ID: 903536275

View in Genome Browser
Species Human (GRCh38)
Location 1:24068384-24068406
Sequence CAGAACAGGGAAAAGGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 339}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903536275_903536281 -8 Left 903536275 1:24068384-24068406 CCAGAGTCCTTTTCCCTGTTCTG 0: 1
1: 0
2: 2
3: 36
4: 339
Right 903536281 1:24068399-24068421 CTGTTCTGGGAACTTTGTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 274
903536275_903536287 21 Left 903536275 1:24068384-24068406 CCAGAGTCCTTTTCCCTGTTCTG 0: 1
1: 0
2: 2
3: 36
4: 339
Right 903536287 1:24068428-24068450 CATCAGAGTGTAGTGGGCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 127
903536275_903536290 26 Left 903536275 1:24068384-24068406 CCAGAGTCCTTTTCCCTGTTCTG 0: 1
1: 0
2: 2
3: 36
4: 339
Right 903536290 1:24068433-24068455 GAGTGTAGTGGGCTTGGGGGTGG 0: 1
1: 0
2: 4
3: 502
4: 8429
903536275_903536283 -6 Left 903536275 1:24068384-24068406 CCAGAGTCCTTTTCCCTGTTCTG 0: 1
1: 0
2: 2
3: 36
4: 339
Right 903536283 1:24068401-24068423 GTTCTGGGAACTTTGTTGTGGGG 0: 1
1: 0
2: 2
3: 29
4: 263
903536275_903536288 22 Left 903536275 1:24068384-24068406 CCAGAGTCCTTTTCCCTGTTCTG 0: 1
1: 0
2: 2
3: 36
4: 339
Right 903536288 1:24068429-24068451 ATCAGAGTGTAGTGGGCTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 151
903536275_903536289 23 Left 903536275 1:24068384-24068406 CCAGAGTCCTTTTCCCTGTTCTG 0: 1
1: 0
2: 2
3: 36
4: 339
Right 903536289 1:24068430-24068452 TCAGAGTGTAGTGGGCTTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 196
903536275_903536284 14 Left 903536275 1:24068384-24068406 CCAGAGTCCTTTTCCCTGTTCTG 0: 1
1: 0
2: 2
3: 36
4: 339
Right 903536284 1:24068421-24068443 GGGTACACATCAGAGTGTAGTGG 0: 1
1: 0
2: 0
3: 2
4: 89
903536275_903536285 15 Left 903536275 1:24068384-24068406 CCAGAGTCCTTTTCCCTGTTCTG 0: 1
1: 0
2: 2
3: 36
4: 339
Right 903536285 1:24068422-24068444 GGTACACATCAGAGTGTAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 64
903536275_903536286 20 Left 903536275 1:24068384-24068406 CCAGAGTCCTTTTCCCTGTTCTG 0: 1
1: 0
2: 2
3: 36
4: 339
Right 903536286 1:24068427-24068449 ACATCAGAGTGTAGTGGGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 130
903536275_903536282 -7 Left 903536275 1:24068384-24068406 CCAGAGTCCTTTTCCCTGTTCTG 0: 1
1: 0
2: 2
3: 36
4: 339
Right 903536282 1:24068400-24068422 TGTTCTGGGAACTTTGTTGTGGG 0: 1
1: 0
2: 2
3: 24
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903536275 Original CRISPR CAGAACAGGGAAAAGGACTC TGG (reversed) Intronic
900622763 1:3594944-3594966 CAGGGCAGGGAGAGGGACTCAGG + Intronic
903186552 1:21632530-21632552 CAGATCAGGGATAAGAACACAGG + Intronic
903283586 1:22263789-22263811 CAGAACAGGGGCAGGGACACGGG + Intergenic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
904005779 1:27362483-27362505 CAGAACAGGTATGAGGACCCAGG + Intronic
905230767 1:36513834-36513856 CAGGACAGGTGAAAGGGCTCTGG - Intergenic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906970624 1:50509741-50509763 CAGTACAGGGAAAAGGTCATGGG + Intronic
907811609 1:57876497-57876519 CAGAACTGGGAAAATGATTCAGG + Intronic
909182207 1:72439169-72439191 CAGAACAGAGAGAAAGGCTCTGG - Intergenic
909753397 1:79192533-79192555 CAGTACTGTGAAAAGGACTCAGG + Intergenic
911159480 1:94670379-94670401 CAGAACAGAGCAAATGACTTTGG - Intergenic
911576570 1:99585382-99585404 TAGAATAGGGAAGAGGATTCTGG - Intergenic
912630468 1:111242409-111242431 CAGAACAGGGCACAGGAGACTGG + Intronic
912658356 1:111507598-111507620 GAGCCCAGGGAAAAGGCCTCTGG + Intronic
912762404 1:112380710-112380732 GACAACAGAGAAAAGGACTTGGG - Intergenic
913441547 1:118903644-118903666 TAGAAGATGGAAAAGGACTAAGG + Intronic
914707320 1:150181028-150181050 CAGAACAGAGACAAGGTTTCTGG + Intergenic
915578281 1:156796040-156796062 CAGGACAGAGCAAAGGACTGTGG + Intronic
916309467 1:163379272-163379294 CAAAACAGGTAAATGGCCTCTGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916652236 1:166843173-166843195 CAGCACAGGCAAAAGCACTGAGG + Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918213635 1:182374119-182374141 CAGAATAGGAGAAAGGCCTCAGG + Intergenic
918613792 1:186521679-186521701 CAGAACAGGCTACAGGAATCTGG - Intergenic
918640634 1:186837364-186837386 CATAGCAGGGAAAAGGAATATGG + Intronic
920181441 1:204134402-204134424 CAGAGCAGGGGAGCGGACTCTGG + Intronic
920530810 1:206700954-206700976 CAGAACAGGGTAAAGTCCTTGGG + Intronic
920564069 1:206959985-206960007 TGGAAGAGGGAAAAGGATTCAGG - Intronic
921103838 1:211955856-211955878 CAGAACAGGAAACAGAACTTTGG - Intronic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921717382 1:218432099-218432121 CTGAAGTGGGAAAATGACTCGGG + Intronic
922713289 1:227849717-227849739 CAGCACTGTTAAAAGGACTCAGG - Intergenic
924432347 1:244007816-244007838 AATATCAGGGACAAGGACTCTGG + Intergenic
1063536785 10:6891302-6891324 CAGGACAGGCCAAAGGACTTTGG + Intergenic
1064276797 10:13913795-13913817 CAGTACAGGGACAGGGACTTTGG - Intronic
1067661433 10:48238793-48238815 CAGATCAGGGAGAAGAACTGTGG - Intronic
1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG + Intergenic
1069789397 10:71010049-71010071 CAGAAAAGGGAAAGTGACTGGGG + Intergenic
1071418195 10:85460814-85460836 CATGACAGGGAAAAGATCTCAGG + Intergenic
1072032899 10:91538318-91538340 CAGAGCTGGGAACAGGACTCTGG + Intergenic
1072721338 10:97782724-97782746 GGGGACAGGGAAAAGGACTGTGG - Intergenic
1074221986 10:111446989-111447011 CAGAACTGGAAAGAGGACCCAGG + Intergenic
1074299619 10:112221804-112221826 CATAACAGGGAATATGACTATGG + Intergenic
1074363934 10:112843202-112843224 CTGTACAGGGAAAGGGATTCTGG + Intergenic
1075295706 10:121273128-121273150 AAGAAGAAGGAAAAGGCCTCTGG + Intergenic
1075514524 10:123098406-123098428 CACAACAGGGAAAAGGACTGAGG + Intergenic
1076986312 11:238411-238433 CAGAGCCAGGAAAAGAACTCAGG + Intronic
1077308616 11:1878736-1878758 CAGAACAGGGAGCAGGGCTGGGG - Intronic
1078023010 11:7671109-7671131 CAGAACAGGCTCAATGACTCTGG + Intronic
1078733467 11:13998272-13998294 CAGAATAGAGAAAATGACACAGG - Intronic
1079183155 11:18211571-18211593 CAGAGGGGGGAAAAGGGCTCAGG + Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080891270 11:36410890-36410912 CAGCACTGGGCACAGGACTCTGG + Intronic
1081164887 11:39796083-39796105 CAGAACAGAGAAAAGGAAACTGG - Intergenic
1083139169 11:60707428-60707450 CAGTACAGAGAAGAGGACTCCGG + Intronic
1084583843 11:70042342-70042364 CAGCACAGGGAGAGGAACTCAGG + Intergenic
1085040529 11:73323952-73323974 GAGAACAGGGAGAAGGACAGAGG - Intronic
1086557943 11:88133961-88133983 TAGAAAAGAGAAAAGGACTCAGG - Intronic
1087128674 11:94650749-94650771 AAAACCAAGGAAAAGGACTCAGG - Intergenic
1088835009 11:113570280-113570302 CAGAACTGGGATTAGCACTCAGG - Intergenic
1089323420 11:117641656-117641678 CAGAAGAGGGAGACAGACTCGGG + Intronic
1089750481 11:120648007-120648029 CAGAAGAGGGAAAAAGGCTGTGG - Intronic
1090234000 11:125133081-125133103 CTGAAGAGGGTGAAGGACTCTGG + Intergenic
1091681991 12:2533777-2533799 CAGAACCGGGACAGGGACGCAGG - Intronic
1092158136 12:6298236-6298258 CAAAACAGTGAAAAGGAGGCCGG + Intergenic
1092555658 12:9558429-9558451 CACAACAGTGAAAAAGCCTCTGG - Intergenic
1094499315 12:31008377-31008399 AAGGACAGGGAAGAGGGCTCTGG - Intergenic
1094516442 12:31132246-31132268 CACAACAGTGAAAAAGCCTCTGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096942715 12:55365340-55365362 CACAACAGTGACAAGGAATCTGG - Exonic
1097548286 12:61032671-61032693 CAGAACCTGAAAAAGGTCTCTGG + Intergenic
1099207638 12:79746462-79746484 CAGAATATGGAAAAGGTATCTGG + Intergenic
1100027731 12:90150515-90150537 CAGAAAAGGAGAAAGGACTCTGG - Intergenic
1102857737 12:116308877-116308899 CAGCAGAGGGAAAAGAAATCAGG - Intergenic
1104731622 12:131108474-131108496 CAGGAGAGGGCACAGGACTCAGG - Intronic
1105387000 13:19939930-19939952 CACAACAGTGAAAAGGAATTAGG + Intergenic
1105887437 13:24653714-24653736 CAGCATAAGGAAAAGAACTCTGG - Intergenic
1106264744 13:28100244-28100266 GAGAAGAGGGAAGAGGACGCGGG + Intronic
1106544209 13:30716259-30716281 AACAACAGGGAAAGGGACACCGG + Intronic
1107610891 13:42111869-42111891 CTGGACAGGGAAAAGGGCACAGG + Intronic
1107619700 13:42213676-42213698 CAGAACAAGAAAAGGGACTGAGG - Intronic
1108116805 13:47137792-47137814 CTGAACAGGGAAAAGGTCTAGGG - Intergenic
1109372244 13:61437830-61437852 CAGAAGAGAGAAATGGATTCTGG + Intergenic
1111716808 13:91888447-91888469 CAGATCAGAGAAAAGGCCTCAGG - Intronic
1111873283 13:93861732-93861754 GAAAACAGTGAAAAGAACTCTGG + Intronic
1112257692 13:97849958-97849980 AAGAACAGGGAACGGGACCCTGG + Intergenic
1112385754 13:98938296-98938318 CAGAGCTGGGGTAAGGACTCAGG - Intronic
1112393295 13:99004313-99004335 GAGAACAAGGAAAAGACCTCAGG + Intronic
1112429583 13:99338979-99339001 CAGAAGAGAGAACAGGACTAAGG - Intronic
1112449485 13:99495881-99495903 AAAAACAAGGAAAAGGACTCAGG + Intergenic
1112636064 13:101219356-101219378 CAATACTGGGAAAAGGAATCCGG + Intronic
1112829769 13:103434783-103434805 GGGAACAGGGAAAGGGACTGAGG - Intergenic
1113394005 13:109927147-109927169 CAGAACAAGGAAAATTACTGAGG + Intergenic
1113478398 13:110601995-110602017 CAGACAAGGGAATGGGACTCTGG - Intergenic
1113763961 13:112869361-112869383 CAGAACTGGGATAAGGAGTTAGG - Intronic
1114356248 14:21912380-21912402 CTGATTAGGGAAAAGGAGTCAGG + Intergenic
1116477475 14:45358156-45358178 TAGAACAGGGAAGATGACTTGGG + Intergenic
1117173698 14:53127314-53127336 AAGAACTGGGTTAAGGACTCAGG + Intronic
1118796136 14:69146692-69146714 GAGAACAGGGACAATGAATCAGG - Intronic
1118884853 14:69858099-69858121 CAGAGCAGGCACCAGGACTCAGG + Intronic
1119104447 14:71910916-71910938 CAGAGCTGGGAAAAAAACTCAGG - Intergenic
1121017123 14:90555631-90555653 AAGGGCAAGGAAAAGGACTCTGG - Intronic
1121021585 14:90583540-90583562 CAGCACAGTGAAATGGGCTCTGG + Intronic
1121525145 14:94614337-94614359 CAGGACAGGGACCAGGACGCAGG + Exonic
1121936923 14:98028349-98028371 ATGAATAGGAAAAAGGACTCAGG + Intergenic
1122094626 14:99362064-99362086 AAGAACAGGGCAGAGGAGTCAGG - Intergenic
1122671969 14:103379487-103379509 CAGGACAAGGACAAGGACCCTGG + Intergenic
1123758274 15:23413899-23413921 CAGAGCTGGGAGAAGGTCTCAGG + Intergenic
1123820736 15:24028060-24028082 CTGAAAAGAGAAAAGGATTCAGG + Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1123911763 15:24975014-24975036 CAGTACAGAGAAAAGCAGTCTGG + Intronic
1124194439 15:27608828-27608850 CACAACATGGAAAACGACCCTGG + Intergenic
1125895258 15:43296613-43296635 CACAGGAGGGAACAGGACTCAGG + Intronic
1126447947 15:48771033-48771055 AAGAAGAGGGAAAAGGAATGTGG - Intronic
1127222166 15:56891292-56891314 CAGAAGAGGGAAAAAGAGACTGG - Intronic
1128462645 15:67882916-67882938 TAAAACAGGGAAAAGGAATCAGG + Intergenic
1128694462 15:69750140-69750162 CAGCCCAGGGAGAAGGACTTAGG - Intergenic
1129706547 15:77797809-77797831 CAGAAGATGGAAAAGCCCTCAGG + Intronic
1132709077 16:1258622-1258644 CAGGACAGGGGACAGGGCTCAGG - Exonic
1134458064 16:14408995-14409017 CAGAGCTGGGAGAAGGTCTCAGG - Intergenic
1134915880 16:18070460-18070482 CAGATGAGGAAAAAAGACTCAGG - Intergenic
1135404887 16:22190729-22190751 CAAAACATGGAAAGAGACTCGGG - Exonic
1137966570 16:52940055-52940077 CAGAAAAGGGAGAAGGCCTATGG - Intergenic
1138510118 16:57503885-57503907 AAGAACAGAGAAGAGGACTCAGG - Intergenic
1141192264 16:81833340-81833362 CAGTCCAGGAAAAAGGACCCTGG - Intronic
1141202850 16:81910892-81910914 AAGAAAAGAGAAAAGGACACAGG - Intronic
1141238588 16:82243621-82243643 CAGAGCAGGGGAAAAGACACTGG + Intergenic
1142140383 16:88470181-88470203 CAGCACAGGGACAAGGACCGTGG - Intronic
1142429083 16:90016748-90016770 CACAACAGGGAACAGGATTTGGG - Intronic
1143190150 17:5034628-5034650 CAGGACAGGGCAAAGGTCACAGG + Exonic
1143722548 17:8822874-8822896 CAGAGCAGGGACAAGCACTGAGG + Intronic
1144131157 17:12249059-12249081 CAGCACAGGGAAAGGAACTCGGG + Intergenic
1144479887 17:15620529-15620551 CAGAATGGGGAATAGGAATCAGG + Intronic
1146820947 17:35983263-35983285 CAGCACAGAAAAAAGGACTATGG + Intergenic
1146969292 17:37059467-37059489 GTGAGCATGGAAAAGGACTCTGG - Intergenic
1147699253 17:42381955-42381977 CAGAAAAGGGATAAGAACTGTGG + Intronic
1147747289 17:42702599-42702621 CAGAGCAGGGAAGAGGAACCAGG + Intronic
1147759960 17:42791142-42791164 GAAAAGAGGGCAAAGGACTCTGG - Intronic
1148076837 17:44942012-44942034 CTGAACAGGGACCAGGACCCAGG - Intronic
1148552219 17:48557327-48557349 CAGAAGAGGGAACGGGACTGGGG + Intronic
1148679591 17:49466070-49466092 CAGAGCTGGGAAATGGCCTCAGG - Intronic
1148752007 17:49950721-49950743 AAGAAGAGGGGAGAGGACTCTGG + Intergenic
1149666791 17:58370631-58370653 CAGAGCAGGGGAAGGGACTCAGG + Intronic
1150510534 17:65747753-65747775 CAGAACGGGGCACAGGTCTCAGG + Intronic
1152259177 17:79257556-79257578 AAGAACAGTGAGAAGGACTCAGG - Intronic
1154022328 18:10675543-10675565 CAGAATTGGGAAAAGGCCTGTGG - Intronic
1155090528 18:22504771-22504793 TAGGACAAGGAAAAGAACTCAGG + Intergenic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156487487 18:37475769-37475791 GAGAACAGGGAAAATGTGTCTGG - Intronic
1157104631 18:44762172-44762194 CAGAACTGGGAAAAGAAGTCAGG - Intronic
1158245812 18:55430983-55431005 AAGCAAAGGGAAAAGGAGTCAGG + Intronic
1159787192 18:72727907-72727929 CAGCACAGGGAAAAGGCATGTGG - Intergenic
1160068903 18:75607226-75607248 GAAAACAGGGAGAAGGACACAGG - Intergenic
1160698939 19:497205-497227 CAGTAAAGTGAAGAGGACTCAGG + Intronic
1160890692 19:1377299-1377321 CAGTGCAGGGAAATGCACTCAGG - Exonic
1160965022 19:1743573-1743595 CAGAACTGGGATGTGGACTCAGG - Intergenic
1161042821 19:2119071-2119093 CAGAAGAGGAAAAAGGACAACGG + Intronic
1161406760 19:4095225-4095247 CAGCTCTGGGAAAAGGAATCTGG + Intronic
1162940236 19:14005192-14005214 CAGCCCAGAGAAAAGCACTCAGG + Intronic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165874450 19:38996067-38996089 TGGATCAGGGAAAAGGACTTTGG + Intronic
1166966222 19:46530768-46530790 CAGGAGAGGGAAGTGGACTCTGG - Intronic
1167834899 19:52060481-52060503 AAAAACGAGGAAAAGGACTCAGG - Intronic
1168321772 19:55514815-55514837 CAGAGCTGTCAAAAGGACTCAGG - Intronic
1168501151 19:56894632-56894654 CAGGAAAGGGAAAAGGACCCAGG - Intergenic
1168673051 19:58255959-58255981 GAGAAAAAGGAAAAGGACTAAGG + Intronic
925031676 2:654615-654637 CAGGAAGGAGAAAAGGACTCTGG + Intergenic
925480111 2:4261266-4261288 CAGAACAGGGACATGTACTGGGG + Intergenic
926404644 2:12538850-12538872 CAGAACTGGGAATAGAATTCAGG + Intergenic
926837782 2:17043613-17043635 CAGAGCAGGGATGAGGACCCAGG + Intergenic
926878158 2:17508825-17508847 GAGAACAGGGCAAAGGACTAAGG + Intergenic
927427102 2:22993835-22993857 CAGTACAGGTAAAAGAACACTGG + Intergenic
928876193 2:36042583-36042605 CAGAAAAGGGGAGAGGACTGGGG - Intergenic
928896970 2:36277076-36277098 GAAACCAGGGAAAAGGACTTAGG - Intergenic
929616615 2:43314793-43314815 CAGAAGAGGAAAAAGAACACAGG + Intronic
931145710 2:59514840-59514862 CAGAACTGGGATTAGAACTCAGG + Intergenic
932619328 2:73256580-73256602 CAGAACAGGGTGGAGGACTGAGG + Exonic
933464818 2:82639027-82639049 CAGAAGAGGGACAAGGCCTGTGG + Intergenic
935815425 2:106842699-106842721 CTGAACAGTGAGAAGGACGCCGG + Intronic
936227395 2:110669164-110669186 CAGAACAGAGGAAAGGACATTGG + Intronic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936962558 2:118090983-118091005 CTGACCAGGGAAAAAGTCTCTGG - Intronic
938045981 2:128120905-128120927 TAGAAAAGGGAAAAGGACTTGGG + Intronic
938705296 2:133919340-133919362 CAGAACAGGGACTTGGACACAGG + Intergenic
939588804 2:144037768-144037790 CAGAAAAAGAAAACGGACTCTGG + Intronic
939812416 2:146850599-146850621 CCACACAGGGAAAAGGATTCTGG - Intergenic
940596686 2:155803040-155803062 CAGAACAGAGAAATGGATCCTGG - Intergenic
941884829 2:170517127-170517149 AAGAACAGGGAGAAGGATTTGGG - Intronic
944205904 2:197158035-197158057 CAGAACATGGGAAAGGGTTCTGG + Intronic
945623792 2:212174364-212174386 ATCAACAGGGAAAAGGACTGAGG + Intronic
945721372 2:213421950-213421972 CAGAACAGAGAACAGCTCTCAGG - Intronic
946047667 2:216834661-216834683 CAAAACTGGGATAAGGACTTTGG + Intergenic
946054915 2:216892710-216892732 CTTAACAGGGAAAAGGATGCAGG + Intergenic
946127657 2:217578107-217578129 CAGAACAGGGTCCAGGACCCTGG + Intronic
946481966 2:220065946-220065968 CTCAACAGGGAAAATCACTCAGG + Intergenic
946703029 2:222431645-222431667 AAGAACAGGGAATAGGGTTCGGG + Intronic
946830638 2:223724946-223724968 CGGAAAAGGGAAGAGGGCTCAGG + Intergenic
947482646 2:230515317-230515339 CAGAACAGGAAAAAGGCCAAAGG - Intronic
947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG + Intronic
948283267 2:236764951-236764973 ATGAACAGGGAAAAGGAAACTGG - Intergenic
948332446 2:237180384-237180406 CAGGAAAGGGAATAGGACCCGGG - Intergenic
1168743120 20:211866-211888 CAGAACACAGAAAATGACTTAGG + Intergenic
1168857119 20:1016569-1016591 CAGAGCTGGGAAAAGGATTTGGG - Intergenic
1170658658 20:18315319-18315341 AAGAACCAAGAAAAGGACTCTGG + Exonic
1172161473 20:32871783-32871805 CAGAACAGGAAGAAGGACACTGG - Intronic
1172215467 20:33232716-33232738 CTGAACAGGGGAAAGGTCTCAGG - Intergenic
1172488670 20:35316630-35316652 AAGAAAAAGGAAATGGACTCAGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1173252615 20:41372566-41372588 CTGACCAGGGAAAGGGAGTCTGG - Intergenic
1173729397 20:45318000-45318022 CAGGGCAGGGACAGGGACTCAGG - Intergenic
1174420012 20:50393434-50393456 CAGACCAGGGAATAACACTCAGG + Intergenic
1175576359 20:60063608-60063630 CAGTGAAGGGAATAGGACTCTGG + Intronic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1179398427 21:41062042-41062064 AAGGACAGGGAAAAGGGCTGGGG - Intergenic
1179803685 21:43824200-43824222 GAGACCAGGGAAGAGGCCTCGGG - Intergenic
1181726395 22:24813957-24813979 CAGAACTGGAACAAGGACACAGG - Intronic
1181884233 22:26007027-26007049 AAGAAAAGGGAAAGAGACTCTGG - Intronic
1181937307 22:26448175-26448197 CAGCACAGGGAGAAGGACCTGGG - Intronic
1182129977 22:27843720-27843742 AAGAGGAGGGAAAAGGGCTCCGG + Intergenic
1182143788 22:27984391-27984413 CAGAACTGAGCAATGGACTCTGG - Intronic
1182322494 22:29487207-29487229 CAGAACTGGGACAAGTCCTCAGG - Intronic
1182477153 22:30582497-30582519 CAAAACAGGGCAAAGAACTGAGG + Intronic
1184913024 22:47548845-47548867 CAAAACCGGGAAACGGACCCTGG + Intergenic
1185251953 22:49807020-49807042 CACACCAGGGAAAAGAACCCCGG + Intronic
950609872 3:14119351-14119373 CAGAACAGGAACAGGAACTCTGG + Intronic
951065466 3:18259951-18259973 GAGAAGAGGGAAATGGCCTCTGG + Intronic
951399332 3:22212162-22212184 CAGAAGAGTGCAAAGGACTGAGG + Intronic
953566862 3:44039552-44039574 CACAACAGGGAAAAGAAATAAGG + Intergenic
954280113 3:49571280-49571302 CAGGACAGGGAAGAGGAGCCTGG + Intronic
955386409 3:58484643-58484665 CAGAACCAGGGAAAGGAATCTGG - Intergenic
955474097 3:59317636-59317658 CAGGACTGGGATCAGGACTCTGG + Intergenic
955487706 3:59451353-59451375 TGGAACAGGAAAAAGGCCTCTGG + Intergenic
957137763 3:76310944-76310966 CAGAAAAGGGAAAAGATGTCAGG - Intronic
958720495 3:97837452-97837474 GAGAACAGGGAAAAAGAATCAGG - Intronic
959554285 3:107698961-107698983 GTGAACAAGGAAAAGGACTATGG + Intronic
960096255 3:113692917-113692939 CAGCACAGAGTAAAAGACTCAGG + Intronic
962316474 3:134362606-134362628 CAGTACAGTGAAAATGACTATGG + Intronic
962737453 3:138338627-138338649 CTGAAAAGGGAAGAGGACCCAGG - Intergenic
963398606 3:144767014-144767036 CAGAACTGGGAGTAGGCCTCAGG + Intergenic
966507482 3:180723016-180723038 GAGAACAGGGAAAAGGAATTAGG - Intronic
966881453 3:184353428-184353450 CAGAACAGGTGGAAGGACTCAGG + Intronic
966924390 3:184635040-184635062 CAGCACAGGGCAAAAGAGTCAGG - Intronic
969058472 4:4416530-4416552 CAAAACAGGGAAAACGCCCCCGG + Intronic
969180529 4:5437114-5437136 CAGTACACGGGAAAGGACCCTGG + Intronic
969281936 4:6176670-6176692 CTGAACATGCAAAAGGACCCAGG + Intronic
969355284 4:6621348-6621370 CAGGACAGGGAAAAGCAGTGCGG + Exonic
969417865 4:7072895-7072917 CAGAACTGTGAAAAGCACTGTGG + Intergenic
969847033 4:9927423-9927445 CACAAGAGGGAAGAGGCCTCCGG - Intronic
969940694 4:10728081-10728103 CAGAACTGGGGAAAGGCTTCTGG + Intergenic
971914645 4:32851834-32851856 CAGCACAGGCTAAAGGGCTCTGG - Intergenic
977227688 4:94412842-94412864 CAGAACAGGGGAAAGCATTTGGG - Intergenic
978175068 4:105720051-105720073 GAGAACAGAGAAAAGCACACAGG - Intronic
978385061 4:108169852-108169874 AAGAGAAGGCAAAAGGACTCAGG + Intergenic
978470774 4:109065027-109065049 CAGAACTGTGACAAGAACTCGGG + Intronic
980242500 4:130195037-130195059 CAGAACTGGTAAAAGGAACCTGG + Intergenic
981169841 4:141609024-141609046 CAGAACTGGGAAAAGGATGGAGG + Intergenic
981741682 4:148008731-148008753 CAGAACCCTGAAAAGGTCTCAGG - Intronic
982381990 4:154759032-154759054 CAGAACAGGGAATAAGTGTCAGG - Intergenic
982868431 4:160546380-160546402 CAGGAGAGGTAAAAGGCCTCAGG + Intergenic
983460901 4:168024921-168024943 CAAATTAGGGAAAAGGAGTCAGG + Intergenic
984258068 4:177410697-177410719 CAAAACAGGAAAAGGTACTCAGG - Intergenic
986379069 5:7164820-7164842 CAAAACAGGGAAAATGATTTAGG + Intergenic
987322651 5:16784887-16784909 CAGAGCAGGTGAAAGGACTGTGG - Intronic
989732536 5:44665088-44665110 CAGAAGCGGGACAAGAACTCAGG + Intergenic
990267626 5:54095088-54095110 TAGGACAGGGAAAAGGATTTAGG + Intronic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
990535718 5:56719958-56719980 CAGAAGAGGGAATGAGACTCAGG + Intergenic
990679603 5:58226884-58226906 CATACCATGGAAAAGTACTCAGG + Intergenic
990688972 5:58340782-58340804 AGAAAGAGGGAAAAGGACTCAGG + Intergenic
991300585 5:65125643-65125665 CAAGGCAGGGGAAAGGACTCCGG - Intergenic
991511130 5:67377309-67377331 CAGAACTGGGAAAAGGAGAGGGG - Intergenic
992531885 5:77659940-77659962 CAGAACAGGCTAAAGGGCTCTGG - Intergenic
993802876 5:92365918-92365940 GAGAGGAGGGAAAAGGACACTGG + Intergenic
995180771 5:109228387-109228409 CAGAGCAGGGCAAAGAACTTTGG + Intergenic
995484719 5:112628678-112628700 CAGAATGGGGAAAAAGAATCCGG + Intergenic
995677974 5:114684835-114684857 TAGAACAAGGAATAGGACTGAGG + Intergenic
995786920 5:115840620-115840642 CAGAACGGGGAAAACGTCTAAGG + Intronic
996686100 5:126282675-126282697 CAGGTCAGGTAAAAGGTCTCAGG - Intergenic
996832841 5:127758824-127758846 GAGGACAAGGAAAGGGACTCTGG + Intergenic
998342636 5:141431751-141431773 CAGAACAGTGATCAGGACTTTGG - Exonic
999699928 5:154218923-154218945 CACTGCAGGGAAAAGGACACAGG - Intronic
999878892 5:155839398-155839420 CAGAAAAGGTAAAAGGCCTCAGG - Intergenic
1000277793 5:159754395-159754417 GTGATCAGGGAAAAGAACTCTGG + Intergenic
1000391535 5:160727830-160727852 CAGGAAAGGTAAAAGGCCTCAGG + Intronic
1000478276 5:161739949-161739971 CTGAATAGGGAAAATGATTCAGG - Intergenic
1001403605 5:171460940-171460962 CAGAAGAGGGGAGAGGACCCAGG + Intergenic
1001775435 5:174325998-174326020 CAGAACAGGGATATGCACCCAGG - Intergenic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1004716227 6:18218788-18218810 GAGCAGAGGGAAGAGGACTCAGG - Intronic
1004990031 6:21126568-21126590 AGGAAAAGGGAAGAGGACTCAGG - Intronic
1005756346 6:28927871-28927893 CTAATCAGGGAAAAGGAGTCAGG + Intergenic
1005819591 6:29586881-29586903 CAGGTCAGAGACAAGGACTCAGG - Intronic
1007159550 6:39777959-39777981 GAGAACATGGAGAAGGTCTCAGG - Intergenic
1007924988 6:45643229-45643251 CAGCACAAGGAAGAAGACTCTGG - Intronic
1009489283 6:64267769-64267791 CAGAACACAGAAAAGGAATATGG + Intronic
1010386962 6:75291231-75291253 AATAACAGGGAAAAGGAGACAGG + Intergenic
1010529015 6:76942899-76942921 CAGAGCAGGGAAAGACACTCTGG + Intergenic
1012283709 6:97362666-97362688 CAGAACAGGTACAAGGAGTTTGG + Intergenic
1015417253 6:132963443-132963465 CAGAACTGGGACCAGGACTGAGG + Intergenic
1016141885 6:140622692-140622714 CAGAACAGAGAAAATTATTCTGG + Intergenic
1016815216 6:148297143-148297165 CAGCACAGAGAGTAGGACTCTGG + Intronic
1017128736 6:151090292-151090314 CAGCACAGGGAAAGGGAGACTGG - Intronic
1017638766 6:156469806-156469828 GAGAACAGGGGAAAGGCTTCAGG + Intergenic
1018216598 6:161534117-161534139 CAGGACAGGGAAAGGGAGTCTGG - Intronic
1018512459 6:164540113-164540135 CAGGCCAGGGGAAAGGATTCAGG + Intergenic
1019257525 7:61665-61687 AAGACCAGTGGAAAGGACTCGGG - Intergenic
1020784945 7:12562125-12562147 CAGAACAGGAAACTGAACTCAGG + Intergenic
1020821333 7:12971864-12971886 CAGAAGAGTGAAAAGTACCCAGG - Intergenic
1023860993 7:44217699-44217721 CAGAATGGGGAACAGGACACAGG - Exonic
1024656920 7:51458777-51458799 CAGACCCAGGAAAATGACTCAGG - Intergenic
1025250952 7:57351048-57351070 CAGACCAGGGAAGAACACTCAGG - Intergenic
1030693019 7:112554105-112554127 CAGACCAGGAAAGAGTACTCAGG - Intergenic
1031636639 7:124108894-124108916 CAGCAAAGGGAAAAGGACATGGG + Intergenic
1032545944 7:132742685-132742707 CAGAAATGGGAAAGGGACACAGG - Intergenic
1033266964 7:139895060-139895082 AAGAACAGGAAACAGGATTCTGG + Intronic
1033490315 7:141837160-141837182 CAGAACAAGGAAAAAGCCACAGG - Exonic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034317173 7:150143575-150143597 GGGATCAGGGAAGAGGACTCAGG - Intergenic
1034724442 7:153322184-153322206 CAGAACAGAGCCTAGGACTCGGG + Intergenic
1034775580 7:153823641-153823663 GGGATCAGGGAAGAGGACTCAGG + Intergenic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1036029459 8:4951487-4951509 CAGAACAGGGAAAGGGAAAGAGG + Intronic
1036222349 8:6931263-6931285 CAGAAGAGGCCATAGGACTCAGG + Intergenic
1036707599 8:11056764-11056786 CAAGACATGGAAAAGGGCTCAGG - Intronic
1037992597 8:23331322-23331344 CAGAGGAGGGAGAAGGGCTCTGG - Intronic
1038510494 8:28129932-28129954 GAGAGCAGGGGAGAGGACTCGGG + Intronic
1038526223 8:28275960-28275982 CAGAACAGGAAAAAGGAGCCTGG - Intergenic
1040676587 8:49757665-49757687 CAGCCCAGGGAGAGGGACTCTGG - Intergenic
1040768952 8:50950123-50950145 CAGAACAGCCAGAAGTACTCTGG + Intergenic
1041260956 8:56020143-56020165 AAGCACAGGGAGAAGGCCTCGGG - Intergenic
1042755289 8:72203763-72203785 CAGAACAGGGAAAATGGCCAAGG - Intergenic
1043670830 8:82882101-82882123 CACAACAGGGACAAGGAATGGGG - Intergenic
1043995583 8:86811353-86811375 CAAAACAGAGAAATGAACTCAGG - Intergenic
1045192342 8:99895401-99895423 CAGGACAGGCAAAAGAACACAGG - Intergenic
1045308652 8:100981401-100981423 CAGAACAGAGGAGAGGACTGTGG + Intergenic
1045543132 8:103105083-103105105 CAGGAGAGGAAAAAGGACTTTGG - Intergenic
1047619325 8:126590309-126590331 AAGAACAGGTAAAAAGACTCAGG + Intergenic
1047679894 8:127243914-127243936 AAGAAAAGGGACAAGGACTTCGG + Intergenic
1047757089 8:127927023-127927045 CAGAAAGGGGAAAAGGACGTGGG + Intergenic
1047861697 8:128974180-128974202 CAGAACAGGGAAACTGAGTCTGG - Intergenic
1048718276 8:137293064-137293086 TAGAGCAGGGAAAAGGACACTGG + Intergenic
1049758212 8:144320208-144320230 CAAAGCAGGGAAAAGGCTTCAGG + Intronic
1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG + Intronic
1053603883 9:39637412-39637434 CAGAACAATTAAAAGGACTAAGG + Intergenic
1053861700 9:42393459-42393481 CAGAACAATTAAAAGGACTAAGG + Intergenic
1054249658 9:62705002-62705024 CAGAACAATTAAAAGGACTAAGG - Intergenic
1054563768 9:66739534-66739556 CAGAACAATTAAAAGGACTAAGG - Intergenic
1054731664 9:68706843-68706865 CAGAACAGGGGAGAAGTCTCTGG - Intronic
1056222573 9:84464920-84464942 CACAGCAGGGAGAAGGACTTAGG - Intergenic
1056755151 9:89377003-89377025 CAGGACAGGGAAGAGGAGCCAGG + Exonic
1057793557 9:98140085-98140107 CAGAACAGGGACCAGGACCCAGG + Intronic
1058748507 9:108015851-108015873 AAGAACAGGGCAGAGTACTCAGG - Intergenic
1058907273 9:109492094-109492116 CAGAGCAGGGGAGGGGACTCGGG + Intronic
1059391361 9:114001522-114001544 CAGAACAGGGACAGGGACCCAGG + Intronic
1059983264 9:119796528-119796550 CAGAATAGTTAAAAGGTCTCAGG + Intergenic
1060491613 9:124089241-124089263 CAGAGCAGGACAAAGGACACGGG + Intergenic
1186169065 X:6858147-6858169 CAAAACATGGATAAGAACTCTGG + Intergenic
1186526879 X:10257095-10257117 CAGAAGGTGGAAAAGGATTCAGG - Intergenic
1187409607 X:19038787-19038809 TAGAATAGGGAATGGGACTCTGG - Intronic
1188523609 X:31065465-31065487 AATAAAAGGGACAAGGACTCTGG + Intergenic
1189047410 X:37608196-37608218 CAGAACACAGAACAGAACTCAGG + Intronic
1189561367 X:42194563-42194585 GAGGACAGGGAGAAGGACACTGG - Intergenic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1190082298 X:47366056-47366078 GAGAAGAGGGGAAAGGAGTCAGG - Intergenic
1192106804 X:68325762-68325784 CCGGACACGGAAAAGGACACCGG - Intronic
1195500108 X:105587033-105587055 CAGAACAGGGTAATGATCTCTGG - Intronic
1197793855 X:130280775-130280797 GAAAACAAGGAAAAGGACTCAGG - Intergenic
1197880293 X:131159310-131159332 CATAGCAGGGAAATGGACTGTGG + Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198302771 X:135347582-135347604 GAGAAAAAGGAAGAGGACTCTGG - Intronic
1199458478 X:148056253-148056275 CAGAACAGTAGAAAGCACTCAGG - Intergenic
1200683606 Y:6242133-6242155 CAATACAGGGACATGGACTCTGG - Intergenic
1200803921 Y:7412788-7412810 CGAAAGAGGGAAGAGGACTCCGG - Intergenic
1200843378 Y:7806541-7806563 CATAACAGGGAAAAGCAACCAGG - Intergenic
1201049029 Y:9912253-9912275 CAATACAGGGACATGGACTCTGG + Intergenic
1201701943 Y:16892534-16892556 CAGAACAGCAAAAAGGACTAAGG - Intergenic