ID: 903523877

View in Genome Browser
Species Human (GRCh38)
Location 1:23977549-23977571
Sequence CTACTTAGAAACAGCTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903523877_903523885 22 Left 903523877 1:23977549-23977571 CCACCAGAGCTGTTTCTAAGTAG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 903523885 1:23977594-23977616 CTCCTTTAAGCAGGGCTCTGTGG 0: 1
1: 0
2: 3
3: 19
4: 209
903523877_903523883 14 Left 903523877 1:23977549-23977571 CCACCAGAGCTGTTTCTAAGTAG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 903523883 1:23977586-23977608 ACCTGTCTCTCCTTTAAGCAGGG 0: 1
1: 0
2: 2
3: 13
4: 141
903523877_903523882 13 Left 903523877 1:23977549-23977571 CCACCAGAGCTGTTTCTAAGTAG 0: 1
1: 0
2: 1
3: 10
4: 125
Right 903523882 1:23977585-23977607 CACCTGTCTCTCCTTTAAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903523877 Original CRISPR CTACTTAGAAACAGCTCTGG TGG (reversed) Intronic
903523877 1:23977549-23977571 CTACTTAGAAACAGCTCTGGTGG - Intronic
903630172 1:24762703-24762725 CTTCGTAGTAACAGCTTTGGTGG + Intronic
909506254 1:76393503-76393525 CTACTTAGAAAAATATCAGGAGG - Intronic
909538632 1:76766592-76766614 CTGCTTAGAGAAAGCCCTGGAGG - Intergenic
911134204 1:94421895-94421917 CTTCTTAAAAAGAGCTCTGGTGG - Intronic
912050804 1:105525974-105525996 CTAGTTAGAGGCAGCTCTGATGG + Intergenic
912390927 1:109302345-109302367 CTACTCAGAAACCTGTCTGGAGG + Intronic
912738740 1:112174100-112174122 TTGCTTGGAAACAGCTCAGGAGG - Intergenic
916754959 1:167760503-167760525 CTACTTAGAAACCTATCTAGAGG - Intronic
917809497 1:178644226-178644248 CTTCTTAGAAAAGGCTCTGAGGG - Intergenic
919070034 1:192742702-192742724 CTAATTTTAAACAGCTCTGCTGG + Intergenic
921853670 1:219957764-219957786 ATACTTACAAACACCTCTTGTGG + Intronic
922870765 1:228900211-228900233 GTACTTAACAACAGCTCGGGAGG - Intergenic
923120848 1:230989824-230989846 ATACTTTGAAACAGTTCTGGGGG - Intronic
1065993844 10:31037799-31037821 TTACTTAGACACAGTTCTGGAGG - Intergenic
1067060363 10:43075261-43075283 CTCCTTGGAAAAAGGTCTGGGGG - Intergenic
1068385869 10:56326853-56326875 CTATTTAGAAAGGGCTCTGTTGG - Intergenic
1071562300 10:86653705-86653727 CTGCCCACAAACAGCTCTGGGGG + Intergenic
1073716503 10:106114408-106114430 CTGACTAGAAACAGCTGTGGTGG + Intergenic
1074180693 10:111060159-111060181 CACCTGAGAAACAGCCCTGGAGG + Intergenic
1074879897 10:117647661-117647683 CTCCGTAGAAACATCTCTGCAGG + Intergenic
1075803929 10:125171644-125171666 CTACTTATAAATAACTCTGTGGG - Intergenic
1081818723 11:45969743-45969765 CTACTTAGAAAGAGCCCATGAGG + Intronic
1083024399 11:59537738-59537760 CTTCTAAGAAACAGATCTGAGGG - Intergenic
1083312131 11:61789351-61789373 CCACTAGGAATCAGCTCTGGTGG - Intronic
1084857751 11:71999793-71999815 GCACTTAGAAACAGAGCTGGGGG - Exonic
1090498446 11:127237693-127237715 CTTCTTAGAAACAGGTTTAGCGG - Intergenic
1093500145 12:19802492-19802514 GTACTTTGATACAGCTGTGGAGG - Intergenic
1095182764 12:39165115-39165137 GTATTTAGACTCAGCTCTGGAGG - Intergenic
1096080583 12:48829879-48829901 CTACTTAGAAAATCCCCTGGGGG + Exonic
1096100158 12:48965958-48965980 CTACCTGGAAACAGCTTTAGGGG - Exonic
1096188909 12:49601851-49601873 CTATTTAAAAACATCACTGGTGG + Intronic
1098624869 12:72652414-72652436 CTTCTCAGAAACTGCTGTGGTGG - Exonic
1101249344 12:102916890-102916912 CTACTTAGAAACAATTGTTGAGG + Intronic
1102254459 12:111407506-111407528 CTGAGTGGAAACAGCTCTGGAGG + Intronic
1103614375 12:122142879-122142901 ATGCCTAGAAACAGCTCTGAGGG - Exonic
1106810356 13:33352853-33352875 CAACTTTGAAACAGATCTTGGGG - Intergenic
1108069259 13:46611021-46611043 AAAGTTAGAAACAGCTCTAGAGG + Intronic
1108857720 13:54815732-54815754 CTATTTAGAAATAGCAATGGTGG + Intergenic
1114356581 14:21916133-21916155 GTCCTTAGAAATACCTCTGGGGG - Intergenic
1114826328 14:26085128-26085150 TTACTTTGAAACTGCTATGGAGG - Intergenic
1117270184 14:54135643-54135665 GTACTTCGAAAAAGCTCTGAAGG - Intergenic
1118003769 14:61547098-61547120 CTACTTCGAAACAGCAGTGGTGG + Intronic
1119085861 14:71738379-71738401 CTACTTAGAAAGGGCTCTCATGG - Intronic
1121490406 14:94355004-94355026 CTTCTTAGAAGCAGCTTTGATGG + Intergenic
1122619282 14:103045316-103045338 CTACATACCAAAAGCTCTGGAGG + Intronic
1125054637 15:35342621-35342643 CCACTTAGAAACCACTTTGGAGG - Intronic
1134908467 16:18002618-18002640 CGACTTCCAAACATCTCTGGTGG + Intergenic
1148487442 17:47999886-47999908 CTAGTGAGAGACTGCTCTGGAGG - Intergenic
1156475033 18:37400501-37400523 CTACTTAGAAACAGATCAGAGGG + Intronic
1158738874 18:60116109-60116131 CTACTTAGGAAAAGCTCTTCTGG + Intergenic
1160458986 18:79023150-79023172 TTAATTAAAAACAGCTCTTGAGG - Intergenic
1165457693 19:35923419-35923441 GTATTTAGAAAGAGCTGTGGGGG + Intergenic
1165553247 19:36606145-36606167 CTACTTAGTTACAGTTTTGGAGG - Intronic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1167485164 19:49758485-49758507 TGACTCAGAAATAGCTCTGGTGG + Intronic
1167494553 19:49809955-49809977 CTACTTAAATACTGCTCTTGTGG - Intronic
925304867 2:2840890-2840912 CTGCTTAGAAATAGACCTGGGGG + Intergenic
925742214 2:7015856-7015878 CCACTGAGACACAGCCCTGGAGG + Intronic
926976655 2:18522634-18522656 CAAGTAAGAAACAGCACTGGGGG - Intergenic
927101821 2:19793673-19793695 TTACTTATAAACAGCTGTGTGGG - Intergenic
927857587 2:26537149-26537171 ATTTTCAGAAACAGCTCTGGGGG - Intronic
929056833 2:37885582-37885604 CTATGTAGAAAGAGCTCTGCTGG - Intergenic
929803789 2:45127235-45127257 CTATTTATAAACAGCCCTGAAGG - Intergenic
931277928 2:60760519-60760541 CTACTGAGAAAAAGCTGAGGGGG + Intronic
933233426 2:79836541-79836563 TTACTTTTTAACAGCTCTGGAGG + Intronic
935816221 2:106848397-106848419 GCACTGAGCAACAGCTCTGGTGG + Intronic
937099988 2:119261208-119261230 CCACTTAGAAACACTTCTGAGGG + Intronic
937952475 2:127399039-127399061 CCACTCAGAAACACCTCTGTAGG - Intergenic
939658906 2:144862767-144862789 ATAATTAAAAACATCTCTGGAGG + Intergenic
940085115 2:149850477-149850499 CTGCATAGGAACAGCTCCGGTGG + Intergenic
940096964 2:149987842-149987864 TTACTTAGAAACGACACTGGAGG + Intergenic
940829465 2:158452353-158452375 CTACTTGGAAATATCTCTTGAGG - Intronic
941116680 2:161480161-161480183 GGACTTAGAAACAGCTCTGGGGG + Intronic
941766900 2:169308104-169308126 CTACATACAAAGAGCTTTGGGGG + Intronic
942041709 2:172071721-172071743 CTACTTCAAAACAGTTATGGGGG - Intronic
942614663 2:177778261-177778283 CTACTCAGGGACAGTTCTGGGGG - Intronic
1172384705 20:34525719-34525741 TTACCCAGAAACTGCTCTGGTGG - Intronic
1175991167 20:62790027-62790049 CAACTTAAAAACAGCTCGAGTGG + Intergenic
1176954278 21:15082644-15082666 CTACTCAGTAACAGCTCCAGTGG - Intergenic
1180928918 22:19575854-19575876 CAACTTAAAAGCAGCCCTGGAGG + Intergenic
1182717520 22:32369635-32369657 CTCCTTAGAAAGAACTCTGAAGG + Intronic
949863998 3:8532461-8532483 CTGTTTTGAAACAGCACTGGAGG + Intronic
949947495 3:9202191-9202213 ATCCATAGAAACAGCTATGGCGG + Intronic
950646829 3:14382363-14382385 AGACTCAGAGACAGCTCTGGAGG + Intergenic
953080239 3:39609890-39609912 CTAATTAGAAACTGATTTGGTGG - Intergenic
955387511 3:58491701-58491723 CTAAGGAGAAACAGCTGTGGAGG + Intergenic
956110214 3:65862799-65862821 CTAATTAGAAACACCTCTTTTGG + Intronic
957579499 3:82052621-82052643 CTACGTAAATACAGCTTTGGAGG - Intergenic
957723903 3:84039475-84039497 CTACTCAGAAACAGCTATCTGGG + Intergenic
958085369 3:88798754-88798776 CTACTGAGAACCAGCCATGGTGG - Intergenic
965403752 3:168245940-168245962 CTCCTTTGATACAGGTCTGGAGG + Intergenic
967137588 3:186525527-186525549 CTTTTTAGAGACAGGTCTGGTGG - Intergenic
967443073 3:189531387-189531409 CTTGTTAGAAGCCGCTCTGGTGG + Intergenic
969393807 4:6908159-6908181 TTACTTAGAAAAAGCTGGGGAGG + Intergenic
973121148 4:46522288-46522310 CTACGTAGAGACAGCTCTAATGG + Intergenic
975534328 4:75433569-75433591 CCACTTAGAAACAGCAGTGATGG - Intergenic
976216643 4:82721309-82721331 GTGCTTAGAAACATCTGTGGGGG - Intronic
978132558 4:105216269-105216291 CTTCTTTGAAACAGGTCGGGGGG + Intronic
980036027 4:127882944-127882966 CCACTTAGAAAAAGAACTGGAGG + Intronic
981044617 4:140253378-140253400 CCGCCTAGGAACAGCTCTGGCGG - Intergenic
984266926 4:177506812-177506834 CTACTGAGTCAAAGCTCTGGGGG - Intergenic
987787982 5:22526793-22526815 CTAGGTAGAAGCAGTTCTGGTGG + Intronic
993344861 5:86770176-86770198 CAACCTAGAAACAGCTTTGTTGG + Intergenic
994207386 5:97050631-97050653 CTCCTTAAATACAGCTCTGCAGG - Intergenic
997381155 5:133439496-133439518 CTAAAAAGAAACAGCTCTGGAGG + Intronic
997642946 5:135461680-135461702 CTACTTGGAGAGAGCTCTGTAGG - Intergenic
1000511079 5:162183919-162183941 GTATTTAGAAAAAGTTCTGGTGG - Intergenic
1003030730 6:2598238-2598260 CCACGTAGAAACAGCTCCGGGGG + Intergenic
1015044397 6:128760711-128760733 CTCCTGAGAAACAGCCCTGCAGG + Intergenic
1017268891 6:152483000-152483022 CTAGTTACAACCTGCTCTGGCGG - Intronic
1017977247 6:159369111-159369133 CTAGGTAGAGACAGCTCTAGTGG + Intergenic
1019543469 7:1561554-1561576 CTGCTTAGGAACAGCACTGCTGG + Intergenic
1019956862 7:4422749-4422771 CTCCTCTGACACAGCTCTGGTGG + Intergenic
1020042082 7:5011905-5011927 ATACTTGGAAGCAGCTATGGCGG - Intronic
1028385472 7:90248146-90248168 CAACTTAGAAACATCTCTGAAGG - Intronic
1028961413 7:96753364-96753386 CTACTTTTAAACATCTCTGCAGG - Intergenic
1031375281 7:121017085-121017107 CTACTTAGAAGAAACTCTGAGGG + Intronic
1035995944 8:4547115-4547137 TAATTTAGAAACAGGTCTGGGGG - Intronic
1036395861 8:8370824-8370846 CTACTGAGAAGCAGCTCAGGAGG + Intronic
1038267645 8:26048602-26048624 TTACTTAGAAACTGCTCTCCTGG + Intergenic
1042098778 8:65249229-65249251 ATACTTAGAAACAGCTCATCAGG - Intergenic
1042430220 8:68698000-68698022 CTAGTTAGAAACAACTCAGTGGG + Intronic
1043809308 8:84716550-84716572 CTTCATATAAATAGCTCTGGAGG - Intronic
1046829076 8:118723852-118723874 ATACTTAGAAAAATTTCTGGTGG - Intergenic
1047476461 8:125236546-125236568 ATACTTAGAAAAAGACCTGGAGG + Intronic
1051481702 9:17568910-17568932 CTACTCTGTCACAGCTCTGGAGG - Intergenic
1055988747 9:82082643-82082665 TTACATATAAACAGCTCTGGAGG + Intergenic
1057271148 9:93652229-93652251 CCACTAAGAACCAGATCTGGGGG - Intronic
1191906730 X:66101127-66101149 TGACTTATAAGCAGCTCTGGGGG + Intergenic
1192487587 X:71543122-71543144 CTACTGATAAACAGCTTTTGTGG - Intronic
1192789495 X:74367458-74367480 CTATGTAGAAGCAGCTCTAGTGG + Intergenic
1193528391 X:82622214-82622236 CTACATAGAATGAGCTATGGAGG - Intergenic
1196378117 X:115057912-115057934 CTATTTACAAACCTCTCTGGAGG + Intergenic
1197348633 X:125355931-125355953 GTAGTTAGAAACAGGTCAGGAGG - Intergenic
1200298857 X:154952023-154952045 CTACTTGGAAAAAGATGTGGTGG + Intronic
1202217299 Y:22505052-22505074 TTATTTAGAAACAGCTTTGTTGG + Intronic