ID: 903538589

View in Genome Browser
Species Human (GRCh38)
Location 1:24083625-24083647
Sequence GTGGTATGGAGCCTGAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903538577_903538589 29 Left 903538577 1:24083573-24083595 CCTATTAGTCTGTCCCTCTAGAG 0: 3
1: 10
2: 6
3: 55
4: 361
Right 903538589 1:24083625-24083647 GTGGTATGGAGCCTGAACTCAGG 0: 1
1: 0
2: 1
3: 10
4: 167
903538578_903538589 16 Left 903538578 1:24083586-24083608 CCCTCTAGAGAACCCTGACTGAT 0: 21
1: 830
2: 1159
3: 794
4: 715
Right 903538589 1:24083625-24083647 GTGGTATGGAGCCTGAACTCAGG 0: 1
1: 0
2: 1
3: 10
4: 167
903538582_903538589 4 Left 903538582 1:24083598-24083620 CCCTGACTGATACAGAAAGGGTG 0: 1
1: 0
2: 3
3: 28
4: 240
Right 903538589 1:24083625-24083647 GTGGTATGGAGCCTGAACTCAGG 0: 1
1: 0
2: 1
3: 10
4: 167
903538583_903538589 3 Left 903538583 1:24083599-24083621 CCTGACTGATACAGAAAGGGTGA 0: 1
1: 0
2: 4
3: 18
4: 171
Right 903538589 1:24083625-24083647 GTGGTATGGAGCCTGAACTCAGG 0: 1
1: 0
2: 1
3: 10
4: 167
903538579_903538589 15 Left 903538579 1:24083587-24083609 CCTCTAGAGAACCCTGACTGATA 0: 21
1: 843
2: 1212
3: 852
4: 668
Right 903538589 1:24083625-24083647 GTGGTATGGAGCCTGAACTCAGG 0: 1
1: 0
2: 1
3: 10
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903538589 Original CRISPR GTGGTATGGAGCCTGAACTC AGG Intronic