ID: 903534192

View in Genome Browser
Species Human (GRCh38)
Location 1:24055904-24055926
Sequence CAGCCTGGAAGGTGAGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903534187_903534192 -3 Left 903534187 1:24055884-24055906 CCTGGTCTGCCTGCACCATGCAG 0: 1
1: 0
2: 3
3: 20
4: 298
Right 903534192 1:24055904-24055926 CAGCCTGGAAGGTGAGCCGCTGG 0: 1
1: 0
2: 0
3: 26
4: 225
903534183_903534192 28 Left 903534183 1:24055853-24055875 CCGCTGCTCCCTGCAGAGGTCTC 0: 1
1: 0
2: 3
3: 60
4: 1176
Right 903534192 1:24055904-24055926 CAGCCTGGAAGGTGAGCCGCTGG 0: 1
1: 0
2: 0
3: 26
4: 225
903534181_903534192 30 Left 903534181 1:24055851-24055873 CCCCGCTGCTCCCTGCAGAGGTC 0: 1
1: 0
2: 1
3: 24
4: 273
Right 903534192 1:24055904-24055926 CAGCCTGGAAGGTGAGCCGCTGG 0: 1
1: 0
2: 0
3: 26
4: 225
903534185_903534192 19 Left 903534185 1:24055862-24055884 CCTGCAGAGGTCTCATCAAACGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 903534192 1:24055904-24055926 CAGCCTGGAAGGTGAGCCGCTGG 0: 1
1: 0
2: 0
3: 26
4: 225
903534182_903534192 29 Left 903534182 1:24055852-24055874 CCCGCTGCTCCCTGCAGAGGTCT 0: 1
1: 0
2: 2
3: 35
4: 336
Right 903534192 1:24055904-24055926 CAGCCTGGAAGGTGAGCCGCTGG 0: 1
1: 0
2: 0
3: 26
4: 225
903534184_903534192 20 Left 903534184 1:24055861-24055883 CCCTGCAGAGGTCTCATCAAACG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 903534192 1:24055904-24055926 CAGCCTGGAAGGTGAGCCGCTGG 0: 1
1: 0
2: 0
3: 26
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903534192 Original CRISPR CAGCCTGGAAGGTGAGCCGC TGG Intergenic
900684356 1:3938522-3938544 CAGCCTGGAAGCTCACCCGATGG + Intergenic
900989633 1:6092383-6092405 CTGCATGGAAGGGGCGCCGCAGG + Intronic
901011983 1:6207300-6207322 CAGCCTGGAATGTGAGGGGTGGG + Intronic
901780726 1:11593019-11593041 CAGCCTGGAAGGGGAGAGCCAGG - Intergenic
902771062 1:18645955-18645977 CAGGCGGGAAGGAGAGCTGCAGG - Intronic
903534192 1:24055904-24055926 CAGCCTGGAAGGTGAGCCGCTGG + Intergenic
903740833 1:25557446-25557468 CAGGCAGGCAGGTGAACCGCCGG + Intronic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG + Intergenic
905375038 1:37514475-37514497 CAGCCGGGAAGCTGAACCGCCGG + Intronic
905395968 1:37666851-37666873 CAGCCTGGAAGCTGCTCCTCTGG + Intergenic
905687812 1:39921481-39921503 CAAACTGGAAGGTGGGCGGCAGG - Intergenic
905793426 1:40802334-40802356 CGGCCTGAAAGGCGAGCAGCGGG - Intronic
907480314 1:54741318-54741340 CAACATGCAAGGTGAGCCTCTGG - Intronic
907905684 1:58782566-58782588 CAGCCTGCACAGCGAGCCGCCGG - Exonic
911043451 1:93609723-93609745 CAGCCTGGAAGGGGAGCACAGGG - Intronic
912993337 1:114510539-114510561 CATCCAGCAAGGTGAGCCGGAGG - Exonic
913231229 1:116742234-116742256 CAGCCTGGAGGGTGAGGCGGTGG - Intergenic
913319774 1:117580043-117580065 CATCCTGGAGGGTGTGCAGCTGG + Intergenic
915738300 1:158098506-158098528 CAGCTTGCAAGGGGAGCCGGTGG + Intronic
916305201 1:163322202-163322224 GAGCCTGGGAGGTGAGGGGCGGG + Exonic
917942639 1:179937876-179937898 CAGCCTGGAAGAAGACCCTCAGG - Intergenic
918509398 1:185293903-185293925 AAGCCTGGAAGGTGAGGTGGTGG + Intergenic
918965584 1:191343581-191343603 CAGCATGGAAGGGGAACCGAGGG + Intergenic
922784409 1:228276016-228276038 CACCGTGGAGAGTGAGCCGCGGG + Exonic
923146192 1:231200038-231200060 CAGCCTGGAAGAGGCGGCGCTGG - Intronic
924382182 1:243475049-243475071 CAGCCTGGGAGGAGAGGAGCTGG + Intronic
1062910797 10:1210777-1210799 AAGCCTGGCAGGTGGGCCTCAGG + Intronic
1063159656 10:3410012-3410034 CAGCCTGCAGGGTCAGCCCCAGG - Intergenic
1063220451 10:3962110-3962132 CTTCCAGGAAGGTGAGCTGCTGG - Intergenic
1066114642 10:32228767-32228789 AATCCTGGAAGGTGAGATGCTGG + Intergenic
1068121265 10:52784293-52784315 CATCCTGGAAGCTGAGCAGAGGG - Intergenic
1070543458 10:77434220-77434242 TAGCCTAGAAGGTGAGAGGCAGG - Intronic
1070604555 10:77889613-77889635 CAGCCTAGCAGGTGACCTGCTGG - Intronic
1070648938 10:78221213-78221235 CAGCTTGTGAGGTGAGCCACTGG - Intergenic
1073899828 10:108206855-108206877 CAGGCTGGAAGCTGAGACACAGG + Intergenic
1075655056 10:124155876-124155898 CTGCCCGGAAGGCCAGCCGCAGG + Intergenic
1076554455 10:131312300-131312322 TGGCCCGGAAGTTGAGCCGCGGG + Intergenic
1077363024 11:2149218-2149240 CTGCCTGGACGATGATCCGCCGG + Exonic
1077433790 11:2528572-2528594 CTGCCTGGAAGGTGGGGTGCAGG + Intronic
1077459761 11:2703123-2703145 CAGGCTGGGAGGTGAGCCCAGGG + Intronic
1080114541 11:28607085-28607107 CAGCCTAGGAGGGGAGCTGCCGG + Intergenic
1080727556 11:34913667-34913689 CAGCCTGGAAGGTGACCGAGGGG + Intronic
1081679777 11:44994160-44994182 CCACCTGGAAGGTGAGCTGAGGG - Intergenic
1082845069 11:57718482-57718504 CACCGTGGATGGTGAGCCCCTGG - Intronic
1083161251 11:60855555-60855577 CAGCCAGGAAGCTGAGGAGCTGG - Intronic
1083344464 11:61979632-61979654 GAGCCTGGAATGGGAGCCTCGGG + Intergenic
1083849420 11:65356261-65356283 GAGCCTGGGATGTGAGCCCCGGG - Exonic
1085525234 11:77160123-77160145 CAGGCTGGCAGGTGAGCACCTGG + Intronic
1088805155 11:113345593-113345615 GGGCCTGGAAGGGGAGCCGTAGG - Intronic
1090874954 11:130780603-130780625 CAGCCTGCAAGGTGGGCCTCGGG + Intergenic
1094238496 12:28195010-28195032 CAGCATGGAAGGGGACCCGAAGG + Intronic
1096580532 12:52581833-52581855 TAGCCTGGCAGGTGTGCCTCAGG + Intergenic
1097021118 12:56021440-56021462 CTTCCTGGAAGGTGAGTGGCTGG + Exonic
1097269444 12:57765285-57765307 CGGACTGGAAGGTGAGTCCCAGG - Exonic
1103261683 12:119594057-119594079 CAGCCTGGGAGGAGAGACCCGGG + Intronic
1105539792 13:21306533-21306555 CTGCCTGCAAGGTGAGCCAATGG - Intergenic
1105845456 13:24290341-24290363 CATCCTGGAAGGTGGGGAGCAGG - Intronic
1105978531 13:25495158-25495180 CACCCTGGAAGGGCAGCAGCAGG - Intronic
1106332842 13:28755060-28755082 CAGCCCTGAAGCTCAGCCGCAGG + Intergenic
1107682433 13:42865665-42865687 CAGCCTTGAAGGTAAGTTGCTGG - Intergenic
1113438693 13:110311864-110311886 CAGCCTGGAAACTAAGCGGCAGG - Intronic
1113566129 13:111320741-111320763 CCGCCTGGGATGTGAGGCGCAGG + Exonic
1113576720 13:111400126-111400148 CAGCTTGGAAGATGAAGCGCTGG + Intergenic
1114539768 14:23446364-23446386 CAGCCCCAAAGGTGAGCCTCAGG + Intergenic
1117625976 14:57638557-57638579 CAGTTTGGAAAGTGAGCCTCTGG - Intronic
1118820332 14:69341437-69341459 CACCCTGAAAGGTGAGCTCCAGG + Intronic
1119484349 14:74978267-74978289 CAGCCTGGAACGTGGGGTGCAGG + Intergenic
1121266831 14:92609296-92609318 CAGCCTTGAGGGTGAGTCACTGG + Intronic
1122414420 14:101542034-101542056 CAGCCTGGAGGCTGAGCGGGTGG - Intergenic
1123695955 15:22879429-22879451 CAGCATGAAAGGGGAGCCCCCGG - Intronic
1125714573 15:41812117-41812139 GGGCCTGGAAGGTGAGTGGCTGG + Exonic
1125768702 15:42151340-42151362 CAGACTGGAAGATGAGGCCCAGG + Intronic
1128135192 15:65257821-65257843 CAGCCTGCAAGGTGGGCAGATGG - Intronic
1128143562 15:65319043-65319065 CAGCCTGGAAGCTGCGCTCCTGG - Intergenic
1128357168 15:66936325-66936347 CAGCCTGCAAGGCGAGCACCAGG + Intergenic
1128469063 15:67936824-67936846 CAGCGTGGAAGGGGACCCGAGGG - Intergenic
1129718546 15:77865488-77865510 CAGCCTGGAAGGGAAGCAGCAGG - Intergenic
1130460382 15:84155378-84155400 CAGCCTGGAGGGAAAGCAGCAGG + Intergenic
1131546736 15:93322069-93322091 CAGCCTAGAGGGTGAGCAGAGGG - Intergenic
1132336042 15:101049388-101049410 CAGCCTGGGAGCTGACCCTCAGG - Intronic
1132759130 16:1500478-1500500 CAGCCGGGATGGTGAGCGGGTGG + Exonic
1132803753 16:1766399-1766421 CAGCCTGGCAGGTGAGCTCTTGG + Exonic
1132945859 16:2531189-2531211 CAGCCAGGGAGGTGGGGCGCTGG - Exonic
1134419329 16:14071355-14071377 CGGCCGGGGAGGTGAGCGGCGGG + Intronic
1136237566 16:28924391-28924413 CATCCTGAAAGGTGAGACGCGGG - Exonic
1137236992 16:46624874-46624896 AAGCCTGGCAGGTGAGATGCTGG + Intergenic
1138588109 16:57984836-57984858 CTGCCGGGCAGGTGGGCCGCGGG + Intronic
1139246345 16:65448134-65448156 CAGCCTGGAATGTGTGCCTTAGG - Intergenic
1139546869 16:67653578-67653600 CAGCCGGGTAGCCGAGCCGCGGG + Intronic
1141892127 16:86933378-86933400 CAGCCTGGAAGGTGTGAAGAGGG - Intergenic
1141959225 16:87392929-87392951 CAGCCCTGAAGGTGACGCGCTGG - Intronic
1142378373 16:89718302-89718324 CAGCCTGGGAGTGGAGCCTCAGG - Intronic
1142712343 17:1730383-1730405 CAGCCTGCAAGATGGTCCGCTGG + Exonic
1143147457 17:4785925-4785947 CAGTCTGGAAGGTGGGGCGCAGG - Exonic
1143487000 17:7260809-7260831 CATCGTGGCAGGTGAGCCCCCGG - Exonic
1143598128 17:7927890-7927912 CAGTCTGGAAGGAGAGGAGCTGG - Intronic
1143691336 17:8568769-8568791 CAGTGTTGAAGGTGAGCAGCTGG + Intronic
1143773559 17:9183255-9183277 CAGCCTGGAAGGTGTTGGGCTGG - Intronic
1144564886 17:16352351-16352373 CAGCCAGGAGGGCGAGCGGCAGG + Intronic
1144619654 17:16809335-16809357 CAGCCTGGAAGCTGAGCATGAGG - Intergenic
1144893031 17:18506369-18506391 CAGCCTGGAAGCTGAGCATGAGG + Intergenic
1145139186 17:20437923-20437945 CAGCCTGGAAGCTGAGCATGAGG - Intergenic
1148820289 17:50356047-50356069 GAGAGTGGAAGGTGAGCTGCAGG - Intronic
1149655641 17:58308450-58308472 CAGCGTGGAATGGGAGCTGCTGG + Intronic
1151308481 17:73279157-73279179 CAGCCTGGGAGGTGAGGGACAGG - Intergenic
1151417219 17:73974266-73974288 GAGCGTGGAAGGGGAGCAGCTGG - Intergenic
1151674606 17:75591039-75591061 CTGCCTGGGAGGTGAGCAGAGGG - Intergenic
1151974098 17:77474689-77474711 AAGCCAGGTAGGTGAGCCCCAGG - Intronic
1152071795 17:78137804-78137826 CTGCCTCGGAGGTGAGCCCCGGG + Exonic
1152241231 17:79162337-79162359 CACCCTGCAAGGTGAGACGTCGG + Intronic
1152558227 17:81065239-81065261 AAGCCTGGCAGGTGACCCGAGGG + Intronic
1153331561 18:3879903-3879925 CAGCCTGGAAGGAGTTCCGCTGG + Exonic
1153618472 18:6954800-6954822 AAGCCTGGCAGGTGAGCTGGAGG + Intronic
1153825094 18:8867858-8867880 CAGCCTGTCAGCTGAGCTGCGGG + Intergenic
1156678839 18:39565273-39565295 AAGCCTGGAAGCTCAGCCTCTGG + Intergenic
1157014748 18:43698671-43698693 CTGGCTGGAAGGGGAGCCACAGG + Intergenic
1159099250 18:63940137-63940159 CAGTCTGTAAGCTGAGGCGCGGG + Intergenic
1159955686 18:74516815-74516837 CAGCATGAAGGGTGAGCCCCAGG - Intronic
1160539703 18:79613842-79613864 CAGCCAGGAAGCTGGGCCACAGG - Intergenic
1161026431 19:2039357-2039379 CACCCGGGAAGGTGAGCAGAGGG - Exonic
1161768316 19:6218633-6218655 GAGCCTGGAAGGACAGCTGCAGG - Intronic
1163570759 19:18080950-18080972 CAGCCTGGTGGCTGAGCCGGCGG + Exonic
1163575757 19:18110056-18110078 CAGCGGGAAAGGGGAGCCGCGGG - Intronic
1163796461 19:19341009-19341031 CAGCCTGGAATGTGAGGCCCGGG + Intronic
1163799639 19:19356735-19356757 CAGCAGGGAAGGTGAGGCGGTGG - Exonic
1164867733 19:31618901-31618923 CACTCTGGAAGGTGACCCACAGG + Intergenic
1165851416 19:38852125-38852147 CGGCCTGGAACGTGCGGCGCCGG - Intronic
1165900436 19:39167069-39167091 CAGCCTGGAGGGCGGGCGGCTGG - Intronic
1166721718 19:45001104-45001126 CAGGCTGGAAGGGGAGCTTCAGG - Intergenic
1168701576 19:58442898-58442920 CAGCATGGAAGAGGACCCGCGGG + Intergenic
925609654 2:5692563-5692585 CAGCCTGGAAGGGGGGGCGGGGG + Intergenic
925869063 2:8253580-8253602 CAGCCTTGAAGGCCAGCTGCCGG + Intergenic
925972226 2:9113636-9113658 CAGGCTGGAGGCTGAGCCTCGGG - Intergenic
928572788 2:32625907-32625929 CTACCTGGAAGGTGAGGCTCTGG - Intergenic
929242480 2:39666364-39666386 CATCCTGAAAGGTGAGCGGCGGG + Exonic
931669908 2:64637811-64637833 CAGCCTGGCCTGTGAGCAGCAGG - Intronic
932365327 2:71148607-71148629 CAGCCAGGAAGATGAGCACCTGG - Intronic
933581108 2:84128071-84128093 CAGCCTGGAAGGGGACCTGCTGG - Intergenic
933692972 2:85194061-85194083 AACCCTGGAAGGTGACCCCCTGG + Intronic
941111042 2:161418767-161418789 TAGCCTGGAAGGCGGGCTGCAGG + Intronic
942538780 2:176993941-176993963 CAACCTGGAAGGAGAGCAGAGGG + Intergenic
942857132 2:180562365-180562387 CTGCCAGGGAGGTGAGCAGCAGG + Intergenic
943701126 2:190989150-190989172 CAGCCTGGACGTTCAGCCTCGGG + Intronic
1168802785 20:653658-653680 CAGACTGGAAGTGGAACCGCTGG - Intronic
1168910961 20:1446268-1446290 CAGCCTGGCAGGTGAGTGGCAGG + Intronic
1171265309 20:23766848-23766870 CAGCCTGAAAGATGAGGAGCAGG + Intergenic
1171267238 20:23781794-23781816 CAGCCTGAAAGGTGAGGAGTAGG + Intergenic
1172127908 20:32636130-32636152 TTGCCTGGATGGTGAGCTGCTGG + Intergenic
1172859175 20:38033853-38033875 CAGCCTGTCAGGTGAGGCCCCGG + Exonic
1173126916 20:40345721-40345743 CACCCTGAACGGTGAGTCGCAGG + Intergenic
1173316601 20:41950412-41950434 CCTCCTGGAAGGTGGGCTGCAGG - Intergenic
1177715920 21:24840006-24840028 CAGCATGGAAGGTGACCCGAGGG + Intergenic
1179416591 21:41203446-41203468 GAGCCTGGTAGGTGAGCTGTGGG + Intronic
1179456945 21:41506937-41506959 CAGCCTCGAAGGCGAGCCCTGGG + Intronic
1181903351 22:26173136-26173158 CAGCCTGGAAGGATGGCTGCAGG + Intronic
1181909876 22:26230129-26230151 CAGCCTGTAAGCTGAGCTGGAGG - Intronic
1182146509 22:28000089-28000111 CAGCCGGCACGGTGGGCCGCTGG + Intronic
1182427829 22:30284214-30284236 CAGCCTGGTGAGTGAGCAGCAGG - Intergenic
1183432425 22:37773790-37773812 CAGCCTGGAGGGTCTGCAGCTGG - Exonic
950129746 3:10533982-10534004 CAGCCTGGGAAGAGAGCTGCTGG - Intronic
950162444 3:10770775-10770797 CAGGCTGGGAGGCGAGCCCCCGG + Intergenic
950880243 3:16317419-16317441 CATCCTGGAAGGTGTGGTGCAGG - Intronic
953354958 3:42248196-42248218 CAGACTGGCATGTGAGCCACAGG + Intergenic
956322020 3:68007894-68007916 CAGCAGGGAAGCTGAGCCCCAGG - Intronic
960404103 3:117238533-117238555 GAGCCTGGAATGTGTGCCCCAGG - Intergenic
961750110 3:129089571-129089593 AAGCCTGGCAGGTGAGATGCTGG + Exonic
962108512 3:132417696-132417718 CACTCTGGAAGCTGAGCCGGCGG + Exonic
966225222 3:177590809-177590831 TAGCCTGGAAAGAGAGCCACAGG + Intergenic
968285530 3:197506417-197506439 CAGCCTGGAAAGGGAGGCCCAGG - Intergenic
971251099 4:24974163-24974185 CAGGGCGGAAGGTGACCCGCAGG + Intronic
974526201 4:63052879-63052901 CAGCATGGAAGGGGACCCGAGGG - Intergenic
978144759 4:105359369-105359391 CAGCCTGGAAGGGGACCCACAGG - Intergenic
979494819 4:121371486-121371508 CAGCCTGGAAGTTGGTCCACTGG + Intronic
984689827 4:182714158-182714180 CAGCCTGGATGGAGAGGAGCAGG + Exonic
985185058 4:187305432-187305454 CAGCCTGGAAGGCGAGAGGAGGG - Intergenic
986146695 5:5084481-5084503 AAGCCTGGAAGGTGAGCTCCTGG + Intergenic
989134675 5:38142023-38142045 CAGCCTGGATGGTCAGCTGAGGG - Intergenic
995190724 5:109316846-109316868 CAGAGTGGATGGTGAGTCGCTGG + Intergenic
999053535 5:148549463-148549485 CAGCCTGGGATGAGAGCCTCTGG - Intronic
1000171606 5:158707967-158707989 CAGCCTGCAAGGTAAGCCCCAGG - Exonic
1000518391 5:162269042-162269064 CAGCGTGGAAGGAGACCCGCAGG - Intergenic
1001748703 5:174111420-174111442 CAGCCTGGACTGTGAGCCCAGGG - Intronic
1003160207 6:3627942-3627964 CCGCCTGCAAGGGGAGCCTCAGG - Intergenic
1003381179 6:5625803-5625825 CTGCCCTGATGGTGAGCCGCTGG + Intronic
1003441651 6:6148367-6148389 GGGCCTGGAAGGTGAGGAGCTGG - Intronic
1004506972 6:16254615-16254637 CATCCTGGAAGCTGTGCCACAGG + Exonic
1005649953 6:27877370-27877392 CAGCATGGAAGGGGATCCGAGGG + Intergenic
1006221250 6:32493946-32493968 CAGCGTGGAAGGGGACCCACAGG - Intergenic
1010057744 6:71585605-71585627 GACCCTGGAGGGTGCGCCGCAGG - Intergenic
1013368166 6:109450008-109450030 CAGCCTGGATGGTGAAGCGGTGG - Exonic
1014760137 6:125346860-125346882 CAGACTGGAGGGTGAACTGCTGG + Intergenic
1015310845 6:131765702-131765724 CAGCCTGGAAGAAGAGCGTCAGG - Intergenic
1016681276 6:146832293-146832315 CAGCCTGGAAAGTGGGTCACTGG + Intergenic
1019005011 6:168789557-168789579 CAGCTGTGAAGGTGAGCCACGGG + Intergenic
1019135546 6:169905521-169905543 CAGCCTGGCTGGTAAGCCCCTGG + Intergenic
1019647652 7:2139617-2139639 CAGCCTTGAAGGAGAGCGGCGGG - Intronic
1019647660 7:2139664-2139686 CAGCCTTGAAGGAGAGTGGCGGG - Intronic
1021831599 7:24618096-24618118 CAGCCTGGCAGGCTAGCCTCTGG - Intronic
1023819613 7:43973244-43973266 CAGCGTGGAAGGTGGGCGGCAGG + Intergenic
1023842634 7:44105674-44105696 AAGCCTGGAAGGAGAGCCAGAGG - Intronic
1024215875 7:47247699-47247721 CAGCAGGGAAGGGGAGCCGTGGG - Intergenic
1026000768 7:66557906-66557928 CCGCCTGGCAGGGGAGCCCCAGG + Intergenic
1026236818 7:68534554-68534576 CAGCGTGGAAGGAGACCGGCGGG + Intergenic
1029459917 7:100688580-100688602 CAGGCTGCCAGGTGAGCCCCGGG - Exonic
1029473052 7:100766676-100766698 CAGGGTGGAAGGTGAGCTGGGGG + Intronic
1029606276 7:101601263-101601285 CAGCCTGGAGGGACAGCCTCAGG - Intergenic
1029744664 7:102510213-102510235 CAGCGTGGAAGGTGGGCGGCAGG + Exonic
1029762655 7:102609375-102609397 CAGCGTGGAAGGTGGGCGGCAGG + Exonic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1034432712 7:151049128-151049150 CAGCCGGGAAGATGAGCCGGTGG - Exonic
1034563856 7:151898391-151898413 CTGCCCGGCAGGGGAGCCGCAGG + Intergenic
1034702876 7:153111473-153111495 CAGCTTGAAAGGTGAGCCTTGGG - Intergenic
1035559899 8:596443-596465 CAGCCCTGAAGGTGAGGAGCAGG + Intergenic
1035617147 8:1010968-1010990 CAGTCTGCATGGTGAGCCCCGGG + Intergenic
1036297579 8:7549469-7549491 CATCCAGGGAGGTGAGCTGCGGG - Intergenic
1036298883 8:7557116-7557138 CATCCAGGGAGGTGAGCTGCGGG - Intergenic
1036300188 8:7564766-7564788 CATCCAGGGAGGTGAGCTGCGGG - Intergenic
1037881069 8:22573719-22573741 CAGCCTGGAAGGGGAGGCCCAGG + Intronic
1038395392 8:27242361-27242383 CAGCCAGGAAAGTGAGGGGCGGG - Intronic
1038575628 8:28701558-28701580 CGGCCTGGAAGGCGGGCGGCCGG + Exonic
1039431206 8:37526501-37526523 CAGGCTGGAAGATGAGCCCTTGG + Intergenic
1043395187 8:79828585-79828607 CAGCCTGGGAGGAGACCGGCAGG - Intergenic
1046622488 8:116543127-116543149 CAGCATAGGAGGTGAGCAGCGGG - Intergenic
1046770313 8:118111449-118111471 CAGCGTGGAAAATGAGCCCCGGG + Exonic
1047301139 8:123614265-123614287 AAGCCTGGAAGGCAAGCCGTGGG + Intergenic
1047404714 8:124575792-124575814 CACTCTGGATGGTGAGCTGCAGG - Intronic
1047706925 8:127508693-127508715 CAGCCTGCGAGGAGAGCAGCAGG + Intergenic
1049441495 8:142611791-142611813 CAGCCTGCAAGGTGAGGGGTGGG + Exonic
1049620561 8:143596559-143596581 CTCCCTGGGAGGTGAGCCGCAGG + Intronic
1049689616 8:143952898-143952920 CAGGCGGGAAGGGAAGCCGCAGG + Intronic
1050336082 9:4591145-4591167 CATCCTGGAAGGGCAGTCGCTGG + Intronic
1050462499 9:5888639-5888661 GAGCCTGGAAGATGAGGAGCTGG + Intronic
1056701840 9:88917668-88917690 CACTCCAGAAGGTGAGCCGCAGG + Intergenic
1057329632 9:94101400-94101422 CAGCCTGGAAGTGGAGAGGCTGG + Intronic
1059749445 9:117234226-117234248 CAGCCTGAAAAGGGAGCCTCAGG + Intronic
1061005360 9:127925946-127925968 AAGGCTGCGAGGTGAGCCGCTGG - Exonic
1061374511 9:130216010-130216032 CGGCCTGGAAGGTGAAGCTCAGG - Intronic
1061846249 9:133389948-133389970 CAGCCTGAAAGTTGTGCCGCTGG - Intronic
1062651015 9:137577717-137577739 CTGCCTGGAAGGAGAACCTCTGG + Intronic
1187230203 X:17414668-17414690 GGACCTGGAAGGTGAGCCACTGG + Intronic
1187450227 X:19389443-19389465 CAGCCTGGCAGGAGAGCCAGAGG - Intronic
1189131529 X:38502980-38503002 CAGCCTGTAAGTTGAGCCCCAGG + Intronic
1190748522 X:53341305-53341327 CTGCCTGGAAGGCCAGACGCTGG + Intergenic
1191843927 X:65532410-65532432 CAGGCTGGAAGCTGAGGCTCTGG + Intronic
1192230275 X:69259871-69259893 CAGTCTGGAGGGTGACCCACTGG - Intergenic
1196499614 X:116364512-116364534 GAGCCTGGAAGGTGAGGCTGTGG + Intergenic
1197929779 X:131682297-131682319 CAGCTTGGAAGGTGAGAGACTGG + Intergenic
1198226871 X:134653283-134653305 AAGCCTGGAGGGTGAGCAGGTGG - Intronic
1200747136 Y:6912124-6912146 CAGCCTGGAAGGCGAGGGGCAGG + Exonic
1202378870 Y:24259802-24259824 CAGCCTGGAGGGGAAGCAGCAGG - Intergenic
1202491912 Y:25410319-25410341 CAGCCTGGAGGGGAAGCAGCAGG + Intergenic