ID: 903516390

View in Genome Browser
Species Human (GRCh38)
Location 1:23913759-23913781
Sequence GGATCCTGGTGTGGGGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903516382_903516390 6 Left 903516382 1:23913730-23913752 CCTACAGGCAGATTAACATAATG 0: 1
1: 0
2: 0
3: 12
4: 205
Right 903516390 1:23913759-23913781 GGATCCTGGTGTGGGGCAATAGG 0: 1
1: 0
2: 1
3: 16
4: 252
903516380_903516390 28 Left 903516380 1:23913708-23913730 CCAGAGCTTTGAAATGCAAATGC 0: 1
1: 0
2: 2
3: 14
4: 288
Right 903516390 1:23913759-23913781 GGATCCTGGTGTGGGGCAATAGG 0: 1
1: 0
2: 1
3: 16
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903516390 Original CRISPR GGATCCTGGTGTGGGGCAAT AGG Intergenic
900115245 1:1025419-1025441 GGAGCCTGGTCTGGGGCTGTCGG - Intronic
901744110 1:11361226-11361248 TGAGCCTGGGGTGGGGCATTTGG + Intergenic
903516390 1:23913759-23913781 GGATCCTGGTGTGGGGCAATAGG + Intergenic
905569175 1:38990940-38990962 GGGGCCTGGTGAGGGGCCATGGG - Intergenic
906277035 1:44524108-44524130 GGATGCTGGAGGGGGGCAAAGGG + Intronic
906523242 1:46479427-46479449 GGAGCCTGGGGTGGGGAACTGGG + Intergenic
907899314 1:58722841-58722863 AGATCCTGGTGTGGAGGAAGAGG + Intergenic
908487813 1:64612117-64612139 GAAACCTGGTATGAGGCAATTGG - Intronic
910290983 1:85600182-85600204 GGGACCTGGTGGGAGGCAATTGG + Intergenic
910538164 1:88323705-88323727 GGGGCATGGTGTGAGGCAATTGG - Intergenic
910543589 1:88388893-88388915 CAATCCTGGGGTGGGGCAACAGG + Intergenic
910744455 1:90558270-90558292 GCATCCTGGTGTGGGGGCACAGG + Intergenic
911370007 1:96985429-96985451 GGGTACTGGTGTGGAGAAATAGG - Intergenic
913296639 1:117327964-117327986 GGAAAGTGGTGTGGGGAAATGGG - Intergenic
913610593 1:120506222-120506244 GGATCCAGGAGTGGGGCCACTGG - Intergenic
914580597 1:149016017-149016039 GGATCCAGGAGTGGGGCCACTGG + Intronic
916405779 1:164496786-164496808 GTCTCCTGGTCTTGGGCAATAGG - Intergenic
916666770 1:166974375-166974397 GAATCCTCATGTGGGGAAATAGG + Intronic
916860674 1:168801198-168801220 GGAACCTGGTGGGGGGTGATTGG - Intergenic
919942250 1:202296245-202296267 GGGTCCTGGGGTTTGGCAATAGG - Intronic
920216657 1:204365953-204365975 GGAACCAGGTGTGTGGAAATGGG + Intronic
920292169 1:204930851-204930873 GGAGGCTGGTGTGGGGATATAGG + Intronic
920917918 1:210272932-210272954 GGATCCTGGCCAGGGGCTATGGG - Intergenic
921021692 1:211241587-211241609 GGATATTGGTGTGGGGATATAGG - Intergenic
924451377 1:244182014-244182036 GCATCCTGGAGTTGGACAATTGG - Intergenic
1062768272 10:81473-81495 GGATCCTTCTGTGGGGCCACAGG + Intergenic
1064322031 10:14314410-14314432 GCATCCTGGTGAGGGGTTATGGG + Intronic
1066006998 10:31154678-31154700 GGGGCCTGGTGCGGGGCATTTGG - Intergenic
1066295734 10:34052672-34052694 GGGGCCTGGTGGGGGGCGATTGG + Intergenic
1068887716 10:62114694-62114716 GGATCCTGGTGTTTGGTCATGGG - Intergenic
1070316760 10:75320997-75321019 GGGGCCTGGTGGGAGGCAATTGG + Intergenic
1070555144 10:77521781-77521803 GGATCCTGGTGTTGGGAGATGGG - Intronic
1074946482 10:118285481-118285503 GGATCCTGGTGAGAGGTGATTGG - Intergenic
1075213168 10:120508952-120508974 GGATCCTGTTGGTGGGCAGTTGG + Intronic
1075266240 10:121001511-121001533 GGCTCCTGCTCTGGGACAATGGG + Intergenic
1077284981 11:1761648-1761670 GCAACCTGGCGGGGGGCAATGGG - Intronic
1077437335 11:2549264-2549286 GGATGCTGGGGTGGGGCTATGGG + Intronic
1078450392 11:11436533-11436555 GCATCATGGTGTGAGGCAGTGGG - Intronic
1078632496 11:13016035-13016057 GGATCTTTGTGTGTGGCATTAGG + Intergenic
1079881715 11:25936194-25936216 GGAGCCTGGTGGGAGGCGATGGG + Intergenic
1082044647 11:47715103-47715125 GGAACCTGGTCTGGGGCAGGTGG + Intronic
1082692441 11:56323212-56323234 GGAACCTGGTGGGAGGCGATTGG + Intergenic
1083233560 11:61338135-61338157 GTATCCTGGGGTGGGGCAGGGGG + Intronic
1083750808 11:64759623-64759645 GGAGCCTGGGGTGGGGGTATGGG - Intronic
1089746310 11:120619582-120619604 GGATCCTGGTGGGAGGTGATTGG + Intronic
1090187710 11:124749079-124749101 GGTTCCTGGTTTGGGGTAAAAGG + Intronic
1091553023 12:1551075-1551097 GGTTCCTGGTGTGAGGTGATTGG + Intronic
1092280350 12:7093162-7093184 GGATGCGGGTGTGGAGCAAGAGG + Intronic
1098039725 12:66341704-66341726 GGATCCTGGTGGGAGGTGATTGG + Exonic
1098238761 12:68444018-68444040 GGATCATGGTGGGAGGCAAAAGG + Intergenic
1098437103 12:70479560-70479582 GGGACCTGGTGGGAGGCAATTGG + Intergenic
1101806478 12:108068589-108068611 GGATTTTGGTGGGGGGCAATGGG + Intergenic
1103415555 12:120739866-120739888 GGGTCCTGGTGTTGGGCAGGTGG + Exonic
1103860446 12:124008335-124008357 GCCTCCTGCTGTGGTGCAATGGG - Intronic
1104132536 12:125908388-125908410 GGGTAGTGGTTTGGGGCAATGGG + Intergenic
1105837768 13:24225595-24225617 GCATGCTGGAGTGGGGCAGTGGG - Intronic
1107071580 13:36275825-36275847 GGAAAATGGTGTGGGGCAACAGG + Intronic
1107307485 13:39038104-39038126 GGGTCCTGGTGTGGGAATATAGG + Intergenic
1107432117 13:40349566-40349588 TAATCCTGGTCTGGGGCAATTGG + Intergenic
1107876330 13:44793928-44793950 GGATCCTGGTGGGAGGTGATTGG - Intergenic
1108324822 13:49319431-49319453 GGATGGAGGTGAGGGGCAATGGG + Intronic
1109823744 13:67691429-67691451 GAATCATGGTGTGAGGCAAAAGG + Intergenic
1110302028 13:73939906-73939928 TGATCCTGGTGAGGAGCAAGGGG - Intronic
1111318507 13:86592871-86592893 GGGTCCTGGTGGGAGGTAATTGG - Intergenic
1112263266 13:97898152-97898174 GGAACCTGGTGGGAGGCGATTGG - Intergenic
1113920905 13:113909096-113909118 GGCTCCAGGTGTGGGGCCAAGGG - Intergenic
1114461026 14:22886367-22886389 GGATCCTCGAGTGGGGCATTGGG - Intronic
1114881194 14:26788346-26788368 GGAGCCTGGTGAGAGGCAATTGG + Intergenic
1115070566 14:29317422-29317444 AGATCCTGGGGTGGGTCAATGGG + Intergenic
1116076479 14:40117600-40117622 GGGACCTGGTGGGAGGCAATTGG + Intergenic
1116677411 14:47923604-47923626 GAATTCTGGTGTGGTGCAAAGGG - Intergenic
1121715524 14:96071305-96071327 GGGACCTGGTGGGGGGTAATTGG - Intronic
1122693480 14:103542214-103542236 ACCTCCTGGTGTGGGGCAAAGGG - Intergenic
1126154139 15:45549336-45549358 GGAGGCTGGTGTTGGGCAAACGG - Intergenic
1126183619 15:45809978-45810000 GATTTCTGGTGTGGGGGAATGGG + Intergenic
1126309299 15:47297820-47297842 GGAGCCGGGGATGGGGCAATGGG + Intronic
1132457172 16:30604-30626 GGATCCTTCTGTGGGGCCACAGG + Intergenic
1132732212 16:1368004-1368026 GGGTCCAGGAGTGGGGCAAGGGG - Intronic
1133267849 16:4595307-4595329 GGAGACTGGGGTGGGGCAGTGGG + Intronic
1135995459 16:27244523-27244545 GGAGCTTGGTGTGGGGGAGTGGG - Intronic
1137714993 16:50593123-50593145 GGAGGATGGTGTGGGGCGATGGG - Intronic
1138089524 16:54162904-54162926 GGAGCCTGGTGGGAGGCAATTGG - Intergenic
1138517174 16:57542579-57542601 GGGTGCAGGTGTGGGGCAAAGGG + Intronic
1138594966 16:58025054-58025076 GGCTCCTGGCCTGGCGCAATAGG - Intergenic
1140272657 16:73480624-73480646 GCATCCTGCTGTGGGGAAACAGG - Intergenic
1141143349 16:81512263-81512285 GGACCCTGGAGTGAGGCAACTGG - Intronic
1141393882 16:83687536-83687558 GGAGCCTGGTGGGAGGCGATGGG - Intronic
1141427618 16:83953910-83953932 GGCTCCAGGTGTGCGGCACTGGG + Intronic
1141796249 16:86277198-86277220 GGGACCTGGTGAGAGGCAATTGG - Intergenic
1142372712 16:89691900-89691922 GGGGCCTGGGGTGGGGGAATGGG + Intronic
1144532037 17:16048914-16048936 GGAACCTGGGGTGGGGAGATGGG + Exonic
1146173450 17:30650021-30650043 GGGTCCTGGTGCGGGGGAGTCGG + Intergenic
1146316791 17:31813619-31813641 CTATCCTGGTGTGGGGACATTGG + Intergenic
1146346907 17:32066051-32066073 GGGTCCTGGTGCGGGGGAGTCGG + Intergenic
1147723015 17:42550245-42550267 GGAGCTTTGTGTGGGGCACTAGG + Exonic
1147724227 17:42556472-42556494 GGAGCTTTGTGTGGGGCACTGGG + Intergenic
1148793650 17:50187118-50187140 GGACCCTGGAGTGGGGGAAATGG + Exonic
1151823846 17:76512666-76512688 TGCTGCTGGTGTGGGGCCATCGG + Intergenic
1152304621 17:79513356-79513378 GCATCCTGGTGTGGGCCACCTGG - Intronic
1152961158 18:81328-81350 GGATCCTTCTGTGGGGCCACAGG + Intergenic
1153614726 18:6923865-6923887 GGACCCTGCTGTGCAGCAATGGG - Intergenic
1155120338 18:22812875-22812897 GGAACCAGGTGTCTGGCAATTGG + Intronic
1156026816 18:32664156-32664178 GGAGCCTGGTGGGAGGGAATTGG - Intergenic
1156398152 18:36717630-36717652 GGGTCCTGGTGTGGGTCTTTGGG + Intronic
1161175782 19:2841595-2841617 GGATCCCGGTGCGGGGCAGCAGG + Intronic
1161663881 19:5563322-5563344 GGACCTTGGTGGGGGGCAACTGG + Intergenic
1162217407 19:9147884-9147906 GGGGCCTGGTGGGGGGCGATTGG + Intronic
1162345736 19:10117035-10117057 GCATCCTGGGGTGGGGCAAAGGG - Intronic
1162988972 19:14290039-14290061 GGGTCCTGGTGCGGGGGAGTCGG - Intergenic
1163726961 19:18928412-18928434 GGGTTCTGCTGTGGGGCACTGGG - Exonic
1163822258 19:19502667-19502689 GTATCCTGGTTAGGGGCAAGAGG - Intronic
1164749644 19:30643133-30643155 GGATCCTGTGGTGGGGGAACGGG + Intronic
1165008256 19:32823904-32823926 AGAGCCTGGTGTGGGGCCCTCGG + Intronic
1165479016 19:36050807-36050829 GGACCCTGGTGTAGGGCCAAAGG - Intronic
1166213963 19:41323880-41323902 GGAGCCGGGTGTGGGGGCATGGG - Exonic
1166555955 19:43699993-43700015 GGACCCTGGTGTGAGGAAAGAGG - Intergenic
1168492541 19:56822762-56822784 GGTTCCTGGTGTGGGACCAGCGG + Exonic
1202639540 1_KI270706v1_random:69684-69706 GGAACCTGGTCAGGGGCAGTTGG - Intergenic
924972518 2:141954-141976 GGGGCCTGGTGGGAGGCAATTGG - Intergenic
925567979 2:5277195-5277217 GGAGCCTGGTGAGGGGTATTTGG + Intergenic
925916550 2:8611073-8611095 GGGACCTGGTGGGAGGCAATTGG - Intergenic
926133533 2:10320319-10320341 GGAGCCTGGTGGGGGGTGATTGG + Intronic
926247759 2:11133385-11133407 GTGGCCTGGTGGGGGGCAATCGG - Exonic
926275371 2:11399504-11399526 GGAGCCTGGTGGGAGGCGATTGG + Intergenic
926702252 2:15811339-15811361 GGAGCCTGGTGGGGGGGAAGGGG + Intergenic
927088939 2:19695827-19695849 GGAGCTTGGAGTGGGGCAGTTGG - Intergenic
927214555 2:20660704-20660726 GGATCCTGGTGTCTGGGGATTGG - Intergenic
928120521 2:28580741-28580763 GGACCCTGGTGTGTGGGAAAGGG + Intronic
933989242 2:87621798-87621820 GGATGCTGATGTGGGGAAAATGG + Intergenic
935449009 2:103188229-103188251 GAATCATGGTGTGAGGCAAAAGG - Intergenic
936304601 2:111329028-111329050 GGATGCTGATGTGGGGAAAATGG - Intergenic
936474506 2:112828101-112828123 GGGGCCTGGTGTGGGGTGATTGG - Intergenic
937922208 2:127138422-127138444 GGACCCTGCTGTTGGGCAGTGGG - Intergenic
939784790 2:146495566-146495588 GGATCCTGGTGGGAGGCAATTGG - Intergenic
940607240 2:155941679-155941701 GGGACCTGGTGTGAGACAATTGG - Intergenic
943283950 2:185972741-185972763 GGGTTCTGGTGGGAGGCAATTGG + Intergenic
944370849 2:198981828-198981850 GGATCCTGGTGGGAGGTTATTGG + Intergenic
947913800 2:233819216-233819238 GGAGCCTGGAGTGGGGCCATGGG + Intronic
1170122154 20:12923189-12923211 GGGGCCTGGTGGGAGGCAATTGG + Intergenic
1172056679 20:32159023-32159045 GGAGCCTGGTGTGTGGAAAGGGG + Intronic
1172274407 20:33671946-33671968 GGCTCCTTGTGTGAGGCACTTGG - Intronic
1175409763 20:58759447-58759469 GGACCCTGGTTTGGGGGAAATGG - Intergenic
1175477429 20:59286809-59286831 GGATGCTTGTGTAGGCCAATAGG - Intergenic
1175981612 20:62741512-62741534 GGAACATGGTGTGGGGCAGGGGG - Intronic
1175998639 20:62822229-62822251 GGAGCCTGGGGAGGGGGAATGGG - Intronic
1177517786 21:22177295-22177317 GGGGCCTGGTGGGAGGCAATTGG + Intergenic
1179094553 21:38300643-38300665 AGAGCTTGGTGTAGGGCAATTGG + Exonic
1179211014 21:39324299-39324321 GGAGCCTGGTGGGAGGTAATTGG + Intergenic
1180185033 21:46135273-46135295 GGATGCTGGTGTGGTGTAATTGG - Intergenic
1180362401 22:11912186-11912208 GGAACCTGGTCAGGGGCAGTTGG + Intergenic
1180799115 22:18623668-18623690 GGATCCTGGAGTGTGGCAGGAGG - Intergenic
1181222603 22:21371598-21371620 GGATCCTGGAGTGTGGCAGGAGG + Intergenic
1181638360 22:24184587-24184609 GGATCCTGGAGTGTGGCAGGAGG + Intronic
1184748746 22:46472340-46472362 GGCTCATGCTGTGGGGCAGTGGG + Intronic
1185088818 22:48754881-48754903 GGACCCTGGGGTGGGGACATGGG - Intronic
949128032 3:469966-469988 GGGTCCTGGTGGGAGGTAATTGG + Intergenic
949608160 3:5676758-5676780 GGATCCTGGTGGGAGGTGATTGG + Intergenic
950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG + Intergenic
950956076 3:17054696-17054718 GGGTCCTGGTGGGAGGTAATTGG - Intronic
951087500 3:18530949-18530971 GGGTCCTGGTGTGAGGTGATTGG + Intergenic
951272941 3:20649851-20649873 GGATCCTGGTGGGAGGTGATTGG + Intergenic
951292023 3:20882788-20882810 GGGTCCTGGTGAGGGGTGATTGG - Intergenic
952113781 3:30155624-30155646 CTATCCTGATGTGGGGCCATAGG + Intergenic
953010545 3:39021471-39021493 AGACCCTGGTGTGGGGAACTGGG + Intergenic
953066441 3:39476242-39476264 GGACCCTGGTGGGAGGCGATTGG - Intronic
954147981 3:48643673-48643695 GGGTCCTGCTGTGGGGACATGGG + Exonic
954461533 3:50629651-50629673 GGTCCCTGGTCTGGGGCACTGGG + Intronic
956214460 3:66834063-66834085 GGGACCTGGTGGGAGGCAATTGG - Intergenic
956855879 3:73274286-73274308 GGGCCATGATGTGGGGCAATAGG + Intergenic
957434311 3:80153983-80154005 GGGGCCTGGTGGGTGGCAATTGG + Intergenic
957656323 3:83081732-83081754 GGATCCTGGTGGGAGGTGATTGG - Intergenic
957914842 3:86675540-86675562 GGAGCCTGGTGGGAGGTAATTGG + Intergenic
961358446 3:126353046-126353068 GGATCCAGGCGTTTGGCAATAGG - Intronic
961492919 3:127267666-127267688 GGTACCTGGTGGGAGGCAATTGG + Intergenic
961883169 3:130077415-130077437 GGGGCCTGGTGGGAGGCAATTGG + Intergenic
964013174 3:151915134-151915156 GGAACCTGGTGTGAGGTAACTGG + Intergenic
965659937 3:171030317-171030339 GGATTCAGGTGAAGGGCAATGGG + Intergenic
966296691 3:178432281-178432303 GGATCATGGGGTGGGGCACGGGG + Intronic
967551660 3:190801965-190801987 GAATCATGGTGTGAGGCAAAAGG - Intergenic
967567246 3:190987232-190987254 GGAACCTGGTGGGAGGTAATTGG + Intergenic
967626695 3:191694161-191694183 GGATCCAGGGGTGTGGCAGTGGG + Intergenic
969103473 4:4787531-4787553 GGAGCCTGGTGGAAGGCAATTGG + Intergenic
969963266 4:10968694-10968716 TGATCCGTGGGTGGGGCAATGGG - Intergenic
969996933 4:11322976-11322998 GGGGCCTGGTGGGAGGCAATTGG + Intergenic
971043278 4:22778551-22778573 GGATCCTGTGCTGGGGCCATGGG + Intergenic
971118668 4:23679491-23679513 GGGGCCTGGTGGGTGGCAATAGG + Intergenic
971465293 4:26951942-26951964 GGATCATGGTGGGAGGCAAAAGG + Intronic
971858796 4:32078543-32078565 GGAACCTGGTGGGAGGTAATTGG - Intergenic
972096841 4:35358444-35358466 AGAACCTGGTGTCGGGGAATAGG - Intergenic
972847290 4:43005031-43005053 GGAACCTGGTGGGAGGCAATTGG + Intronic
973790549 4:54374280-54374302 GGCTCCTGGAGTGGAGCAGTAGG + Intergenic
974209166 4:58747172-58747194 GGGTCCTGGTGGGAGGCATTTGG + Intergenic
976463755 4:85344078-85344100 GGGTCCTGGTGGGAGGCAATTGG - Intergenic
976985103 4:91284640-91284662 GGATGCTGGTGTGGGAAAAGAGG - Intronic
979765411 4:124459759-124459781 AGATCCTGCTGTGGTGCATTAGG - Intergenic
981805139 4:148706777-148706799 GGGGCCTGGTGGGAGGCAATTGG + Intergenic
982486125 4:155968007-155968029 GGGTCCTGGTGGGAGGCGATTGG + Intergenic
983567006 4:169163945-169163967 TGATTCTTGTGTGGGTCAATAGG + Intronic
984599720 4:181712267-181712289 GGATCCTGGTGGGAGGTGATTGG + Intergenic
985035373 4:185834281-185834303 GGAGCCTGGTGGGAGGTAATTGG - Intronic
986338210 5:6770170-6770192 GGATCTGGGAGTGGGGCAAGGGG + Intergenic
986512070 5:8517795-8517817 GGGACCTGGTGGGAGGCAATTGG - Intergenic
987761736 5:22172389-22172411 AGATCCTGATGTGTGTCAATTGG - Intronic
988037287 5:25843754-25843776 GAATCATGGTGCGGGGCAAAAGG + Intergenic
988074920 5:26339889-26339911 GGGTCCTGGTGGGAGGTAATTGG - Intergenic
988134757 5:27156870-27156892 GCAGCCTGGTGGGAGGCAATTGG + Intergenic
988211375 5:28209212-28209234 GGAGAATGGTGTGGGGCCATGGG + Intergenic
988550155 5:32193572-32193594 GGACCGAGGTGAGGGGCAATGGG - Intergenic
989008331 5:36840625-36840647 GGAGCCTGGTGGGAGGCGATTGG - Intergenic
991896519 5:71405828-71405850 AGATCCTGATGTGTGTCAATTGG - Intergenic
993009095 5:82459331-82459353 AGATCCTGGTGTAGGGCAGGGGG + Intergenic
994568658 5:101485083-101485105 GGGACCTGGTGGGAGGCAATTGG - Intergenic
995864884 5:116680273-116680295 GGAGCCTGGGGTGTGGGAATGGG - Intergenic
996480784 5:123973089-123973111 GGAGCCTGGTGGGAGGTAATTGG - Intergenic
997305863 5:132835987-132836009 GGGTCCTAGTGGGAGGCAATTGG + Intergenic
997335662 5:133107395-133107417 GGGTTCTGTTGTGGGGCAGTGGG + Intergenic
997389528 5:133502513-133502535 GGGGCCTGGTGGGAGGCAATTGG + Intronic
997689481 5:135816185-135816207 GGAACCTGGTGGGAGGTAATTGG - Intergenic
1004252682 6:14034906-14034928 GGAGCCTGGCTTGGGGAAATGGG + Intergenic
1006747042 6:36350297-36350319 GGCTCCTGGTGTGTGGCATTTGG - Intergenic
1006869996 6:37242835-37242857 GGATACTGGTGTGAGTCACTGGG - Intronic
1007272829 6:40651175-40651197 GTATCCTGCTGTGGGTCAATGGG + Intergenic
1007703967 6:43780174-43780196 GAATCCCGGTGTGGGGGAAGCGG - Intronic
1007992378 6:46270296-46270318 GGACCTTGCTGAGGGGCAATGGG + Intronic
1011240615 6:85267803-85267825 GGGTGCTGGTGTGGGGCAGGAGG - Intergenic
1011435691 6:87334168-87334190 GGAGCCTGGTGGGAGGCATTTGG - Intronic
1011957744 6:93044333-93044355 GGCTCCTGGAGTGAGGAAATTGG - Intergenic
1014771293 6:125460135-125460157 GGGCCCTGGTGGGAGGCAATTGG - Intergenic
1014884033 6:126757647-126757669 GGAACCTGGTGGGAGGAAATTGG - Intergenic
1015116441 6:129654748-129654770 GGATCCAGGTGTGTAGCGATGGG - Intronic
1020669130 7:11083932-11083954 GGATGCCCGTCTGGGGCAATAGG + Intronic
1021537961 7:21726332-21726354 GGGGCCTGGTGTGGGGTGATTGG - Intronic
1022492407 7:30831103-30831125 GGATACTGGTGAGGGGCTCTTGG + Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024339213 7:48239898-48239920 GGATGTTGGTGTGGGGCAGAGGG + Intronic
1025035363 7:55590096-55590118 GCACCCTGGCGGGGGGCAATGGG - Intergenic
1025834929 7:65085525-65085547 GAGTCCTGGTCTGGGGCACTGGG + Intergenic
1025904699 7:65775004-65775026 GAGTCCTGGTCTGGGGCACTGGG + Intergenic
1028719349 7:94011814-94011836 GGATCCTGCAGTGGGGCCACAGG + Intergenic
1029447999 7:100625506-100625528 TGACCCTGGGGTGAGGCAATAGG - Intronic
1031375757 7:121023786-121023808 GGGTGCTGGTGTGGGGCTAGAGG - Intronic
1032051043 7:128651315-128651337 GGAGGCTGTTGTGGGGCAGTAGG - Intergenic
1034877652 7:154739441-154739463 GGACACTGCTGTGGGGGAATGGG + Intronic
1036946425 8:13099307-13099329 GCCTCCGGGTGTGGGGCACTGGG - Intronic
1044117744 8:88355160-88355182 GGATCCTGGTGGGAGGTGATTGG - Intergenic
1047747422 8:127855350-127855372 GGGTCCCGGTGTGCGGAAATTGG + Intergenic
1048826952 8:138437338-138437360 GGAACCTGGTGGGAGGTAATTGG + Intronic
1048925405 8:139266772-139266794 GGGTACTGGGGTGGGGCCATTGG - Intergenic
1049338092 8:142097124-142097146 GGTGCCTGTTGTGGGGAAATGGG - Intergenic
1049509540 8:143020575-143020597 TGGTCCTGGGGTGGGGGAATGGG - Intronic
1050131933 9:2422103-2422125 GGGTCCTGGTGGGAGGTAATTGG - Intergenic
1053055654 9:34991747-34991769 ACATGCTGGTGGGGGGCAATGGG + Intronic
1054914520 9:70483561-70483583 GGGTCCTGGTGGGAGGCAATTGG + Intergenic
1056835121 9:89948581-89948603 GGAGCCTGGTGAGAGGCGATTGG - Intergenic
1056919593 9:90774440-90774462 GTTTCCTTGTGTGGGGCAGTGGG - Intergenic
1057783090 9:98065899-98065921 GAATCATGGTGGGGGGCAAAAGG - Intronic
1060039004 9:120283670-120283692 AGACCCAGGTGTGGGGCAAATGG - Intergenic
1061245997 9:129401561-129401583 GGATCCAGTAGTGGGGCAAGGGG + Intergenic
1061375589 9:130222603-130222625 TGATCCTGGGCTGGGGCAGTGGG - Intronic
1061750005 9:132770763-132770785 GGATCCAGGGGAGGGGGAATGGG - Intronic
1062737001 9:138142808-138142830 GGATCCTTCTGTGGGGCCACAGG - Intergenic
1203547649 Un_KI270743v1:140416-140438 GGAACCTGGTCAGGGGCAGTTGG - Intergenic
1185841553 X:3396559-3396581 GGGGCCTGGTGGGAGGCAATTGG - Intergenic
1198153379 X:133933312-133933334 GGAACATGGTGTGGGGCAGGTGG + Intronic
1199403646 X:147429897-147429919 GGGTCCTGGTGGGAGGTAATTGG - Intergenic
1199554479 X:149091491-149091513 GGATTTTGGTGTGGGAAAATTGG - Intergenic
1200309174 X:155059787-155059809 GGATCCTGGTGAGAGGTGATTGG + Exonic
1200399186 X:156008781-156008803 GGATCCTTCTGTGGGGCCACAGG - Intronic
1201377860 Y:13341725-13341747 CGATACTGGTGTGGAGCATTCGG + Intronic
1201628230 Y:16039108-16039130 GGAGCCTGGTGGGAGGTAATTGG - Intergenic