ID: 903537461

View in Genome Browser
Species Human (GRCh38)
Location 1:24076464-24076486
Sequence AGATGGAACCTGGTGATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903537461_903537467 29 Left 903537461 1:24076464-24076486 CCACCAATCACCAGGTTCCATCT 0: 1
1: 0
2: 0
3: 15
4: 207
Right 903537467 1:24076516-24076538 TTTTTTTTTTTTTTTTGAGACGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903537461 Original CRISPR AGATGGAACCTGGTGATTGG TGG (reversed) Intronic
902541318 1:17157306-17157328 AGATGGGACCTGGTGGGAGGTGG - Intergenic
903537461 1:24076464-24076486 AGATGGAACCTGGTGATTGGTGG - Intronic
904002705 1:27347915-27347937 GGAGGGACCCTGGTGACTGGTGG - Intronic
904422551 1:30403500-30403522 AGATGGGAGCGGGTGAATGGAGG + Intergenic
905493715 1:38366100-38366122 AGACAGGGCCTGGTGATTGGAGG - Intergenic
906539211 1:46572159-46572181 AGATGGAACCTGGGGAGCAGAGG + Exonic
909052122 1:70778695-70778717 ACATGGAGCCTGGTCATTGGAGG - Intergenic
910483875 1:87688667-87688689 AGATTGAACCTGGTGAAATGCGG - Intergenic
911841480 1:102687489-102687511 AGATTGACAGTGGTGATTGGTGG - Intergenic
912769634 1:112451866-112451888 AGATGGAACCTGGAGGTGGCAGG - Intronic
914678059 1:149918747-149918769 AGAGGGAATATGGTGATTTGGGG + Intergenic
915082675 1:153362653-153362675 AGAAGCATCCTGGGGATTGGAGG + Intergenic
915532006 1:156508151-156508173 AGCCGGAACCAGGTGATAGGAGG - Intergenic
915550458 1:156630007-156630029 AGGAGGCACCTGGTGACTGGCGG + Intergenic
916995404 1:170292148-170292170 ACATGGCACCTGGTGCTTTGTGG - Intergenic
919198551 1:194320991-194321013 AGATGGAACCTGGTAAGAGGTGG - Intergenic
920499041 1:206474755-206474777 AGCTGGGACCTGGAGAATGGGGG + Intronic
921049449 1:211500765-211500787 AGGGGGAACCTGGTGATGGCTGG - Intergenic
921239804 1:213167151-213167173 AAATGGACCTTGGTGATTAGAGG + Intronic
921606546 1:217162423-217162445 AGCTGGTCCCAGGTGATTGGTGG + Intergenic
924279336 1:242420317-242420339 AGATGGAACATGTTGATTGAGGG - Intronic
924546012 1:245028784-245028806 AGAGGGAACTGGGTGACTGGTGG - Intronic
1062946711 10:1466941-1466963 GGAAGGAACGTGGTGAGTGGTGG + Intronic
1063223716 10:3994508-3994530 AGAAGGAAGGAGGTGATTGGCGG + Intergenic
1064067532 10:12195606-12195628 AGAGGGAAACTGGGGATTGGAGG - Intronic
1065174743 10:23065360-23065382 AGATGGCATCTGGTGACTAGGGG + Intergenic
1065395899 10:25237253-25237275 AGATAGAACCTGGTTATTCATGG + Intronic
1066326477 10:34364874-34364896 AGATTGAACCTTGTACTTGGAGG - Intronic
1067179194 10:43972185-43972207 AGATGGTACCTGCTGAGTGGAGG - Intergenic
1067363977 10:45608042-45608064 AGAGGGAACCTGAGGAGTGGAGG + Intergenic
1067509933 10:46886167-46886189 AGATGGGGCCTGGGAATTGGTGG + Intergenic
1067652320 10:48165691-48165713 AGATGGGGCCTGGGAATTGGTGG - Intronic
1069924520 10:71839058-71839080 AGAAGGAAGCTGGTATTTGGGGG - Intronic
1070891088 10:79942610-79942632 AGATGGGACCTGCTGTTGGGAGG - Intronic
1071983229 10:91024597-91024619 ATATGAAAACTGGTGATTGGAGG + Intergenic
1072481890 10:95817127-95817149 TGATGGATCCTGATGATTGTTGG + Intronic
1073095174 10:100975103-100975125 AGATGGAACCAGGTCATGGAAGG + Intronic
1075701768 10:124474597-124474619 AGATGGGACCTGTGGTTTGGAGG - Intronic
1076215880 10:128693098-128693120 AGATGGGACCTGATGTTTGTTGG + Intergenic
1078877636 11:15414077-15414099 AGATGGGACATGGGGATAGGAGG + Intergenic
1080077531 11:28168905-28168927 AGATGGAAGCAAGTGACTGGAGG + Intronic
1081625427 11:44652489-44652511 TGATGGAGCCTGGAGATTGTGGG + Intergenic
1083728770 11:64642372-64642394 TGATGGGAGCTGGAGATTGGAGG + Intronic
1085227736 11:74937507-74937529 AGATGGAACCTATTGAGTTGAGG - Intronic
1085654334 11:78298862-78298884 ATATGGAACCAGGTCTTTGGAGG - Intronic
1087891875 11:103544886-103544908 TGATGGAACTTGGTGGTTGATGG - Intergenic
1089111057 11:116056562-116056584 AGATGGAACCTGGAGAGCAGAGG + Intergenic
1089808035 11:121109064-121109086 CAATGGAACCCGGTGTTTGGGGG + Intronic
1095531311 12:43189982-43190004 AGCTTGAACCTGGGGGTTGGAGG - Intergenic
1096865250 12:54558726-54558748 AGATGGCACCTGGATATTGGTGG - Intronic
1100664450 12:96736198-96736220 AGATGGAACGAGGTGATTCCAGG - Intronic
1101738442 12:107481406-107481428 AGATGCAACCTGGTGCTCAGAGG - Intronic
1103120153 12:118373102-118373124 CGATGGAACCCGAGGATTGGCGG + Intergenic
1104692001 12:130833492-130833514 AGCTGGAACCTGGGAAGTGGAGG - Intronic
1105069637 12:133226816-133226838 ACCTGGAACCTACTGATTGGAGG + Intronic
1105833485 13:24187044-24187066 ACATGCAACCTGGTGTTTGCTGG - Intronic
1106310657 13:28550994-28551016 TGAAGGAACTCGGTGATTGGGGG - Intergenic
1107252029 13:38375405-38375427 AGATAGATGCTGCTGATTGGTGG - Intergenic
1109219871 13:59630293-59630315 GGATGGAAGCTGTTAATTGGTGG - Intergenic
1109696554 13:65967995-65968017 AGTTGGAACCTGATGTTAGGGGG - Intergenic
1110331836 13:74281996-74282018 AGATGATCCCTGGTGTTTGGGGG - Intergenic
1113826380 13:113257642-113257664 AGATGGGACCGGGTGGGTGGGGG - Intronic
1116430080 14:44836110-44836132 AGAGGGAAGCTAGTGATGGGTGG - Intergenic
1116958556 14:50947182-50947204 TGATGGAACCAGGTGATTTAGGG + Intergenic
1117224004 14:53636602-53636624 AGATAGACCCTTGTGATTGTTGG - Intergenic
1117910859 14:60637455-60637477 AGATGGAAGCTGCTGACTGATGG + Intergenic
1121097934 14:91230728-91230750 TGATGGACTCTGGTGATGGGAGG + Intergenic
1121575081 14:94978158-94978180 AGATGGGACCAGGTCATTGCAGG - Intergenic
1121854076 14:97250505-97250527 AGATAGAACCTGGGGAATGGGGG - Intergenic
1122915897 14:104858855-104858877 AGATGGAAGGTGGTGATGGAGGG - Intergenic
1122916041 14:104859439-104859461 AGATGGAAGGTGGTGATGGAGGG - Intergenic
1122916090 14:104859643-104859665 AGATGGAAGGTGGTGATGGAGGG - Intergenic
1122916108 14:104859721-104859743 AGATGGAAGGTGGTGATGGAGGG - Intergenic
1122916700 14:104862548-104862570 AGATGGATGGTGGTGATGGGTGG - Intergenic
1122983997 14:105203840-105203862 AGAAGGCACCTGGGGGTTGGGGG + Intergenic
1124375649 15:29127288-29127310 TGAGGGCACCTGGTGATGGGAGG - Intronic
1126234502 15:46367755-46367777 AGGTGGATCCTGGTAACTGGAGG + Intergenic
1127918299 15:63473350-63473372 AGATGGAGCCAGGTGATAAGTGG + Intergenic
1128438855 15:67683674-67683696 AGCTTGAACCTGGGCATTGGAGG + Intronic
1131027933 15:89160882-89160904 AGATGGAAAGTAGTTATTGGTGG + Intronic
1134176576 16:12011773-12011795 AGCTGGTAACTGGTGATTTGTGG - Intronic
1134649543 16:15897890-15897912 AGATGGAAACTGAGGTTTGGAGG + Intergenic
1135006973 16:18834350-18834372 GGATGGAGCCTGGTTCTTGGAGG - Exonic
1135492403 16:22920984-22921006 AGATGCCACCTGGGGGTTGGGGG - Intergenic
1138045851 16:53724036-53724058 AGATAGAACCAGGTGATGGTGGG + Intronic
1138057589 16:53851861-53851883 GGATGGAACTTGGGGATAGGTGG - Intronic
1138453678 16:57108487-57108509 AGTTGGAACCTGGCCATTGTTGG + Intronic
1139675083 16:68518018-68518040 AGATGTAATCTGGTCATTGCAGG + Intergenic
1143081479 17:4384684-4384706 AGAGGGAACCTAGTGATTAAAGG - Intergenic
1146429203 17:32774406-32774428 AGATGGAATTTGGTGGTTGGGGG + Intronic
1148957314 17:51364530-51364552 AGATGGAAAGTGGTGGTGGGTGG + Intergenic
1152095950 17:78271692-78271714 GAATGGAACCTGGTGACTTGTGG + Intergenic
1153033477 18:736461-736483 AGATGTCCCCTGGTGAGTGGCGG + Intronic
1155754131 18:29468738-29468760 AGATTGAACCAGGTGGTTGCTGG + Intergenic
1156856206 18:41784062-41784084 AGTTACAACCTGTTGATTGGTGG + Intergenic
1159785960 18:72714463-72714485 AGATGGGACCACGTGATTGAGGG + Intergenic
1160784307 19:892560-892582 GGATGGACCCTGGAGATTGGGGG - Intronic
1161777282 19:6270458-6270480 AGCTGGAACCTCATGGTTGGAGG + Intronic
1165802796 19:38563141-38563163 AGAAGGAAGCGGGTGTTTGGAGG - Intronic
1166145668 19:40833200-40833222 AGATGTAACATGGCTATTGGAGG + Intronic
1166149777 19:40864102-40864124 AGATGTAACATGGCTATTGGAGG + Intronic
1167984965 19:53306970-53306992 AGATAGCACCTGGTTATTGAGGG + Intergenic
926749763 2:16189386-16189408 AGGTGGCTCCTGGTGACTGGTGG + Intergenic
928170262 2:28998851-28998873 TGTTGGACCCTGGAGATTGGTGG + Intronic
928254503 2:29710465-29710487 AGGTTGAAGCTGGTGATTGGAGG - Intronic
928596573 2:32864577-32864599 AAATGGAACCTTCTGGTTGGAGG - Intergenic
930111529 2:47682859-47682881 AGATGTCACCTGGGGAGTGGTGG + Intergenic
933250404 2:80022979-80023001 AGATGGAATCTGATGGTTGCTGG - Intronic
933322345 2:80792675-80792697 AGATGTCACCTTTTGATTGGAGG - Intergenic
937070959 2:119062635-119062657 AGATGGAAGTGGGGGATTGGTGG + Intergenic
938741200 2:134234190-134234212 AGAAGGAAGCCGGGGATTGGGGG + Intronic
940140427 2:150486285-150486307 AGATCTAACCTGCTGGTTGGCGG - Intronic
940182608 2:150952687-150952709 AGATGTATCCTGCTGATGGGTGG - Intergenic
944321933 2:198356146-198356168 ACATGGAGCCTGGAGGTTGGAGG + Intronic
945190904 2:207186483-207186505 TGATAGAACTTGGTGATAGGAGG - Intergenic
945367407 2:208972652-208972674 AGGTGAAATCTGGCGATTGGTGG - Intergenic
946934314 2:224703960-224703982 AGGTAGTATCTGGTGATTGGGGG - Intergenic
947273860 2:228369795-228369817 AGATGGCACTTGGAGAATGGTGG + Intergenic
949008548 2:241665340-241665362 AGACGGACCCTGGTGAGTCGTGG - Intronic
1170385049 20:15807190-15807212 AGTTGGAGCTTGGTTATTGGTGG - Intronic
1170686224 20:18571875-18571897 TGATGGGACCTGGTGGCTGGAGG - Intronic
1170686966 20:18577978-18578000 TGATGGAATTTGGTCATTGGAGG + Intronic
1171161204 20:22925364-22925386 TGATGGAACGTGGTGATGGAAGG - Intergenic
1171195379 20:23193520-23193542 ACATGGAACTTGGGGTTTGGGGG + Intergenic
1171287907 20:23957286-23957308 AGGTGGAACCTGGTGCTTGAGGG - Intergenic
1173721306 20:45260436-45260458 AGATGGATTCTAGTGATTTGGGG - Intergenic
1175312819 20:58023805-58023827 ACTTGGGACCTGGTGAATGGTGG - Intergenic
1177786807 21:25680416-25680438 AGATGGAAGCTGATGAATGAAGG + Intronic
1179053634 21:37912169-37912191 AAATGGAACCAAGTGAATGGGGG + Intronic
1180655794 22:17419373-17419395 AGAAGCCACCTGGGGATTGGAGG + Intronic
1181236636 22:21451045-21451067 AGAGGGAAGCTAGTGATGGGTGG - Exonic
1181462137 22:23092149-23092171 GGATGGAACCTGATGATGGTTGG - Intronic
1182004093 22:26944683-26944705 AGAAGGACCCTTGTGATTGCAGG + Intergenic
1182262289 22:29082569-29082591 AGAGGGAAGCTGGTGAATGAGGG - Intronic
1182271455 22:29156508-29156530 TGCTAGAACTTGGTGATTGGTGG + Intronic
1184692956 22:46125628-46125650 AGATGGCACCTGTGGCTTGGTGG + Intergenic
953468263 3:43144193-43144215 ACAAGGATCCTGGAGATTGGTGG + Intergenic
953706607 3:45235919-45235941 AGGTGGGGCCTGGTGGTTGGAGG + Intergenic
954665239 3:52248054-52248076 AGCTGGATCCTGGTGGTTGGAGG + Intronic
955998293 3:64700753-64700775 ATATGGATACTGCTGATTGGGGG + Intergenic
957212011 3:77271699-77271721 AGATGTACCCTGGTGTTTGTTGG + Intronic
961848048 3:129785302-129785324 ACTTGGAACATGGTAATTGGGGG - Intronic
962050742 3:131812312-131812334 AGATTGAACTTGGAGAGTGGAGG + Intronic
969503968 4:7571963-7571985 GGATGGAGCCTGGTGCCTGGAGG - Intronic
972258317 4:37382772-37382794 TGCTTGAACCTGGTGAGTGGAGG - Intronic
972262762 4:37427140-37427162 AGATGGAGTTTGGTCATTGGTGG - Intronic
972679103 4:41288404-41288426 ACCTGGAACCTGCTGAATGGAGG - Intergenic
976826120 4:89262348-89262370 AGAAGGAAGATGGTGCTTGGGGG + Intronic
978371094 4:108030078-108030100 AGATGTCACATGGTGACTGGGGG - Intronic
980213913 4:129826556-129826578 AGATGGAAGGTCATGATTGGTGG + Intergenic
980521985 4:133947475-133947497 AGCTGGCACCTGCTTATTGGGGG - Intergenic
980880844 4:138708754-138708776 AGATGGAACGTGGTGAATAAAGG + Intergenic
981956547 4:150481154-150481176 ACATGGAATCTTGTCATTGGTGG - Intronic
986065936 5:4233856-4233878 AGGTGGAGCCTGCTGACTGGTGG - Intergenic
987768815 5:22272714-22272736 AGATAGAAACAGCTGATTGGTGG + Intronic
990922027 5:60978631-60978653 AGATGGGACCTGGTGGAAGGTGG - Intronic
991014759 5:61918900-61918922 AGCTGGAACTTGCTGATTGCTGG - Intergenic
991930488 5:71749013-71749035 AGATAGAATCTGATCATTGGGGG + Intergenic
992366858 5:76101089-76101111 AGAGGGAATCTTGTGAATGGGGG + Intronic
995749713 5:115441357-115441379 AGATGCAGCCTGGTGTTAGGGGG - Intergenic
997443818 5:133926996-133927018 AGATGCTTCCTGGTGTTTGGGGG + Intergenic
998006915 5:138663167-138663189 AGATGGCAGCTGGAGATAGGAGG - Intronic
998791356 5:145768879-145768901 AAATGGAACATGGAGAATGGCGG + Intronic
999564379 5:152841015-152841037 AGATGGAACATAGTAAGTGGGGG - Intergenic
1000430757 5:161149443-161149465 AGATTGGATATGGTGATTGGAGG - Intergenic
1001411736 5:171517153-171517175 AAATGGAACATGGTGGCTGGGGG - Intergenic
1004286963 6:14330103-14330125 AGATGGAGCCTGCTGGTTGATGG + Intergenic
1006308038 6:33236709-33236731 AGGTGGAGCCTGGTGAGAGGTGG + Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1009626360 6:66142588-66142610 AGAGGGGACCTGGAAATTGGAGG - Intergenic
1010403255 6:75472608-75472630 AGATGGAACCTGATAATTTAAGG + Intronic
1010629538 6:78181571-78181593 AGATAGAAGATGGTAATTGGAGG + Intergenic
1016164358 6:140922123-140922145 AGGTGGAACATTGTGCTTGGGGG - Intergenic
1018848358 6:167570763-167570785 TGATGGAGTCTGGTGGTTGGGGG - Intergenic
1019031951 6:169021152-169021174 AGAAGTAACCTGGGGAGTGGGGG - Intergenic
1020062908 7:5166088-5166110 AGCTTGAACCTGGGGGTTGGAGG - Intergenic
1022188720 7:27996372-27996394 AAAAAGAACCTGGTGTTTGGAGG - Intronic
1022516588 7:30978616-30978638 AGATGGAACGGTGGGATTGGGGG - Intronic
1022829831 7:34054835-34054857 AGAAGGAAACTGGTGGTTCGTGG + Intronic
1023380823 7:39606569-39606591 AGGTGGAACCGGGTGAATGGTGG + Intronic
1026431932 7:70356444-70356466 AGATGGAACCTAATCATTTGAGG + Intronic
1026480602 7:70775914-70775936 AAATGAATCCTGGTGGTTGGGGG + Intronic
1026898242 7:74022817-74022839 AGATGGAGCCTGGAGATAGTAGG - Intergenic
1028962443 7:96764234-96764256 GGATGGAAACTGGTTCTTGGAGG - Intergenic
1029125009 7:98289568-98289590 TGATGGGACCTGGTGCTTAGGGG - Intronic
1036928363 8:12929400-12929422 AAATGGAAGCTGTTTATTGGAGG - Intergenic
1036968521 8:13328043-13328065 AGCTGGAATCTGGTGAGTGATGG + Intronic
1040399131 8:47030488-47030510 AGATGGTAGCTGGGGGTTGGGGG + Intergenic
1040933783 8:52762949-52762971 AGGTGGCACCTGGTGAATGACGG + Intergenic
1041971015 8:63742717-63742739 AGGTGGAACCTGAGGGTTGGAGG + Intergenic
1046705816 8:117450401-117450423 AGAAGTAACCTGGTAATTGATGG + Intergenic
1048706317 8:137157009-137157031 AGAAAGAACATGGTGATGGGTGG - Intergenic
1048842331 8:138576930-138576952 AGAAGGAACCTGGTGGTTTTTGG + Intergenic
1051617801 9:19023120-19023142 GGATGTAATCTGGTGTTTGGGGG - Intronic
1052454519 9:28678244-28678266 AGATGGAGCCTGGTGAGAGTGGG - Intergenic
1052835252 9:33245546-33245568 AGATGGAATGTGGTGGTGGGAGG - Intronic
1053661991 9:40290727-40290749 AGTTGGGACCTGGTTAGTGGTGG + Intronic
1053912441 9:42920891-42920913 AGTTGGGACCTGGTTAGTGGTGG + Intergenic
1054374117 9:64436963-64436985 AGTTGGGACCTGGTTAGTGGTGG + Intergenic
1054522618 9:66085557-66085579 AGTTGGGACCTGGTTAGTGGTGG - Intergenic
1055583371 9:77731462-77731484 ACATGGCACCTGGTGAATGGAGG - Intronic
1055832898 9:80403709-80403731 ACAGGAAACCTGATGATTGGAGG + Intergenic
1057497725 9:95574160-95574182 AGATGGAACCTGAGGGTAGGAGG - Intergenic
1059789549 9:117625517-117625539 AGATGGAAAATGCTGATTTGTGG + Intergenic
1061873449 9:133532636-133532658 AGAGGGATCCTGGAGAGTGGGGG + Intronic
1062274315 9:135723610-135723632 AGAGGGACCCTGGGGCTTGGGGG + Intronic
1185866716 X:3630812-3630834 AGGTGGGACCTGGTGAGAGGTGG - Intronic
1186385888 X:9109953-9109975 AGATGGGACCTGGCATTTGGAGG + Intronic
1186858818 X:13651592-13651614 AGATGTCACCTGGAGGTTGGTGG - Intergenic
1186955064 X:14672774-14672796 ACATGGAACCTGGAGCGTGGTGG + Intronic
1193004943 X:76606013-76606035 AGAGAGAACTTGGTGATGGGGGG + Intergenic
1193261356 X:79410323-79410345 ATAGGGAAGCTGGTGGTTGGGGG - Intergenic
1194575579 X:95610496-95610518 AGGTGGAACATGGAAATTGGTGG - Intergenic
1195043308 X:101033509-101033531 TGCTGGAACCTGGTGGGTGGAGG + Intronic
1195168621 X:102244957-102244979 AGATGGAATCAGGTGGTGGGAGG + Intergenic
1195190236 X:102442130-102442152 AGATGGAATCAGGTGGTGGGAGG - Intronic
1195433103 X:104811567-104811589 AGGAGGAACCAGGTGATTGAGGG + Intronic
1195433209 X:104812621-104812643 AGATGAAAGCTGGTAATAGGTGG + Intronic
1195632608 X:107074365-107074387 AGCTGCTACCTGGTGAATGGTGG + Intronic
1195694000 X:107653361-107653383 AAAGGGAATCTGGTTATTGGAGG - Intergenic
1199851929 X:151729992-151730014 AGCTGGAATCTGGTGATTCAGGG - Intergenic
1200924956 Y:8646069-8646091 GGAAACAACCTGGTGATTGGTGG + Intergenic
1200936555 Y:8743427-8743449 AGATGCAATCTGGTGAGGGGTGG - Intergenic