CTGGAGATGCAGAGGAGGGAAGG - Intronic
938614016 2:132979081-132979103 CTGGAAATTCAGTGGAAGCTTGG - Intronic
939908269 2:147946156-147946178 CTATAAATAAAGAGGATGCTGGG - Intronic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
941624341 2:167814369-167814391 TTGGTAGAACAGAGGAGGCTTGG + Intergenic
942235557 2:173900998-173901020 TTTGAAATACAGAGAAGGGTGGG + Intergenic
943918202 2:193665480-193665502 CTGGGAATACAGAACAGGATAGG + Intergenic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
946411539 2:219517583-219517605 CTGGAATTACAGATTGGGCTGGG + Intronic
946988333 2:225300312-225300334 CTGGAAAGACTGAGGAGGCATGG + Intergenic
947349450 2:229227542-229227564 CTGGAAATGCTCAAGAGGCTTGG + Intronic
947588476 2:231371102-231371124 CAGCAAATCCAGGGGAGGCTCGG + Intronic
1169450851 20:5709654-5709676 CTAGAAAAACAGAGGTGGCATGG + Intergenic
1171946927 20:31387100-31387122 CTGAAAATACACAATAGGCTGGG - Intronic
1172050682 20:32115222-32115244 CAGGAAGTACAGAGGAGGTTGGG + Intronic
1172624577 20:36339939-36339961 CTGGACAGGCAGTGGAGGCTGGG + Intronic
1172798411 20:37559286-37559308 CTGCAACTCCAGAGGAAGCTAGG - Intergenic
1172815237 20:37681026-37681048 ATGGAAATAGAGAGGATGTTAGG + Intergenic
1173839901 20:46150562-46150584 CTGGTACAACAGAGGATGCTTGG - Intergenic
1174037244 20:47675769-47675791 CTGGAAAGCCAGGGCAGGCTTGG - Intronic
1174566723 20:51470008-51470030 CTGACAACACCGAGGAGGCTGGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175047944 20:56125125-56125147 CTGTAAATAGAGTGGATGCTTGG + Intergenic
1175852280 20:62100045-62100067 CTGGGAATCCAGAGCAGGCAGGG - Intergenic
1176044466 20:63085097-63085119 CAGAAAGTAGAGAGGAGGCTCGG + Intergenic
1176242549 20:64081752-64081774 CTGGATGTGCAAAGGAGGCTGGG - Intronic
1176525259 21:7861534-7861556 CAGGAAATACAGAGGAGAGAAGG - Intergenic
1177654713 21:24002945-24002967 CTGGATTTGCAGAGGAGACTGGG - Intergenic
1178445559 21:32638399-32638421 TTGAAAATTCAGAGTAGGCTGGG + Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178659279 21:34491547-34491569 CAGGAAATACAGAGGAGAGAAGG - Intergenic
1178753866 21:35329066-35329088 CTGGGAATACAGTGGTGGATGGG + Intronic
1181317379 22:21979341-21979363 CAGGAATTACAGAGGGGCCTGGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183012577 22:34959175-34959197 CTGGAGTAATAGAGGAGGCTGGG - Intergenic
1184678174 22:46054518-46054540 ATGGAGGTGCAGAGGAGGCTGGG - Intronic
1185111290 22:48901547-48901569 CTGGAAGCAGGGAGGAGGCTTGG + Intergenic
949873516 3:8608745-8608767 CTTTAAATCCAGAGGAGGCTTGG - Intergenic
949904298 3:8845773-8845795 ATGGAAAGACACAGGATGCTGGG - Intronic
950012571 3:9733419-9733441 CTGGGGATACAGAGGTGGATAGG + Intronic
950563520 3:13749767-13749789 CTAGAGATACAGAGGACACTCGG - Intergenic
950820743 3:15755631-15755653 ATGGAGATACAGGGGAGGCAGGG + Intronic
952092242 3:29901797-29901819 CTGGAAAAATAGAAGTGGCTGGG + Intronic
952258247 3:31714018-31714040 CTGAAGATTCTGAGGAGGCTGGG + Intronic
953721757 3:45362241-45362263 CTGGAGATAAAGAGGAGGGCAGG - Intergenic
954450334 3:50568021-50568043 ATGGATGTACAGAGGAGACTTGG + Intronic
954959445 3:54551135-54551157 CAGGAAATAAAAAGGAGGCTGGG - Intronic
955407612 3:58635487-58635509 CCGGCAAGACAGAGGAGGCGTGG - Intronic
955727805 3:61951599-61951621 CTGGAAATACACAGGAAATTAGG - Intronic
956442790 3:69296478-69296500 CTGGAAGTTCAGAATAGGCTGGG + Intronic
956934510 3:74084668-74084690 TCAGAAATATAGAGGAGGCTTGG + Intergenic
957950861 3:87124664-87124686 CTGGAAATACAAAGGTGAGTTGG + Intergenic
959957303 3:112253004-112253026 CTGGAAAATCTGAGGAGACTAGG + Intronic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
963866800 3:150370228-150370250 CTAGAAAAGGAGAGGAGGCTTGG + Intergenic
964677527 3:159300340-159300362 CAGGAATTACAGATGAGTCTGGG - Intronic
965440452 3:168706648-168706670 CTCAAAATACAGAGGAAGTTTGG + Intergenic
966251827 3:177874815-177874837 GTTAAAATAAAGAGGAGGCTGGG + Intergenic
967722861 3:192833919-192833941 ATGGGAATACAGGGGAGGATGGG - Intronic
968514031 4:1008975-1008997 CTGGGAAGACAGAGGTGGCCAGG - Intergenic
969329803 4:6467763-6467785 CTGGAAGTTCAGAGGCGGCCTGG + Intronic
969392421 4:6900682-6900704 TTGGAAACACAGCGGGGGCTGGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974593844 4:63991133-63991155 CTGGAGATCCAGAGGAGGGAGGG + Intergenic
975383692 4:73730982-73731004 GTGGAAATAATGAGGAGGCACGG - Intergenic
975487498 4:74950295-74950317 CTGGAGCTTCAGAGGAGGCATGG - Intronic
976400040 4:84596977-84596999 CTGGAGAGTAAGAGGAGGCTGGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978347276 4:107784955-107784977 ATGGAAATACAGAGAAAACTTGG - Intergenic
978402405 4:108344522-108344544 CTGGAAAAAGAGAGGAGTTTTGG - Intergenic
978914183 4:114103351-114103373 ATGGAAATAAAAAGGAAGCTTGG + Intergenic
979772036 4:124538342-124538364 CAGGAAATACAGAGGAGGTTGGG + Intergenic
979994962 4:127420684-127420706 CTGAAAATACAGTGCAAGCTTGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981495571 4:145388167-145388189 GTGGAAATACAAAGGATACTTGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983252657 4:165362311-165362333 CAGGAGTTACAGAGGAGCCTGGG + Intronic
983527351 4:168772718-168772740 CTGGAAATACAGAGATGAATGGG - Intronic
983888192 4:173004280-173004302 CTGGAAAGACAGAAGACACTAGG - Intronic
986920213 5:12671255-12671277 CTGGAAATACAGAGGGCCGTCGG - Intergenic
987512504 5:18857781-18857803 TTCTAAATGCAGAGGAGGCTTGG + Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989235558 5:39144347-39144369 TAGGAAATACAGAGGAGACAGGG + Intronic
989552704 5:42755109-42755131 TTGGAAGTACAGATGAGGCAGGG + Intergenic
992908236 5:81369609-81369631 CTGGAAAGTCAGTGGAGGCTAGG + Intronic
993016305 5:82538660-82538682 TGGGAAAGACAGAGGAGGATTGG - Intergenic
993954109 5:94211548-94211570 CTGGAAATACAGTCCAGGATGGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
997690605 5:135825413-135825435 CTGCAGAGACAGAGGAGGCAAGG + Intergenic
998193376 5:140045039-140045061 ATGGCAATACAGAGGAGGAAGGG - Intergenic
1000276077 5:159735852-159735874 CTGTAAAAACAGAGGAGCCAAGG - Intergenic
1000613150 5:163397452-163397474 TTAGAAATACAGAGGATGGTTGG - Intergenic
1001260860 5:170227389-170227411 ATGGAAACACAGAAGGGGCTGGG + Intergenic
1002296754 5:178235638-178235660 CTGGAACTCCAGAGGCGGCATGG + Intergenic
1002341997 5:178522975-178522997 CTGGACATAGATGGGAGGCTGGG - Intronic
1002646043 5:180655521-180655543 TAAGAAATACAGACGAGGCTGGG - Intergenic
1002648316 5:180673377-180673399 CAGGCAAATCAGAGGAGGCTCGG - Intergenic
1002850855 6:995375-995397 CTGGAACTGCAGTGAAGGCTTGG + Intergenic
1003511343 6:6783564-6783586 CTGGAAATGCAGAGGCAGATAGG - Intergenic
1004627607 6:17391718-17391740 CTGGAAAGAGATAGGAGGCAGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006388687 6:33746404-33746426 CTGGGACTACAGAGGAAGCTGGG - Intronic
1007227513 6:40325395-40325417 CTGGAGTTGCAGAGGAGGGTGGG + Intergenic
1007323899 6:41045916-41045938 CTGGAGATACAAAGGTGGGTGGG - Intronic
1008395639 6:51003586-51003608 CTGGAGAAAGAGAGGAGGCATGG + Intergenic
1008909209 6:56715363-56715385 GGGGAAATACTTAGGAGGCTTGG - Intronic
1009339542 6:62536799-62536821 CTTGGAAAACAGAGCAGGCTGGG - Intergenic
1012355218 6:98306208-98306230 TTGGAAATTCAGAAAAGGCTTGG + Intergenic
1014852707 6:126361588-126361610 ATAGAAATACAAAAGAGGCTGGG - Intergenic
1016220651 6:141666407-141666429 TTAGAAATACAGAGTAGACTGGG - Intergenic
1018168963 6:161128886-161128908 CTGTTAATTCAGGGGAGGCTGGG - Intergenic
1019052421 6:169193255-169193277 GAGGAAATACAGAGTGGGCTTGG - Intergenic
1019486052 7:1289684-1289706 CTGGAAATACAGAGAATTTTAGG - Intergenic
1021433305 7:20585817-20585839 CTTGAAATACAAAGGATCCTTGG - Intergenic
1021698413 7:23295294-23295316 AGAGAAATACAGAGCAGGCTGGG - Intergenic
1022891235 7:34702076-34702098 GTAGAAATACAGAGGAGCCTGGG - Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1024697699 7:51873196-51873218 CTGGAAAAACTGAGGTGACTAGG - Intergenic
1024916225 7:54503229-54503251 CAGGAAATACAGAGAACGCCTGG - Intergenic
1025300856 7:57818886-57818908 CTGGGAATAAGGAGGAGGCCTGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1026739440 7:72969591-72969613 CTGGAACTACAGAGGTCGCACGG - Intergenic
1026931533 7:74225454-74225476 CTGGAAACAGACAGGAGGCAGGG + Intronic
1027104291 7:75395482-75395504 CTGGAACTACAGAGGTCGCACGG + Intronic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1031828739 7:126600234-126600256 CTGGAAATACAGTTGACCCTTGG + Intronic
1036259607 8:7229307-7229329 CAGGAAAGACAGGGGAGACTGGG + Intergenic
1036307010 8:7610217-7610239 CAGGAAAGACAGGGGAGACTGGG - Intergenic
1036311650 8:7687877-7687899 CAGGAAAGACAGGGGAGACTGGG + Intergenic
1036357858 8:8058204-8058226 CAGGAAAGACAGGGGAGACTGGG - Intergenic
1036358922 8:8064346-8064368 CAGGAAAGACAGGGGAGACTGGG - Intergenic
1036701620 8:11016828-11016850 CTGGAAAAACAGAAGAGGAGAGG - Intronic
1036893091 8:12608742-12608764 CAGGAAAGACAGGGGAGACTGGG + Intergenic
1036900652 8:12666728-12666750 CAGGAAAGACAGGGGAGACTGGG + Intergenic
1037503646 8:19509202-19509224 CTGGTTATACTGAAGAGGCTGGG + Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038714677 8:29981089-29981111 CTGGAGATTCTGAGGGGGCTGGG + Intergenic
1038719523 8:30021459-30021481 AAAGAAACACAGAGGAGGCTGGG + Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1038895968 8:31782389-31782411 CAGGTAATACAGAGCAGGGTGGG - Intronic
1039430240 8:37520050-37520072 CTGGAGATACAGTGATGGCTGGG - Intergenic
1040456677 8:47605167-47605189 CTGAGGAGACAGAGGAGGCTGGG + Intronic
1041032798 8:53755204-53755226 CTGGAGATACAGGGGAGGTAGGG - Intronic
1041390707 8:57345004-57345026 CAGGAAATACACAGGAGTGTTGG - Intergenic
1041521823 8:58765210-58765232 CTGGAAACACAGAGGAGAAGAGG + Intergenic
1043307931 8:78820241-78820263 CTGGAAATAAAGGACAGGCTGGG + Intergenic
1043427760 8:80165529-80165551 CAGGAAAAAGAGAGGAGGTTTGG - Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044293536 8:90500773-90500795 CTGGCTATACAGAGAAGGCTGGG - Intergenic
1044587021 8:93877516-93877538 CTGTCAATAGAGTGGAGGCTAGG + Intronic
1044834078 8:96278818-96278840 CTTGAAGTACAGATAAGGCTGGG - Intronic
1044838702 8:96319591-96319613 CTGGAAATTCTTAGAAGGCTGGG + Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046850385 8:118965551-118965573 CTGTAAATGCAAAGGAGGTTGGG + Intergenic
1046983369 8:120360940-120360962 CTGGAGTTGCAGAGGAGGCAGGG - Intronic
1047373859 8:124277871-124277893 GAGGAAAAACAGTGGAGGCTTGG - Intergenic
1047536283 8:125722969-125722991 CTGGAAATAAGTAGGATGCTTGG - Intergenic
1047716605 8:127601572-127601594 TTGGAAAGACAGAGAAGGCCTGG + Intergenic
1048049000 8:130799620-130799642 CTGGAAATGCCTGGGAGGCTAGG + Intronic
1048575373 8:135685938-135685960 CTGGGAGTCCAGAGGAGGCTAGG - Intergenic
1048611495 8:136027873-136027895 CAGGAAAGACAGAGGTGGCTTGG + Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1055353355 9:75412353-75412375 CTGGGGCTACAGAGGAGGCCTGG + Intergenic
1055360400 9:75483576-75483598 CTGGAAATACAGTGGAGGAGAGG - Intergenic
1056579989 9:87883523-87883545 CAGATCATACAGAGGAGGCTGGG - Intronic
1057511531 9:95683687-95683709 CTAAAAATACAAAGGAGGCTGGG + Intergenic
1058190085 9:101903323-101903345 CTGGGAATCCAGAGGAGTCCTGG + Intergenic
1058703758 9:107622115-107622137 CTGGAAGGACAGAGAAGGCCCGG - Intergenic
1059364017 9:113771327-113771349 CTGGCAAGACAGAGGAAGATTGG + Intergenic
1059725947 9:117008177-117008199 CTGGTAATACAGGGAAAGCTTGG + Exonic
1059822773 9:117992370-117992392 GTGGAAATGGAGAGGAGGCAGGG + Intergenic
1060104819 9:120866966-120866988 CTGGAGAGACAGAGGAGCCAAGG + Intronic
1062002399 9:134223122-134223144 CTGGAAATAGAAAGCAGGCCAGG - Intergenic
1062547770 9:137071289-137071311 CTGGAAACACAGCAGAGGCAGGG - Intergenic
1062694282 9:137865211-137865233 CTGGACACAGAGAGGGGGCTGGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1188702541 X:33282499-33282521 CAGGAAATACTTAGGTGGCTGGG - Intronic
1189146698 X:38662487-38662509 CTGGATATGCACAGGAGGATGGG + Intronic
1191174148 X:57482018-57482040 CTGAAAGCACTGAGGAGGCTGGG - Intronic
1192271867 X:69588504-69588526 AGGGATATACAGAGGAGACTTGG - Intergenic
1194953309 X:100152588-100152610 CTGGAAAAACCGAGGTGACTAGG - Intergenic
1195711938 X:107780037-107780059 CTAAAAATTCAGGGGAGGCTGGG - Intronic
1195915263 X:109929172-109929194 ATGGAAATACAGAGGAAAATTGG + Intergenic
1196821057 X:119701077-119701099 CTGGAACTCAAGAGAAGGCTGGG + Intergenic
1196960289 X:120993311-120993333 CAGGAAACACACAGGAGGTTGGG - Intergenic
1198594945 X:138226083-138226105 CTGGAGATACAGAGGTGAGTTGG + Intergenic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1200134694 X:153869228-153869250 CTGGAACTTCAGGGAAGGCTGGG - Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic