ID: 903523106

View in Genome Browser
Species Human (GRCh38)
Location 1:23969926-23969948
Sequence TGCCTGCCTCTTTATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 2, 2: 3, 3: 16, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903523106 Original CRISPR TGCCTGCCTCTTTATGAGGG AGG (reversed) Intronic
900886824 1:5421143-5421165 TGCATGCCTCCTTATCATGGAGG + Intergenic
902360141 1:15937911-15937933 TCCCTGCCCCTTTCTGAAGGAGG + Exonic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
903852280 1:26315310-26315332 TGGCTGCCTCTTTGTAAGAGGGG + Intronic
904524436 1:31122171-31122193 TGCATGCCTTTTTTGGAGGGGGG - Intergenic
905379735 1:37553252-37553274 TGCCTGGATCTTTAAGAGGTTGG + Intronic
905904437 1:41608467-41608489 TGCCTGCCTCTTTGTGAAGAAGG + Intronic
908159466 1:61392522-61392544 GCCATGGCTCTTTATGAGGGTGG - Intronic
909681454 1:78296003-78296025 TGCCTGACTTTTTATGAGGGAGG + Intergenic
911474139 1:98355706-98355728 TGTCAGCCTCTTTCTGAGGCTGG - Intergenic
915717155 1:157955473-157955495 TGCCTGCCATTATATAAGGGTGG + Intergenic
915909847 1:159908186-159908208 TGCCTCCCTACTTATCAGGGTGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
918290307 1:183101011-183101033 TGCCTGGTTCTTTCAGAGGGTGG + Intronic
921453323 1:215336455-215336477 TGGTTGGCTCTTTATGATGGGGG - Intergenic
922903613 1:229157272-229157294 TGCCTGTCTCTTTATCTAGGTGG - Intergenic
923533689 1:234831664-234831686 TGCCTGCTTTTTTTTGGGGGGGG - Intergenic
1065616291 10:27528239-27528261 TGCCAGCCTTTTTATTAGGCAGG - Intronic
1067745623 10:48933604-48933626 TGCATGCTTCTTTTTCAGGGAGG - Intronic
1068948672 10:62755443-62755465 TCACTGCAACTTTATGAGGGAGG - Intergenic
1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG + Intergenic
1071789397 10:88938419-88938441 TGCCTGCCTTCTAATGAGGAAGG + Intronic
1072348647 10:94535450-94535472 TGACTGCCTCTTTAGGAGTATGG + Exonic
1072801392 10:98394682-98394704 TGCCTTTTTCTTTATGAGTGAGG - Intronic
1073468237 10:103706895-103706917 TTCCTGCCTATTTATGAGGACGG + Intronic
1074113210 10:110437255-110437277 TGCCTGCCTGCTTCAGAGGGTGG + Intergenic
1075022280 10:118960646-118960668 TGCCTGCCTCTTCATGGGGCTGG + Intergenic
1075894495 10:125983407-125983429 TGCCTTCATCATCATGAGGGAGG - Intronic
1077955437 11:7014608-7014630 TGGCTGCCCCTTTAGGAGAGGGG + Intronic
1078139589 11:8682645-8682667 TCGCTTCCTCTTTCTGAGGGTGG - Exonic
1079940343 11:26672614-26672636 TTCCTCCCTCTTGTTGAGGGTGG + Intronic
1082973041 11:59043592-59043614 TGCCTACCTGTTTTTGAGGTCGG - Intergenic
1082977435 11:59087156-59087178 TGCCTACCTGTTTTTGAGGTCGG - Intergenic
1083484907 11:62977155-62977177 TCCCTGCTTCTTTCTGAGTGGGG + Exonic
1085703295 11:78764038-78764060 TGTCTGCGTCCTTATCAGGGAGG + Intronic
1087112954 11:94491608-94491630 TGCCTGACTCTTTATCTGTGAGG - Intronic
1087438030 11:98146959-98146981 TGCCTCCCTTTTTCTAAGGGTGG + Intergenic
1089667657 11:120030608-120030630 TTCCAGCCTCTTTAAGTGGGGGG - Intergenic
1090620512 11:128556590-128556612 TCCCTGCGTCTTTATGTGGGGGG - Intronic
1092146378 12:6217564-6217586 GGCCTGCTTCTTTATGGGGTGGG - Intronic
1093027411 12:14257677-14257699 TTTCTGCCTCTTTGTTAGGGCGG - Intergenic
1093809564 12:23474947-23474969 TGCATGCGTGTTGATGAGGGTGG - Intergenic
1094333108 12:29318127-29318149 TGCTAGCCCCTTTATAAGGGAGG + Intronic
1094465187 12:30746034-30746056 TGCCTGCTTCTCTTTGAGGTGGG - Intronic
1095271558 12:40224963-40224985 CGCCCGCCTGTTTATGAGGAAGG - Intronic
1096124716 12:49110720-49110742 TGCCTGCCCCTTTAAGGGCGGGG - Exonic
1098153006 12:67567463-67567485 GGCATGCCTCTTAAGGAGGGAGG - Intergenic
1100298779 12:93287770-93287792 TGCCAGCGTCTTTAGAAGGGAGG + Intergenic
1101708345 12:107241728-107241750 TGCTTTCCTTTTTATGATGGTGG + Intergenic
1101830132 12:108250554-108250576 TGCCTGTCTATTTTGGAGGGGGG + Intergenic
1102815616 12:115863298-115863320 TGCCTGCGTCTTTATGAAGGTGG - Intergenic
1105933346 13:25073755-25073777 TTCCTTCCTCTTTTTGAGGGGGG - Intergenic
1105969105 13:25412119-25412141 TGCCTGCCTGTCTCTGAGAGGGG - Intronic
1107819690 13:44275208-44275230 TGCTTGCTTCTTTATGAGGCTGG - Intergenic
1110883564 13:80603906-80603928 TGGCTGTCTCTTTATGACTGTGG + Intergenic
1112036036 13:95497501-95497523 TGCCTCCCTCTTTGTGTGGCTGG - Intronic
1112371964 13:98802120-98802142 TGCCTTCCTGTTTCTGAGGAAGG + Intronic
1113549743 13:111183678-111183700 TTATGGCCTCTTTATGAGGGAGG + Intronic
1113724821 13:112590510-112590532 TGCCTGTATCTTTGTGATGGTGG - Intergenic
1115410612 14:33069942-33069964 TACGTGCCTCTTTTTGAAGGTGG + Intronic
1117007417 14:51435979-51436001 TGCCTGCTTCCTGATGAGCGAGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1121337234 14:93084884-93084906 TTCCTGCCTCTTGATGAGGAAGG - Intronic
1122004558 14:98691325-98691347 TGCCTGTCTCTCTATGAGGTAGG - Intergenic
1122883225 14:104699397-104699419 TGCCTGGCTCTTCATGGTGGTGG + Intronic
1129695539 15:77738890-77738912 TGCCTGCTTCTTCATATGGGAGG - Intronic
1131401913 15:92131946-92131968 TCCCTGCAGCTTAATGAGGGAGG - Intronic
1133611865 16:7441116-7441138 TGCCTTCCTCTATATGAGGTGGG + Intronic
1136016119 16:27402268-27402290 TGCCTGCCTCTCCCTGAGTGTGG + Exonic
1139796074 16:69483942-69483964 TCCATGCCTCTTTCTGATGGAGG + Intergenic
1140023603 16:71262896-71262918 TTCCTGCCTCTTTCTGGGGTAGG - Intergenic
1140544600 16:75794581-75794603 TGGCTTCCTCTTTTTGAGAGTGG - Intergenic
1140820749 16:78660711-78660733 TGGCTGCCTCTTTTGGAGAGAGG - Intronic
1141167022 16:81667891-81667913 TGCCTCCCTCTTTATGTAGCAGG + Intronic
1144213642 17:13035771-13035793 TGCCTTTCTCTTTAATAGGGAGG + Intergenic
1145264207 17:21371762-21371784 TGCCTGCCTCCTGATGGGGCAGG + Intergenic
1146744469 17:35315102-35315124 TGCCTGCCTCTCTCTCAGAGAGG - Intergenic
1147957036 17:44141898-44141920 TGCCTGCCCCTTTAAGAAGGCGG + Exonic
1148037890 17:44682098-44682120 TGCCTGCTTCTCAATTAGGGTGG + Exonic
1148124939 17:45231645-45231667 TCCCTGCCTCTTTGTGTGAGTGG + Intronic
1156368159 18:36448589-36448611 CGCCTCCCTCTGTGTGAGGGAGG + Intronic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1160335207 18:78032705-78032727 CGCCTGCCTGATTATGAGGCGGG + Intergenic
1162580830 19:11529243-11529265 GGCCTGGCTCGTTATGAGGCGGG - Intergenic
1164525687 19:29011664-29011686 TGCCAGCCTCTTCCTGAAGGCGG + Intergenic
1164834439 19:31348853-31348875 GGCCTGGCTCTTTCTGTGGGTGG - Intronic
1166062766 19:40336921-40336943 TCCATGCCTCTCTCTGAGGGAGG - Intronic
1166711706 19:44941963-44941985 TGCCTCCCACTTTATGGAGGAGG + Intergenic
1167121504 19:47520133-47520155 TGCCTCCCTTTTTAAGAGTGAGG - Intergenic
926118399 2:10227602-10227624 TGCTTGCCTGTCTATGGGGGAGG + Intergenic
926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG + Intronic
927178310 2:20425598-20425620 TGTCTGCCTCTCTTTGAGGTGGG - Intergenic
928168498 2:28988201-28988223 TGCCTCCATCTTTATTAGGAGGG - Intronic
931239203 2:60437609-60437631 TGGGTGCCTCTCTCTGAGGGAGG - Intergenic
936252302 2:110876270-110876292 TGCCTGCCTCTCTCTGGGTGTGG - Intronic
937336374 2:121064801-121064823 TGCCTTCTTCATTATCAGGGTGG - Intergenic
937361162 2:121231120-121231142 TGTCTGCCTCTATATGATGTGGG - Intronic
942646607 2:178117674-178117696 TGCCTACCTCTTTATTAAAGAGG - Intronic
948229893 2:236342067-236342089 TTCCTGCCTCTTATTGCGGGAGG + Intronic
948653876 2:239464979-239465001 TGCCTGCCACTGTCTGGGGGCGG + Intergenic
948689803 2:239694716-239694738 TGCCTGCTCCTTCAGGAGGGTGG + Intergenic
1171194556 20:23187092-23187114 AGCCTGGCTCTTCCTGAGGGTGG + Intergenic
1171486934 20:25491897-25491919 TGCCTCCCTCCTTGGGAGGGAGG - Intronic
1172810183 20:37641792-37641814 TCTGTGCCTCATTATGAGGGTGG + Intergenic
1174257786 20:49271132-49271154 TGCCTGCCTGCTTATGTGGTAGG - Exonic
1174651243 20:52127521-52127543 TTCCTGCCTCTTTGTGAAGAAGG + Intronic
1174661818 20:52220317-52220339 TTCCTGCCACTTTATGAAGAAGG - Intergenic
1175574776 20:60052585-60052607 TGCCAGCCCCTTTTTGAGGCTGG - Intergenic
1175907492 20:62388044-62388066 CGCCTGCCGCTTCTTGAGGGTGG + Intronic
1178617693 21:34147755-34147777 TGCCTGCATATTTGTGAGGAAGG + Intergenic
1179478165 21:41660996-41661018 GGGCTGCCTCTTTAGGAGGTGGG + Intergenic
1179588716 21:42390815-42390837 TGCCTTCATCTTCATGAGGCTGG - Intronic
1179873892 21:44257816-44257838 TGCCTGGCGCCTTCTGAGGGAGG - Intronic
1181486068 22:23232480-23232502 TGCCTGGCTCTTTGGGAGTGGGG + Intronic
1182921503 22:34084216-34084238 TGACTCCATCTTTATGAGGTAGG + Intergenic
1184492165 22:44815994-44816016 TGGCTGCCTCTGTGAGAGGGCGG + Intronic
1184981842 22:48100729-48100751 TTCCCGCCTCTTTCTCAGGGTGG - Intergenic
949516877 3:4815306-4815328 TGCCTGCCCAGTTATGCGGGAGG + Intronic
950718944 3:14868820-14868842 TGCCTGGCTCATTGTCAGGGAGG + Intronic
952729859 3:36627396-36627418 TGCTTGGCTCTTGATGGGGGAGG - Intergenic
953673382 3:44981254-44981276 TTCCTGCCTCTTTTTGAATGAGG + Intronic
955948305 3:64216826-64216848 TGCCTGCCTCATTAGGAAGGAGG - Intronic
963856431 3:150258375-150258397 TGCATGCTTCTGTATGAAGGAGG + Intergenic
964596825 3:158442146-158442168 TGGCTGCCCATTGATGAGGGTGG + Intronic
966715078 3:183006530-183006552 GGCTTGCTTCTTTGTGAGGGTGG + Intergenic
972398183 4:38674828-38674850 TGCCTGCCCCTTCCTGAGGGAGG - Intronic
974125822 4:57693958-57693980 TTCCTGCCTCTTTGTGAGGAAGG + Intergenic
975791459 4:77957106-77957128 TGCCTGCTTCTTTATGTGGGAGG - Intergenic
981716639 4:147758618-147758640 TGCCTGCCTATTTTTCAGGCAGG + Intronic
983537291 4:168871733-168871755 TCCCAGCCTCTTTTTGGGGGAGG - Intronic
984944200 4:184958447-184958469 TTCATGGCTATTTATGAGGGTGG + Intergenic
985786444 5:1897813-1897835 TGCCTGCCTGTGCCTGAGGGAGG + Intergenic
988493348 5:31723962-31723984 TTCCTGCCTCTTCATGAGAGAGG - Intronic
990630588 5:57664518-57664540 TGCCTGTGTCTTCATGATGGTGG - Intergenic
991443363 5:66674926-66674948 TGCCTGCCATTTTCTGAGAGTGG - Intronic
991648565 5:68827873-68827895 TGAGTGCTTCTTTATGAGGATGG - Intergenic
997200230 5:132005600-132005622 TTTCTGCCTGTTTATGAGGCAGG + Intronic
998277552 5:140771305-140771327 TGCCTTACTCTTTATCAGAGTGG + Intergenic
1004787125 6:18981544-18981566 TGATTGCATCTTTCTGAGGGGGG - Intergenic
1010653330 6:78480431-78480453 TGCCTTCCTCTTATGGAGGGTGG - Intergenic
1011990886 6:93515872-93515894 CTCCTGCCACTTTATGAAGGAGG + Intergenic
1013114624 6:107093005-107093027 AGTCTGCCTCTTTATGAGCATGG - Intronic
1017945879 6:159095887-159095909 TGCCAGGCTCTTCCTGAGGGCGG + Intergenic
1019748735 7:2715440-2715462 TGCCTGGCTCATGCTGAGGGTGG + Exonic
1021790223 7:24197260-24197282 TGCCTACCCCTTAATGTGGGGGG - Intergenic
1024227246 7:47335295-47335317 TGCCTCCAGCTTTATGAGGACGG - Intronic
1026711444 7:72743899-72743921 TGCCTCTCTCTTTTTGGGGGTGG - Intronic
1028604865 7:92644670-92644692 TTCCTTCCTCTTTTTCAGGGTGG - Intronic
1028614191 7:92746770-92746792 TGCTTGCCTCAATATGATGGGGG + Intronic
1029026979 7:97427161-97427183 TGCCTGGCTCCGTATGTGGGGGG - Intergenic
1029152445 7:98490599-98490621 AGCCTGACTCTTTAAGAGGAGGG + Intergenic
1030452821 7:109733998-109734020 TTTCTAGCTCTTTATGAGGGAGG - Intergenic
1032267654 7:130380328-130380350 TCCCTGCCACTTTATCATGGAGG + Intronic
1034342010 7:150363532-150363554 TGCCTGACTCATGATGAGGCCGG + Intergenic
1037974275 8:23199108-23199130 TGCCTGTCCCCTTGTGAGGGTGG + Intronic
1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG + Intronic
1039430194 8:37519787-37519809 TCCCTGCCTCTTTCTCAGGACGG - Intergenic
1042404594 8:68389568-68389590 TCCCTGCCTCTTAACAAGGGAGG - Intronic
1042674931 8:71309752-71309774 TCCCTGCCTCATTATGAAGTGGG - Intronic
1046596652 8:116269373-116269395 TGCTTGCCTCAGAATGAGGGAGG + Intergenic
1047740199 8:127800568-127800590 AGGCTGCCATTTTATGAGGGAGG - Intergenic
1047839701 8:128737915-128737937 TGCCTGGCTGTGGATGAGGGAGG + Intergenic
1049016346 8:139922749-139922771 CGCCTGCCTCTGTGTGAGGAAGG - Intronic
1049640071 8:143711484-143711506 TGCCAGCCTGTATCTGAGGGGGG - Intronic
1050188678 9:3001977-3001999 TTTCTGTCTCTTTAAGAGGGAGG - Intergenic
1050821945 9:9890014-9890036 TCCATGCCTCTTTGGGAGGGTGG - Intronic
1051942788 9:22529164-22529186 TGCCAGCCACTTTGTGGGGGTGG - Intergenic
1055217425 9:73883373-73883395 AGCCTGACTCTTTATCAGTGGGG - Intergenic
1055711125 9:79063107-79063129 TGGTTGCCTCTTTAAGATGGTGG + Intergenic
1187740345 X:22348860-22348882 TGAGTGCCTCTTTAAGAGTGAGG + Intergenic
1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG + Exonic
1190173667 X:48131266-48131288 TGCATGGCTCATTATGAGAGTGG + Exonic
1191105721 X:56770901-56770923 TACCTTCCTCTTTTTGGGGGGGG + Intergenic
1191106714 X:56776303-56776325 TACCTTCCTCTTTTTGGGGGGGG + Intergenic
1195295653 X:103473838-103473860 TGCCTGCAGCTTTCTGAGGCTGG - Intergenic
1196972929 X:121129585-121129607 TGCCTTCCACTTTATGTGCGTGG + Intergenic
1199476392 X:148250808-148250830 TGCCTGCATGTTTATGATAGAGG + Intergenic