ID: 903536617

View in Genome Browser
Species Human (GRCh38)
Location 1:24071235-24071257
Sequence CCAGTGATCAAACTGATCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903536617_903536629 3 Left 903536617 1:24071235-24071257 CCGGAGATCAGTTTGATCACTGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 903536629 1:24071261-24071283 GCGCAGGACGGGAAGGGGGTGGG 0: 1
1: 0
2: 2
3: 34
4: 410
903536617_903536625 -3 Left 903536617 1:24071235-24071257 CCGGAGATCAGTTTGATCACTGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 903536625 1:24071255-24071277 TGGGAGGCGCAGGACGGGAAGGG 0: 1
1: 0
2: 1
3: 26
4: 400
903536617_903536624 -4 Left 903536617 1:24071235-24071257 CCGGAGATCAGTTTGATCACTGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 903536624 1:24071254-24071276 CTGGGAGGCGCAGGACGGGAAGG 0: 1
1: 0
2: 1
3: 31
4: 464
903536617_903536630 7 Left 903536617 1:24071235-24071257 CCGGAGATCAGTTTGATCACTGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 903536630 1:24071265-24071287 AGGACGGGAAGGGGGTGGGTTGG 0: 1
1: 0
2: 4
3: 87
4: 1069
903536617_903536627 -1 Left 903536617 1:24071235-24071257 CCGGAGATCAGTTTGATCACTGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 903536627 1:24071257-24071279 GGAGGCGCAGGACGGGAAGGGGG 0: 1
1: 0
2: 8
3: 143
4: 1539
903536617_903536623 -8 Left 903536617 1:24071235-24071257 CCGGAGATCAGTTTGATCACTGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 903536623 1:24071250-24071272 ATCACTGGGAGGCGCAGGACGGG 0: 1
1: 0
2: 0
3: 17
4: 143
903536617_903536626 -2 Left 903536617 1:24071235-24071257 CCGGAGATCAGTTTGATCACTGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 903536626 1:24071256-24071278 GGGAGGCGCAGGACGGGAAGGGG 0: 1
1: 0
2: 2
3: 68
4: 794
903536617_903536622 -9 Left 903536617 1:24071235-24071257 CCGGAGATCAGTTTGATCACTGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 903536622 1:24071249-24071271 GATCACTGGGAGGCGCAGGACGG 0: 1
1: 0
2: 1
3: 21
4: 360
903536617_903536628 2 Left 903536617 1:24071235-24071257 CCGGAGATCAGTTTGATCACTGG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 903536628 1:24071260-24071282 GGCGCAGGACGGGAAGGGGGTGG 0: 1
1: 0
2: 1
3: 78
4: 997

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903536617 Original CRISPR CCAGTGATCAAACTGATCTC CGG (reversed) Exonic
900247345 1:1643045-1643067 GCAGTCATCACACTGACCTCGGG - Intronic
900258569 1:1710177-1710199 GCAGTCATCACACTGACCTCGGG - Intronic
903536617 1:24071235-24071257 CCAGTGATCAAACTGATCTCCGG - Exonic
905303516 1:37001864-37001886 CCAGTGGTAAGACTGAGCTCCGG - Intronic
906798067 1:48713228-48713250 ACAGTGATCAACCTGGACTCAGG + Intronic
907723426 1:56995800-56995822 CCAGAAAACAAACTGGTCTCAGG + Exonic
907885490 1:58588999-58589021 CCAATGCTCTAACTGTTCTCAGG + Intergenic
909422570 1:75483291-75483313 CCAGTAATAAAAATGATATCTGG - Intronic
910529926 1:88224253-88224275 CCAGTGATCAAAGTGATTCTTGG + Intergenic
915545483 1:156594851-156594873 CCAGAAAGGAAACTGATCTCTGG - Intronic
915634363 1:157176017-157176039 CCAGGGATCAAACCAAGCTCAGG - Intergenic
916687228 1:167158415-167158437 CCAGTGATTAAAAAGAACTCAGG + Intergenic
919955747 1:202413515-202413537 GTGGTTATCAAACTGATCTCAGG + Intronic
920434478 1:205939281-205939303 CCAGGGACAAAGCTGATCTCAGG + Intronic
921616883 1:217279255-217279277 CCAGTGATGAAACTGACTCCTGG - Intergenic
1063556005 10:7080520-7080542 CCAGTCCTCAAACAGAGCTCAGG + Intergenic
1064084275 10:12333550-12333572 CCAGAAATCAAACTGTTCCCAGG - Intergenic
1078175630 11:8967595-8967617 CCAGTGATCAAATAGCTCTCTGG + Intergenic
1081905447 11:46666649-46666671 CCTGTGAGCTAACTGAGCTCAGG - Intronic
1084380096 11:68806254-68806276 CCAGTGAACCACCTGAGCTCAGG - Intronic
1089251687 11:117167734-117167756 CCAGTGATAGAACTGATCTGAGG - Exonic
1099241407 12:80143420-80143442 CCTGTGTTCAAAGTGATCCCTGG + Intergenic
1100385122 12:94099003-94099025 CCAGTGACCAAAAAGATGTCTGG - Intergenic
1102029354 12:109731104-109731126 CCAGGGTTCAAACTGAGTTCTGG + Intronic
1104230708 12:126881196-126881218 CCAATGATGCAACTGATCCCAGG - Intergenic
1104231436 12:126888436-126888458 CTACTGATAAAACTGATTTCTGG + Intergenic
1107263088 13:38518817-38518839 CCAGTGTTCAAAACCATCTCAGG - Intergenic
1107401325 13:40072481-40072503 CCAGTCATGAAACTGAGCTTTGG - Intergenic
1109352030 13:61195148-61195170 CCGGTGATCACACAGGTCTCTGG + Intergenic
1111070749 13:83163568-83163590 CCAGTGATCAAAAATATCTGTGG + Intergenic
1114840576 14:26258279-26258301 ACAGTGACCAAACTGATCTGTGG + Intergenic
1115518237 14:34206593-34206615 CCAGAGATAAAACTGAAGTCTGG + Intronic
1117379600 14:55147429-55147451 CAAGTTATCAAAGTGATTTCAGG - Intergenic
1118774832 14:68967212-68967234 CCAGCAATCAACCTCATCTCTGG + Intronic
1119562261 14:75600130-75600152 ACAGTGATGAAAGTGACCTCTGG + Intronic
1120409040 14:84128136-84128158 CCAGTTATCAAACTGTGCTAAGG + Intergenic
1120892490 14:89503744-89503766 CCAGTGACCAAACAGAGCTGCGG - Intronic
1122269814 14:100563800-100563822 CCAGGGAACAAACGGATTTCAGG + Intronic
1123045233 14:105509149-105509171 TCAGTTCTCAAACTGATCTATGG - Intergenic
1125806650 15:42498733-42498755 CCAGTGATCTGAGTGATCTCAGG + Intronic
1129131287 15:73499368-73499390 CAAGTGATCAAACTGGATTCTGG - Intronic
1130330648 15:82919543-82919565 TCACAGATCAAACTGACCTCAGG + Intronic
1133281284 16:4666850-4666872 CCAGACATCAAACTCAGCTCTGG - Intronic
1135435110 16:22421375-22421397 CCAGTGATAAAAGTGATCAAAGG - Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1155936550 18:31760797-31760819 CCAGTTATCAAAATGGACTCGGG - Exonic
1156476085 18:37406296-37406318 CCACTGACCAAACTGAACTGGGG - Intronic
1163103678 19:15111418-15111440 CCAGTGATGACATTGATATCGGG - Exonic
1166918150 19:46210066-46210088 CCAGTGACCAAACTGATAAAGGG - Intergenic
933637176 2:84720925-84720947 GCAGGGATCAAACTGATCCTTGG + Intronic
933770057 2:85737883-85737905 TCAGGGATAAAACTGATATCAGG + Intergenic
936889649 2:117354444-117354466 CCTGTGTTCAAACTGCTCTTTGG - Intergenic
941729440 2:168899928-168899950 CCAGAAATATAACTGATCTCAGG + Intronic
949014093 2:241699831-241699853 CTGGGGATCAAACTCATCTCTGG - Intergenic
1174105251 20:48157320-48157342 ACAGTGACCAAAGTGATCTCTGG + Intergenic
1175796604 20:61775128-61775150 CCAGTGATCAAACTGTGGTTTGG - Intronic
949785206 3:7733046-7733068 ACAGTGATGAAAGTGACCTCTGG - Intronic
951620937 3:24601870-24601892 CCAGAGAGCAAACTGATCCGGGG - Intergenic
954928015 3:54254230-54254252 CCAGAGATCAAACTCACCACTGG - Intronic
958108344 3:89106270-89106292 CCAGTCATCAAACTATTATCTGG + Intergenic
958515836 3:95114269-95114291 CCAATGATCAAAAGCATCTCTGG - Intergenic
960309530 3:116104122-116104144 CCAGTGTTCATACTGAGTTCTGG - Intronic
973220754 4:47723435-47723457 CCAGATATCAGACTGATCCCTGG + Intronic
973220753 4:47723435-47723457 CCAGGGATCAGTCTGATATCTGG - Intronic
976312912 4:83630268-83630290 CCAGTGATAAAGCTGTTCTGTGG - Intergenic
976822900 4:89226992-89227014 CCAGTTAGCAAACTGTTCACTGG + Intergenic
984886713 4:184456104-184456126 TCACTGATCACACTGATCACGGG + Intronic
990968201 5:61472310-61472332 CCACTGATCCCACTGATCTAGGG + Intronic
991132894 5:63145493-63145515 CCAGTGACCAAACTGACTTGAGG - Intergenic
992061997 5:73061100-73061122 CCAGTGATAAAACTGCCCCCAGG - Intronic
993744395 5:91578392-91578414 ACAGTGATGAAACTTATCTGGGG - Intergenic
998460432 5:142305912-142305934 GCTGTTCTCAAACTGATCTCAGG - Intergenic
1004979754 6:21010462-21010484 CAAGTGATGAAATGGATCTCTGG - Intronic
1008689710 6:53964360-53964382 CCAGAGACCAAACAAATCTCTGG + Intronic
1008927569 6:56903041-56903063 CTAGTGGTCAAACTAAACTCTGG - Intronic
1010374452 6:75150435-75150457 CCAGTGAAGAAACTGAGATCTGG - Intronic
1015452858 6:133390835-133390857 CCAGTGCTCAAACTGCACTCTGG - Intronic
1017993678 6:159511733-159511755 ACAGTGATGAAAGTGACCTCTGG - Intergenic
1020779028 7:12495029-12495051 CCATTGATAAAATTGCTCTCAGG + Intergenic
1021909359 7:25368790-25368812 GCAGAGATCAAACTATTCTCAGG + Intergenic
1022815668 7:33912056-33912078 CCAGTGATCCCAGTGATCTTTGG + Intronic
1026510745 7:71025379-71025401 CCAGGGATAACACTCATCTCTGG + Intergenic
1026918025 7:74134297-74134319 ACAGTGATGAAACTGACCTCTGG + Intergenic
1027735839 7:81931951-81931973 CCAATGTACAACCTGATCTCAGG + Intergenic
1028941414 7:96526227-96526249 ACAGTGATAAAACAGTTCTCTGG + Intronic
1033706127 7:143886283-143886305 CCTGGGACCAAACTGTTCTCTGG + Intronic
1034017329 7:147601185-147601207 CCAGTGAAAATACTGATGTCTGG - Intronic
1034276761 7:149827240-149827262 CCAGTGAGGAAACTGAGGTCTGG + Intergenic
1035739928 8:1919359-1919381 CAAGTGATGAAGCTGTTCTCTGG + Intronic
1037970788 8:23170417-23170439 CCAGAGATCAGTCTGGTCTCTGG + Intergenic
1037970787 8:23170417-23170439 CCAGAGACCAGACTGATCTCTGG - Intergenic
1040878383 8:52176503-52176525 CCAGTGAGCAGACTGTTCGCTGG + Intronic
1043322490 8:79007012-79007034 CCAGTGAACAAATTGAGCACTGG - Intergenic
1048081412 8:131132097-131132119 GCAGAGATCAAACTTCTCTCAGG - Intergenic
1051269734 9:15343802-15343824 ACAGTGGTCAAAGTCATCTCTGG + Intergenic
1051467560 9:17397505-17397527 ACAGTGATCAGAGTGACCTCTGG - Intronic
1055717184 9:79130988-79131010 CAAGTGATGAAACTGGTCTAGGG - Intergenic
1056691948 9:88815240-88815262 CCAGTTATCCCACTGCTCTCTGG + Intergenic
1057542994 9:95993267-95993289 CCAGTGCTCAGACTGCTATCTGG + Intronic
1057739293 9:97697676-97697698 CCACTGAAGAAACTGAACTCTGG - Intergenic
1059827912 9:118053032-118053054 TCAGTGATCAAAATAATCTTAGG - Intergenic
1186403132 X:9277966-9277988 CCTGTGTTCAAACTGCTCCCTGG + Intergenic
1188158849 X:26775975-26775997 CCAGAGATCTCACAGATCTCTGG - Intergenic
1202578861 Y:26357665-26357687 GTGGTTATCAAACTGATCTCAGG - Intergenic