ID: 903540038

View in Genome Browser
Species Human (GRCh38)
Location 1:24091709-24091731
Sequence TAGCTAATGCTGCCACGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 63}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903540038_903540049 28 Left 903540038 1:24091709-24091731 CCTGTCCGTGGCAGCATTAGCTA 0: 1
1: 0
2: 1
3: 3
4: 63
Right 903540049 1:24091760-24091782 CCACACTGGAAAAAGGCCGGAGG 0: 1
1: 0
2: 0
3: 11
4: 144
903540038_903540041 -8 Left 903540038 1:24091709-24091731 CCTGTCCGTGGCAGCATTAGCTA 0: 1
1: 0
2: 1
3: 3
4: 63
Right 903540041 1:24091724-24091746 ATTAGCTATTTTCTCAAGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 211
903540038_903540042 5 Left 903540038 1:24091709-24091731 CCTGTCCGTGGCAGCATTAGCTA 0: 1
1: 0
2: 1
3: 3
4: 63
Right 903540042 1:24091737-24091759 TCAAGCTGGGCCTTCAGAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 181
903540038_903540040 -9 Left 903540038 1:24091709-24091731 CCTGTCCGTGGCAGCATTAGCTA 0: 1
1: 0
2: 1
3: 3
4: 63
Right 903540040 1:24091723-24091745 CATTAGCTATTTTCTCAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 164
903540038_903540047 25 Left 903540038 1:24091709-24091731 CCTGTCCGTGGCAGCATTAGCTA 0: 1
1: 0
2: 1
3: 3
4: 63
Right 903540047 1:24091757-24091779 CGGCCACACTGGAAAAAGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 121
903540038_903540043 14 Left 903540038 1:24091709-24091731 CCTGTCCGTGGCAGCATTAGCTA 0: 1
1: 0
2: 1
3: 3
4: 63
Right 903540043 1:24091746-24091768 GCCTTCAGAGCCGGCCACACTGG 0: 1
1: 0
2: 2
3: 16
4: 164
903540038_903540045 21 Left 903540038 1:24091709-24091731 CCTGTCCGTGGCAGCATTAGCTA 0: 1
1: 0
2: 1
3: 3
4: 63
Right 903540045 1:24091753-24091775 GAGCCGGCCACACTGGAAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903540038 Original CRISPR TAGCTAATGCTGCCACGGAC AGG (reversed) Intronic
900090149 1:916684-916706 TCGCTCATGCTGCCAGGGCCTGG - Intergenic
903540038 1:24091709-24091731 TAGCTAATGCTGCCACGGACAGG - Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
916500643 1:165384054-165384076 CAGCTAATGCTGCCAGTGTCAGG - Intergenic
921483188 1:215687190-215687212 TAGCTAATGCTGTCACCTAATGG + Intronic
1066077065 10:31889271-31889293 TAGCTAATACTGCCAGGTTCTGG - Intronic
1066645191 10:37599956-37599978 TAGTAAATGCTGGCAAGGACAGG - Intergenic
1067789957 10:49280286-49280308 TACCTAATGCTGCCAAAGATGGG + Intergenic
1072461879 10:95626412-95626434 TACCTAATTCTGCCACATACTGG - Intronic
1075807789 10:125202502-125202524 TAGCTAATGGGACCAAGGACCGG - Intergenic
1083086789 11:60156399-60156421 TGGCTCATGCTTCCAAGGACTGG - Intergenic
1086010751 11:82100248-82100270 TAGCTAATGTTGCAATGAACAGG - Intergenic
1089168111 11:116493329-116493351 TGGACAATGCTGCCATGGACAGG + Intergenic
1098046784 12:66408815-66408837 TGGCGAATGCTGCCAGGGCCGGG - Intronic
1101741370 12:107502706-107502728 AATCTAATGCTGCCACTGATCGG - Intronic
1106231863 13:27826775-27826797 TAGCTATGGCGGCCACGCACAGG - Intergenic
1113718753 13:112534959-112534981 TAGTTAATGTTGTCAGGGACTGG - Intronic
1128235577 15:66065105-66065127 AAGCAAATGCTGCCACGGGTGGG + Intronic
1133449226 16:5889694-5889716 TAGCATGGGCTGCCACGGACAGG - Intergenic
1144587565 17:16496883-16496905 TAGTTAATGATGCCAAGGATGGG + Intergenic
1145883770 17:28369218-28369240 GAGCTATTGCTCCCAGGGACAGG - Intronic
1158769389 18:60496181-60496203 TAGCTAATGCTACCACACTCAGG - Intergenic
1160142194 18:76335630-76335652 CAGCTATTGGTGCCACTGACAGG + Intergenic
1164710787 19:30355744-30355766 AATCTAATGCAGCCACTGACAGG - Intronic
930092838 2:47543891-47543913 TAGCTACTTCTGCCACTGATGGG + Intronic
935168544 2:100591128-100591150 AAGCTGATGCTGCCAAGGAGGGG - Intergenic
939418135 2:141927856-141927878 TGGCTAATGCTGCTAAGGACAGG - Intronic
942427869 2:175878374-175878396 TAGCTGATTCTGCCAGGAACTGG + Intergenic
946541081 2:220685237-220685259 TCACAAAAGCTGCCACGGACTGG - Intergenic
1170881815 20:20303696-20303718 TTGCTGATGCTGCCAAGGTCAGG - Intronic
1172920217 20:38474595-38474617 AAGCTAATGCAGCCAGAGACAGG - Intronic
1177416441 21:20799284-20799306 AATCTAATGCTGCCACTGATCGG - Intergenic
1181171687 22:21013622-21013644 TAGCTAATCCTGCCAGAGTCAGG + Intronic
1181177605 22:21046507-21046529 TAGCTAATCCTGCCAGAGTCAGG - Intronic
1185327464 22:50234063-50234085 TGGATGATGCTGCCATGGACAGG - Intronic
1185327507 22:50234272-50234294 TGGGTGATGCTGCCATGGACAGG - Intronic
1185327635 22:50234847-50234869 TGGGTGATGCTGCCAGGGACAGG - Intronic
1185327677 22:50235024-50235046 TGGCTGATGCTGCCGTGGACAGG - Intronic
962377490 3:134870602-134870624 TATCTAATGCTGCCCCAGATTGG + Intronic
969409507 4:7018859-7018881 TAGATAATTCTGCCACTGGCCGG - Intronic
973214602 4:47655103-47655125 TAACTAATGCTGCCAGGGCTGGG - Intronic
978684861 4:111428282-111428304 TAGCAAATGCTGGCAAGGACTGG + Intergenic
982349316 4:154397676-154397698 TAGTTAATTCTCCCAAGGACAGG + Intronic
998824030 5:146083153-146083175 TAGCTTATTCTGTCACGGTCTGG + Intergenic
999779367 5:154836582-154836604 TAGCTAATGGGGCCATGTACAGG + Intronic
1003023242 6:2530256-2530278 TAGCTACTGCTGCCCCTGGCTGG + Intergenic
1009318998 6:62261580-62261602 TGGCTAATGCTGCCACTAATGGG - Intronic
1013019444 6:106197940-106197962 AAGCCAGTGCTGCCACGGACAGG + Intronic
1019628393 7:2033047-2033069 CAGCTGACGCTGCCACTGACTGG + Intronic
1020857404 7:13447601-13447623 TAGAGAATGCTGCCACGTAGAGG + Intergenic
1024301445 7:47890297-47890319 TAGCTAAAGCTGGCACAGCCGGG - Intronic
1042009098 8:64219601-64219623 TGAATAATGCTGCCATGGACAGG - Intergenic
1045981904 8:108199604-108199626 AATCGAATGCTGCCACAGACTGG + Intergenic
1049256362 8:141616010-141616032 TCTCCAATGCTGCCATGGACGGG - Intergenic
1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG + Intronic
1053449339 9:38180095-38180117 TAGCTAATGGTTCCACTGATTGG - Intergenic
1054857129 9:69913138-69913160 TCTCTAATGCTGCCAAGGAAAGG + Intergenic
1058287171 9:103192560-103192582 AAGAAAATGCTGCCACGGATTGG - Intergenic
1059885817 9:118743655-118743677 AAGCCAATGTTTCCACGGACAGG + Intergenic
1186922035 X:14292856-14292878 TAGCTAATGATGCCTCTGAGGGG - Intergenic
1187166371 X:16807747-16807769 TAGCTCTTGCTGGCAAGGACTGG + Intronic
1188065920 X:25659162-25659184 AATCTAATGCTGCCACTGATCGG + Intergenic
1190124024 X:47687496-47687518 TGGCTGATGCTGCCACGTCCAGG + Intergenic
1190152031 X:47957022-47957044 GTGCTATTGCTGCCACTGACAGG - Intronic
1190160629 X:48029127-48029149 GTGCTATTGCTGCCACTGACAGG + Intronic
1190395298 X:49976143-49976165 CAGGTAATGCTGCCACGGCTGGG - Intronic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1198640992 X:138756450-138756472 TAGCTAATGCTGCCATCTCCAGG - Intronic