ID: 903543486

View in Genome Browser
Species Human (GRCh38)
Location 1:24109777-24109799
Sequence CTAGGGGTTGGGCTAGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 444}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903543486_903543496 12 Left 903543486 1:24109777-24109799 CCAATCCCTAGCCCAACCCCTAG 0: 1
1: 0
2: 2
3: 45
4: 444
Right 903543496 1:24109812-24109834 CTATGTCATATGTCCATTCAAGG 0: 1
1: 0
2: 0
3: 13
4: 138
903543486_903543498 23 Left 903543486 1:24109777-24109799 CCAATCCCTAGCCCAACCCCTAG 0: 1
1: 0
2: 2
3: 45
4: 444
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543486_903543500 29 Left 903543486 1:24109777-24109799 CCAATCCCTAGCCCAACCCCTAG 0: 1
1: 0
2: 2
3: 45
4: 444
Right 903543500 1:24109829-24109851 TCAAGGCCAGGCCGTGGCAGAGG 0: 1
1: 0
2: 1
3: 16
4: 247
903543486_903543497 17 Left 903543486 1:24109777-24109799 CCAATCCCTAGCCCAACCCCTAG 0: 1
1: 0
2: 2
3: 45
4: 444
Right 903543497 1:24109817-24109839 TCATATGTCCATTCAAGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903543486 Original CRISPR CTAGGGGTTGGGCTAGGGAT TGG (reversed) Intronic
900018088 1:168576-168598 GTGGGGGTGGGGCTAGGGAGGGG - Intergenic
900048346 1:527172-527194 GTGGGGGTGGGGCTAGGGAGGGG - Intergenic
900125998 1:1069171-1069193 CTTGGGGAGGGGCTACGGATGGG - Intergenic
900158828 1:1213917-1213939 CTGGGGGCTGGGGCAGGGATGGG - Intronic
900338208 1:2175342-2175364 TTTGGGGTTGGGATGGGGATGGG - Intronic
900338222 1:2175376-2175398 ATTGGGGTTGGGGTTGGGATGGG - Intronic
900585656 1:3431198-3431220 GTAGGGGCTGAGCCAGGGATGGG - Intronic
901075820 1:6554228-6554250 GCCGGGGTCGGGCTAGGGATCGG + Exonic
902175352 1:14646082-14646104 GTAGGGGTTGGGGTGGGGAGTGG + Intronic
902393710 1:16120701-16120723 CCAGAGGTTGGGGCAGGGATGGG - Intergenic
902627235 1:17683620-17683642 CTGGGGCTGGGGCTAGGGCTGGG + Intronic
902808458 1:18875120-18875142 CTAGGGGCAGGGCTAGGAATTGG - Intronic
903543486 1:24109777-24109799 CTAGGGGTTGGGCTAGGGATTGG - Intronic
903865220 1:26392877-26392899 CTGGGGGAGGGGCCAGGGATGGG - Intergenic
903994387 1:27296751-27296773 CTAGGGCTGGGGCTGGGGGTGGG - Intronic
903994397 1:27296769-27296791 CTAGGGTTGGGGCTGGGGCTAGG - Intronic
903994402 1:27296781-27296803 CTGGGGCTGGGGCTAGGGTTGGG - Intronic
903994405 1:27296787-27296809 CTAGGGCTGGGGCTGGGGCTAGG - Intronic
903994410 1:27296799-27296821 CTGGGGCTGGGGCTAGGGCTGGG - Intronic
905024101 1:34838075-34838097 CTAGGAGCTGGGCCAGGGAAGGG - Intronic
905580939 1:39082127-39082149 CTAGGGGGTGGGCTGGGGCTTGG + Intronic
906370178 1:45247402-45247424 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
906370181 1:45247408-45247430 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
906370184 1:45247414-45247436 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
908436186 1:64109014-64109036 CTAGAGCTTGGGCCAGGAATCGG + Intronic
908997518 1:70174760-70174782 CCAGGGGTTGGGGTATGGAAAGG + Intronic
909042273 1:70668899-70668921 CTAGGGCTTGGGATGGAGATTGG - Intergenic
910864721 1:91777588-91777610 CTAGGGCTGGGGCTAGAGCTGGG - Intronic
912365665 1:109131785-109131807 CCAGGGGTTGGGCTAAGATTTGG - Intronic
915738202 1:158097975-158097997 ATAGGGTTGGGGGTAGGGATGGG + Intronic
916142824 1:161713924-161713946 CTAGGTGTTGGGCTCTGGAATGG + Exonic
916269573 1:162926255-162926277 ATATGGGTTGGGGTGGGGATGGG - Intergenic
917135475 1:171784550-171784572 CTGGGGCTTGGGCTGGGGCTGGG + Intronic
918051344 1:180975603-180975625 CTGGGGGTTGGGGTTGGGAGTGG - Exonic
920328683 1:205188005-205188027 CTAGGGGGTGAGCTAGGGAAAGG - Intronic
920726376 1:208439092-208439114 GTAGGGGTTGGGGGAGGGACGGG + Intergenic
921406921 1:214790452-214790474 GTAGGGGGTGGGGTAGGGAGAGG - Intergenic
921880320 1:220248493-220248515 CTAGGGGTAGGGGTAGGGGTTGG + Intronic
921980151 1:221248129-221248151 GTAGTGGTTGGTTTAGGGATGGG + Intergenic
922105931 1:222514440-222514462 GTGGGGGTGGGGCTAGGGAGGGG - Intergenic
922266270 1:223987051-223987073 GTGGGGGTGGGGCTAGGGAGGGG - Intergenic
922364182 1:224848675-224848697 CTAGGGGATGAGGCAGGGATTGG + Intergenic
923941064 1:238827749-238827771 CCAGAGTTTGGGCTAGGGAATGG + Intergenic
924009696 1:239651560-239651582 CTAGGGGCTGGCCTGGGGAAGGG - Intronic
924348116 1:243092007-243092029 GTGGGGGTGGGGCTAGGGAGGGG - Intergenic
924957822 1:248945691-248945713 TTAGGGGTAGGGGTAGGGTTAGG + Intergenic
924957824 1:248945697-248945719 GTAGGGGTAGGGTTAGGGTTAGG + Intergenic
1062765815 10:64274-64296 TTAGGGTTAGGGCTAGGGCTAGG - Intergenic
1063231422 10:4069199-4069221 CTAGGGTTAGGGTTAGGGTTAGG - Intergenic
1063280012 10:4617928-4617950 CTAGGGGAGGGGCTAGGAATAGG + Intergenic
1063710036 10:8468512-8468534 CTAGGGTTAGGGTTAGGGTTAGG - Intergenic
1063792417 10:9467802-9467824 CCAGGGGTTGGGGTGGGGGTGGG + Intergenic
1065136858 10:22679858-22679880 CTAGGGCTGGGGGTAGGGGTTGG + Intronic
1066728243 10:38412894-38412916 GTGGGGGTGGGGCTAGGGAGGGG + Intergenic
1069076276 10:64041642-64041664 CCTGGGGTTGGGGGAGGGATGGG + Intergenic
1069101676 10:64330121-64330143 GGAAGGGTTGGGCTAGGGAGGGG + Intergenic
1070769711 10:79075097-79075119 CTAGGGGTGGAGCTGGGGCTGGG - Intronic
1070956795 10:80469147-80469169 ATGGGGGTGGGGGTAGGGATGGG + Intronic
1070975555 10:80603343-80603365 CTAGGGGTGCTGCTAGGGCTGGG + Intronic
1072220483 10:93323645-93323667 GTTGGGGTTGGGTTAGTGATGGG - Intronic
1073047410 10:100647947-100647969 CTAGGGGTTTGGCTGGTGTTGGG + Intergenic
1073098977 10:100997319-100997341 CTAGGGGTTGGGGTGAGGAGGGG + Intronic
1073141994 10:101254226-101254248 CTAGGGGATGGGGGAGGGGTGGG + Intergenic
1073476062 10:103754662-103754684 CTCCTGGTTGGGCTAGTGATGGG + Intronic
1074683777 10:115938842-115938864 CTAGGGGAAGGGGGAGGGATGGG + Intronic
1076974690 11:163772-163794 GTGGGGGTGGGGCTAGGGAGGGG - Intergenic
1076976285 11:175579-175601 CTAGGGTTAGGGTTAGGGTTAGG - Intronic
1076976553 11:176454-176476 CTAGGGCTAGGGCTAGAGTTAGG - Intronic
1077080526 11:722824-722846 GTTGGGGCTGGGGTAGGGATGGG - Intronic
1077251895 11:1564458-1564480 CTGGGGGTTGGGGAGGGGATAGG - Intronic
1077301796 11:1850801-1850823 TGAGGGGTTAGGCTAGGGGTAGG + Intergenic
1077659663 11:4056299-4056321 CTAGGGCTTGGGCTGGGAGTGGG + Intronic
1079300987 11:19278690-19278712 CTGGGGCTGGGGCTAGGGCTGGG + Intergenic
1080649313 11:34209777-34209799 GTAGGGGTGGGGGTAGGGGTGGG + Intronic
1080752977 11:35167805-35167827 CTTGGGGTTGGCCCAGGGTTGGG - Intronic
1081162357 11:39764874-39764896 CTAGGGACTTGGCTAGGGAATGG + Intergenic
1082875066 11:57979736-57979758 CTAGGGCTAGGGCTAGAGTTAGG - Intergenic
1083179178 11:60973193-60973215 CCAGGGGCTGAGCTAGGCATTGG + Intronic
1083235012 11:61345635-61345657 CTGAGGGTTGGGCTAGGGCCTGG - Intronic
1083451695 11:62750550-62750572 CTTGGGGTAGGGGTAGGGGTAGG - Intronic
1083658094 11:64239825-64239847 GTAGGGGCTGGGCTTGGGCTAGG - Intergenic
1084208207 11:67608283-67608305 GGAGGGGCTGGGCTAGGGCTAGG - Intronic
1084870858 11:72097761-72097783 CAAGGGGGTGGGGTAGAGATGGG + Exonic
1085636852 11:78165608-78165630 CTGGGGGGAGGGCTAGGGAGAGG + Intergenic
1086245151 11:84742808-84742830 CTAGGGGTTGGAGTAGGTAAAGG - Intronic
1086306062 11:85482563-85482585 CTAGGACCTGGCCTAGGGATTGG - Intronic
1086334861 11:85790357-85790379 TCAGGGGTTGTGCTTGGGATAGG - Intronic
1087651661 11:100875366-100875388 CTAGGGCTGGGGCTAGGGGTGGG + Intronic
1087651666 11:100875378-100875400 CTAGGGGTGGGGATGGGGAAAGG + Intronic
1089459322 11:118643570-118643592 CCCAGGGTTGGGCTAGGGATTGG + Intronic
1089528562 11:119112471-119112493 CTAGGAGTTCGGCTGGGGAAAGG - Exonic
1090202180 11:124864971-124864993 CTAGGGGTTTGGCGACGGAAGGG - Intergenic
1090745747 11:129703546-129703568 CTAGGGTTAGGGTTAGGGTTAGG + Intergenic
1091081880 11:132678715-132678737 TTAGGGGTTGGGCGAGGGAGAGG + Intronic
1091373130 12:10264-10286 TTAGGGGTAGGGTTAGGGTTAGG - Intergenic
1091388137 12:108105-108127 CTAGGGTTAGGGTTAGGGTTAGG - Intronic
1091578283 12:1760480-1760502 CTAGGGTTGGGGGTAGAGATGGG - Intronic
1091656768 12:2351799-2351821 TTAGGGGTAGGGGTAGGGAAAGG - Intronic
1092404098 12:8204676-8204698 CCCGTGGTTGGGCAAGGGATGGG + Intergenic
1092418819 12:8313227-8313249 CTTGGGGTTGGGGTTGGGGTTGG - Intergenic
1093098097 12:14995057-14995079 CTGGGGGTGGGGCTTGAGATGGG - Intergenic
1094279471 12:28719733-28719755 CTAAGGGCTGCGTTAGGGATAGG + Intergenic
1094667685 12:32537578-32537600 TAAGGGGTAGGGATAGGGATAGG - Intronic
1095405815 12:41866086-41866108 CTTGGGGATGGGGTGGGGATGGG - Intergenic
1095497561 12:42801293-42801315 GTAGGGGTGGGGATGGGGATGGG + Intergenic
1097263074 12:57730575-57730597 CTGGGGCTGGGGCTAGGGCTTGG + Exonic
1098311786 12:69156080-69156102 CTTGGGCTTGGGCTTGGGCTTGG + Intergenic
1099971177 12:89503084-89503106 ATAGGGATAGGGATAGGGATAGG - Intronic
1100013081 12:89976951-89976973 CTGGAGCTTGGGCTAGAGATGGG + Intergenic
1102136974 12:110583347-110583369 CTAGGGGCAGGGCCAGGGAGGGG - Intergenic
1103033129 12:117634066-117634088 CTAGGGGCTGGGCTAGGCTCTGG - Intronic
1103577413 12:121888709-121888731 CAAGGGGCGGGGCTTGGGATGGG - Exonic
1104178513 12:126355713-126355735 CCAAGGCTTGGGCTAGGGATGGG + Intergenic
1104198548 12:126565413-126565435 CTGGGGTTAGGGCTAGGGTTAGG - Intergenic
1104309353 12:127640351-127640373 CCAGTGATTGGGCTAAGGATAGG + Intergenic
1106646671 13:31641901-31641923 CCAGGGGTTGGGATTGGGAGTGG + Intergenic
1106660195 13:31791424-31791446 CAGGGGCTTGGGCTTGGGATGGG - Intronic
1106772595 13:32976248-32976270 CTAGGGGCTGTGCAAGGGGTTGG - Intergenic
1110427541 13:75385292-75385314 CTAGGCCTTGTGCTTGGGATAGG - Intronic
1112172195 13:96985213-96985235 CCAGGGGCTGGGCTAGGCATCGG + Intergenic
1113597226 13:111541833-111541855 CTAGGGGTTGGGGTGGGGCCTGG + Intergenic
1114030295 14:18572883-18572905 TTAGGGGTTGGGCTTGGGTTAGG + Intergenic
1114617047 14:24073923-24073945 CTTTGAGTTGGGCTAGGGTTGGG - Intronic
1114678151 14:24459438-24459460 TTAGGGGTCAGACTAGGGATGGG - Intergenic
1115528143 14:34301888-34301910 CTAGGGGTGGGGCTGGGGCTGGG - Intronic
1115542970 14:34439983-34440005 CAAGGGGTTGGGGTAAGAATGGG - Intronic
1117449704 14:55838968-55838990 CTATGGGTTGGGGGCGGGATGGG + Intergenic
1117547582 14:56805721-56805743 CTGGGGGTGGGGGTGGGGATGGG - Intronic
1119527488 14:75333923-75333945 CCCGGGGTAGGGGTAGGGATGGG + Intergenic
1121450404 14:94003374-94003396 CTGGGGGTGGGGTTAGGGGTGGG + Intergenic
1121635514 14:95451503-95451525 GTAGGGGTCGGGCTGGGGTTGGG - Intronic
1122363215 14:101179698-101179720 CTGGGGCTGGGGCTGGGGATGGG + Intergenic
1122387167 14:101357024-101357046 CCAGGGGCTGGGATGGGGATGGG + Intergenic
1123509734 15:20985032-20985054 CTAGGTGTTGGGCCAAGGCTTGG - Intergenic
1123566954 15:21558771-21558793 CTAGGTGTTGGGCCAAGGCTTGG - Intergenic
1123603218 15:21996064-21996086 CTAGGTGTTGGGCCAAGGCTTGG - Intergenic
1125932773 15:43612106-43612128 CCAGGGCCTGGGCTAGGGTTTGG + Intronic
1125945872 15:43711568-43711590 CCAGGGCCTGGGCTAGGGTTTGG + Intergenic
1126452801 15:48827723-48827745 CTAGGGGCTAGGATAGGGAGGGG + Intronic
1126527983 15:49678977-49678999 CTAGGGGATGGGACAGGGAAAGG - Intergenic
1126972365 15:54130961-54130983 CTAGGCATTGTGCTAGGGACAGG - Intronic
1127453487 15:59138298-59138320 CTTGGGCTTGGGCTGGGGCTTGG + Exonic
1128362365 15:66971410-66971432 CTAGGGCTTGGGTTAGGGCCTGG + Intergenic
1129244494 15:74271329-74271351 GGAGGGGTTGGGCTAGGGGTAGG - Intronic
1129356867 15:74997201-74997223 CAAGGGGTGGGGATAGGGACAGG - Intronic
1129899295 15:79133737-79133759 CTGGGGATTGGGCTAGGGCTGGG - Intergenic
1130537558 15:84798105-84798127 GTAGGGGGTGGCATAGGGATGGG + Intronic
1131526961 15:93160183-93160205 CTAGGGGTTGGGATATGGAGAGG - Intergenic
1202975315 15_KI270727v1_random:285865-285887 CTAGGTGTTGGGCCAAGGCTTGG - Intergenic
1132594132 16:740559-740581 CCAGGGGTCGGGTTAGGGTTAGG + Intronic
1133621594 16:7531890-7531912 GAAGGGGATGGGTTAGGGATGGG - Intronic
1135352302 16:21739337-21739359 CTAGAGGGTGGGCTGGGGGTTGG + Intronic
1135450791 16:22555459-22555481 CTAGAGGGTGGGCTGGGGGTTGG + Intergenic
1135763101 16:25153476-25153498 CTTGGGATTGGGATTGGGATTGG - Intronic
1136601221 16:31290242-31290264 CTGGGGGTTGGACTGGGGATTGG + Intronic
1137437794 16:48471676-48471698 CCAGGGTTTGGGCTGGGGATGGG - Intergenic
1138030272 16:53554252-53554274 CTGGGGGTTGTGGTAGGGACAGG + Intergenic
1138533243 16:57646336-57646358 CTGGGGGTGGGGCGGGGGATGGG + Intronic
1139290008 16:65849465-65849487 CAAGGGGTTGGGCTGGGCAGAGG + Intergenic
1139952918 16:70680706-70680728 GTAGGGGATGGGCCAGGGAAAGG - Intronic
1141184428 16:81776958-81776980 GGTGGGGTTGGGCTAGGGGTTGG + Intronic
1141277518 16:82602072-82602094 ATCAGGGATGGGCTAGGGATAGG - Intergenic
1141585941 16:85033659-85033681 CTGGGGGTGGGGGCAGGGATGGG + Intronic
1142368436 16:89663664-89663686 TTTGGGGTTGGGGTAGGGAGTGG + Intronic
1142443861 16:90121714-90121736 TTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1142443863 16:90121726-90121748 CTAGGGCTAGGGCTAGAGTTAGG + Intergenic
1142461938 17:101585-101607 GTGGGGGTGGGGCTAGGGAGGGG - Intergenic
1142463562 17:113489-113511 CTAGGGCTAGGGCTAGAGTTAGG - Intergenic
1142463564 17:113501-113523 TTAGGGCTAGGGCTAGGGCTAGG - Intergenic
1143141448 17:4743873-4743895 CTAGGGGTAGGGCCAGGGACTGG + Intronic
1143727639 17:8860432-8860454 CTGGGGCTGGGGCTGGGGATGGG - Intronic
1144596280 17:16572791-16572813 CTAGTGGATGGGGTAGGGAGAGG - Intergenic
1144783252 17:17818169-17818191 GGTGGGGTGGGGCTAGGGATGGG + Intronic
1145789684 17:27618446-27618468 CTAGGGGTTGGGCCAGGTCTAGG + Intronic
1145866941 17:28247707-28247729 ATGGGGCTTGGGCTGGGGATAGG - Intergenic
1146047757 17:29524381-29524403 CTAGGGCTTGGGTGATGGATAGG + Intronic
1146705395 17:34997364-34997386 CCCGGGGTTGGCCTTGGGATCGG + Intronic
1146977168 17:37123517-37123539 CTTGGGGTTGGGGCTGGGATGGG + Intronic
1147306935 17:39570489-39570511 GTAGGGGTTGAGCTAGGCCTAGG + Intergenic
1147925146 17:43941369-43941391 CTGGGGCTGGGGCTGGGGATAGG + Intronic
1148231176 17:45935999-45936021 CTGGGGGTTGGGTTTGGGAGTGG - Intronic
1149330488 17:55576335-55576357 TTAGGGGTGGGGCTCGGGGTGGG - Intergenic
1149932416 17:60769493-60769515 CTGGAGGTGGGGCTAGGGTTAGG - Intronic
1150284393 17:63947005-63947027 CTCTGGGGTGGGCTGGGGATGGG - Intronic
1150387313 17:64772708-64772730 CTAGGGGCTGGGCCAGAGAGAGG - Intergenic
1151427721 17:74041832-74041854 CTCTGGGTTTGGCTAGGGCTTGG - Intergenic
1151536737 17:74743214-74743236 CAAGGGGCTGGGGTAGGGGTTGG - Intronic
1152255281 17:79235401-79235423 CTTGGGGTTGGGGGAGGGAAAGG + Intronic
1152952445 17:83247182-83247204 TTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1152952447 17:83247188-83247210 CTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1152952449 17:83247194-83247216 CTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1152952451 17:83247200-83247222 CTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1152952651 18:10350-10372 GTTGGGGTTGGGGTAGGGTTAGG - Intergenic
1152952740 18:10581-10603 GTAGGGGTAGGGGTAGGGTTGGG - Intergenic
1152952743 18:10587-10609 TTAGGGGTAGGGGTAGGGGTAGG - Intergenic
1152958613 18:63616-63638 TTAGGGTTAGGGCTAGGGCTAGG - Intronic
1152958622 18:63641-63663 CTAGGGCTAGGGTTAGGGTTTGG - Intronic
1152958624 18:63647-63669 CTAAGGCTAGGGCTAGGGTTAGG - Intronic
1152958653 18:63745-63767 TTAGGGTTAGGGCTAGGGTTAGG - Intronic
1152958655 18:63751-63773 CTAGGGTTAGGGTTAGGGCTAGG - Intronic
1152958657 18:63757-63779 CTAGGGCTAGGGTTAGGGTTAGG - Intronic
1152958659 18:63763-63785 CTAAGGCTAGGGCTAGGGTTAGG - Intronic
1152958688 18:63870-63892 TTAGGGTTAGGGCTAGGGTTGGG - Intronic
1152958693 18:63882-63904 TTAGGGGTAGGGTTAGGGTTAGG - Intronic
1156585997 18:38431757-38431779 CTAGGTGTTAGTCTAGGGAAAGG - Intergenic
1156952127 18:42914628-42914650 TTAGGGGTTGGGATAGGAAGGGG + Intronic
1157687040 18:49650964-49650986 CTGGGGGTTCGGCTGGGGGTGGG + Intergenic
1160632925 18:80258821-80258843 GTAGGGTTTGGGGTAGGGTTAGG + Intergenic
1160651642 19:233953-233975 GTGGGGGTGGGGCTAGGGAGGGG - Intergenic
1160653263 19:245841-245863 CTAGGGGTAGGGTTAGGGTTAGG - Intergenic
1160808305 19:1001930-1001952 CTGGAGGATGGGCTTGGGATGGG - Intronic
1161378227 19:3950835-3950857 CCAGGGGTTGGGGTGGGGAGGGG + Intergenic
1162236063 19:9310213-9310235 CTAGGGATGGGGCTAAGGCTAGG + Intergenic
1162297414 19:9822827-9822849 CGAGGAGTTGGGAAAGGGATGGG - Intronic
1164064866 19:21707326-21707348 ATAGGGATAGGGATAGGGATAGG - Intergenic
1164064868 19:21707332-21707354 ATAGGGATAGGGATAGGGATAGG - Intergenic
1164064870 19:21707338-21707360 ATAGGGATAGGGATAGGGATAGG - Intergenic
1164064872 19:21707344-21707366 ATAGGGATAGGGATAGGGATAGG - Intergenic
1164064874 19:21707350-21707372 ATAGGGATAGGGATAGGGATAGG - Intergenic
1164691849 19:30217221-30217243 CCAGGGATTGGGCTAGGCCTAGG + Intergenic
1165058702 19:33194667-33194689 CTCGGGCTCGGGCTAGGGCTCGG - Exonic
1165925002 19:39321096-39321118 CTGGGGGTGGGGCTGGGGAAGGG - Intergenic
1166283224 19:41808946-41808968 CTAGGGGGTGGGAGAAGGATGGG - Intronic
1166395015 19:42433286-42433308 CAAGGGTTTGGGCAAGGGTTTGG + Intronic
1166785528 19:45364588-45364610 CCAGGGGTAGGGGTAGGGGTTGG - Intronic
1166909746 19:46144790-46144812 CCAGGGGTTGGGGTTGGGTTTGG - Intronic
1166991814 19:46697389-46697411 CTAGGGGCGGGGCTGGGGTTAGG - Intronic
1167380075 19:49133496-49133518 CTAGGGGCTGGGAAAGGGACAGG + Intronic
1168371768 19:55841288-55841310 CTAGAGGCTGGGGAAGGGATGGG - Intronic
1168488449 19:56786048-56786070 CTAGGGCTTGGGGTAGGGCGTGG - Intronic
924958255 2:10538-10560 CTAGGGCTAGGGCTAGGGTTAGG - Intergenic
924958257 2:10544-10566 CTAGGGCTAGGGCTAGGGCTAGG - Intergenic
924958259 2:10550-10572 TTAGGGCTAGGGCTAGGGCTAGG - Intergenic
925185414 2:1843318-1843340 CAAGGCGTCGGGCTAGGAATTGG - Intronic
926186127 2:10692293-10692315 CTAGGGCTTGGGTGGGGGATGGG - Intergenic
926542297 2:14196540-14196562 CCAGGGGTTGGGATTGGCATTGG - Intergenic
926798277 2:16636771-16636793 CAAGGGGTTGGGGGAGAGATAGG - Intronic
927777220 2:25911624-25911646 CTAGAGGTAGGGGTAGGGGTAGG + Intergenic
927777223 2:25911630-25911652 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
927777226 2:25911636-25911658 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
927777229 2:25911642-25911664 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
928093522 2:28390832-28390854 CTGGGGGTGGGGGTAGGGACGGG - Intergenic
928201558 2:29250621-29250643 CTGGGGGCTGGGGTAGGGTTGGG + Intronic
929516448 2:42607066-42607088 GTAGGGGTAGGGGTAGGGGTAGG + Intronic
929516451 2:42607072-42607094 GTAGGGGTAGGGGTAGGGGTAGG + Intronic
930533587 2:52619982-52620004 CTAGGGGTAAGGGTAGGGGTAGG - Intergenic
930754405 2:54960354-54960376 CTGGGGGCTGGGCCAGGGAAGGG + Intronic
932411537 2:71550639-71550661 CTGGGGGTGGGGCTGGGGAGGGG + Intronic
933704765 2:85281548-85281570 CTCTGGGTAGGGCAAGGGATGGG + Intronic
934713943 2:96532446-96532468 CGAGGAGTTGGGCTGGGGATGGG - Intergenic
934960737 2:98670229-98670251 CAACGGGTTGGGCTAGGTACTGG + Intronic
935226581 2:101058169-101058191 TTAGGGGGTGGGCTAGGCGTTGG - Intronic
936569518 2:113602715-113602737 GTTGGGGTTGGGGTAGGGGTGGG + Intergenic
936569538 2:113602757-113602779 TTAGGGGTAGGGGTAGGGGTAGG + Intergenic
936569541 2:113602763-113602785 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
936569608 2:113602965-113602987 GTAGGGGTAGGGGTAGGGTTGGG - Intergenic
936569611 2:113602971-113602993 TTAGGGGTAGGGGTAGGGGTAGG - Intergenic
936569635 2:113603027-113603049 TTAGGGTTTGGGTTAGGGTTAGG - Intergenic
936569701 2:113603237-113603259 TTAGGGGTAGGGTTAGGGTTAGG - Intergenic
936569739 2:113603335-113603357 TTTGGGGTTGGGGTAGGGTTAGG - Intergenic
936569768 2:113603407-113603429 TTAGGGCTAGGGCTAGGGCTAGG - Intergenic
936569770 2:113603413-113603435 TTAGGGTTAGGGCTAGGGCTAGG - Intergenic
936591766 2:113811142-113811164 CTGGGGGCTGGTCTAGGAATAGG + Intergenic
938314590 2:130317146-130317168 TTAGGGGTAGGGCTAGTGAGGGG + Intergenic
939780900 2:146446394-146446416 CCAGGGGTTGAGGTAGGGAGGGG - Intergenic
940501536 2:154500449-154500471 CTAGGTGTTGGGGGAGGGACTGG - Intergenic
941007479 2:160262792-160262814 CTAGGAGTGGGGCTGGGGAAAGG + Intronic
941882305 2:170493741-170493763 CTTGGGGTTGGGGTTGGGGTTGG - Intronic
942743713 2:179207668-179207690 CTTGGTGTGGTGCTAGGGATGGG - Intronic
943566697 2:189524743-189524765 CTGGAGGTGGGGCTAGGCATTGG - Intergenic
945984881 2:216345568-216345590 CTAGGGGTGGGACCAGGCATTGG - Intronic
946723617 2:222638666-222638688 GTATGGGATGGGCTAGGGACAGG - Intronic
947796419 2:232896644-232896666 GTAGGGGTTGGGGTGGGGGTAGG + Intronic
947796433 2:232896668-232896690 GTGGGGGTGGGGGTAGGGATGGG + Intronic
948569086 2:238906133-238906155 CTGGGGGTTGGGAGAGGGCTGGG + Intronic
1169865117 20:10191544-10191566 TTAGGGTTTGGGTTAGGGTTAGG + Intergenic
1170610649 20:17910005-17910027 GTAGAGGATGGGCTAGGGGTGGG + Intergenic
1170688113 20:18587724-18587746 GTAGGGGCTGGGCCCGGGATGGG + Intronic
1172297706 20:33825068-33825090 CTAGAGGTCTGGCTAGGGCTGGG + Intronic
1173130690 20:40390412-40390434 ATTGGGGTTGGGCAAGGGGTGGG + Intergenic
1174159031 20:48537270-48537292 CAAGGTGTTGGGCTATGGCTTGG + Intergenic
1174407823 20:50313416-50313438 CTAGTGATTGGTCCAGGGATGGG + Intergenic
1174470801 20:50759241-50759263 ATAGGGATTGGGTTAGGGATGGG - Intergenic
1175002763 20:55647662-55647684 CAAGGGCTTAGGCTAGGTATAGG - Intergenic
1175972161 20:62692141-62692163 CCAGGGGTGGGTCTTGGGATGGG - Intergenic
1176215427 20:63945509-63945531 GTTGGGGTTGGGGTAGGGAGTGG + Intronic
1176942702 21:14943043-14943065 CAGGGGGTAGGGGTAGGGATTGG + Intergenic
1177953998 21:27574206-27574228 GTAGAGGTAGGGATAGGGATAGG + Intergenic
1178337232 21:31754186-31754208 CTAGGGGGTGGTTTGGGGATAGG + Intergenic
1179057473 21:37949412-37949434 CCAGGGGTTGGGGTAGAGAAAGG + Intergenic
1179498395 21:41790557-41790579 CTAGGGAATGGGGGAGGGATTGG + Intergenic
1179498419 21:41790612-41790634 CTAGGGAATGGGGGAGGGATGGG + Intergenic
1179498498 21:41790795-41790817 CTAGGGAATGGGGGAGGGATGGG + Intergenic
1179498542 21:41790902-41790924 CTAGGGAATGGGGTAGGGATGGG + Intergenic
1180184816 21:46134328-46134350 TTAGGGGTTGGGGTTGGGGTTGG + Intergenic
1180454408 22:15499933-15499955 TTAGGGGTTGGGCTTGGGTTAGG + Intergenic
1180867108 22:19126026-19126048 CTGGGGCTTGGGCTGGGGCTGGG + Intergenic
1181275121 22:21683268-21683290 CTAGGGGCTGGGCTAGGCGAGGG + Intronic
1181488813 22:23248699-23248721 CTAGGAGTGGGGCTGGGGAGAGG - Intronic
1182095710 22:27623975-27623997 CCAGGGGCTGGGCTGGGGGTGGG - Intergenic
1182242322 22:28925955-28925977 CCAGGGGATGGGGTAGGGGTTGG - Intronic
1182994189 22:34797884-34797906 CAAGGGGCTCGGCTAGGGAGCGG - Intergenic
1184960997 22:47928293-47928315 CTAAAGGTGGGGCTGGGGATGGG - Intergenic
1185388686 22:50547869-50547891 CTGGGGTTAGGGCTGGGGATGGG - Intergenic
949089314 3:10550-10572 GTAGGGGTAGGGTTAGGGTTAGG - Intergenic
949089318 3:10562-10584 GTTGGGGTTGGGGTAGGGGTAGG - Intergenic
949089329 3:10585-10607 TTAGGGGTAGGGTTAGGGGTAGG - Intergenic
949089390 3:10756-10778 GTAGGGGTAGGGTTAGGGTTAGG - Intergenic
949089392 3:10762-10784 GTAGGGGTAGGGGTAGGGTTAGG - Intergenic
949089394 3:10768-10790 GTAGGGGTAGGGGTAGGGGTAGG - Intergenic
949089397 3:10774-10796 GTAGGGGTAGGGGTAGGGGTAGG - Intergenic
949089400 3:10780-10802 TTAGGGGTAGGGGTAGGGGTAGG - Intergenic
950410271 3:12831585-12831607 CCAGGGCCTGGGCTAGGGCTGGG - Intronic
953190497 3:40682208-40682230 CGAGGGATTGGGGTAGGAATGGG + Intergenic
953338389 3:42113369-42113391 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
953338392 3:42113375-42113397 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
953376425 3:42432059-42432081 CCAGGGCTTGGTCTAGGGAAGGG + Intergenic
953570285 3:44065989-44066011 CCAGTGGTTGGGCTGGGGAAAGG - Intergenic
954643755 3:52118101-52118123 CTTGAGGGTGGGCAAGGGATGGG - Intronic
954841996 3:53519814-53519836 CTAGGGCTGGGGCTAGGGAGGGG - Intronic
957147307 3:76440935-76440957 CTGGGAGTTAGGCTAGAGATGGG - Intronic
960455327 3:117864042-117864064 CCAGGGGAGTGGCTAGGGATGGG + Intergenic
961485548 3:127213390-127213412 CTGGGGCTTTGGCTAGAGATAGG - Intergenic
961675297 3:128561217-128561239 CTAGGGGTTGGGGAGGGAATGGG + Intergenic
963925363 3:150945140-150945162 CTAGGGCTAGGACTAGGGAGAGG - Intronic
966933667 3:184691792-184691814 GCAGGGGTTGGGGGAGGGATTGG - Intergenic
967970629 3:194996486-194996508 CGAGGGGTGGGTGTAGGGATGGG + Intergenic
968364153 3:198172749-198172771 TTAGGGCTAGGGCTAGGGCTAGG + Intergenic
968364155 3:198172761-198172783 CTAGGGCTAGGGCTAGAGTTAGG + Intergenic
968366190 3:198186016-198186038 GTGGGGGTGGGGCTAGGGAGGGG + Intergenic
968831341 4:2934298-2934320 GTTGGGGTTGGGATCGGGATCGG - Exonic
969723289 4:8905125-8905147 CTAGGAGTGGGGTTAGGGAGTGG - Intergenic
970675941 4:18450410-18450432 TTAGGGGTAGGGGTAGGGAGAGG - Intergenic
970822387 4:20232910-20232932 CTAGGAGTTGGGTTGAGGATGGG - Intergenic
972258127 4:37381114-37381136 CTTGGGGTGGGGCTAGGGCTTGG - Intronic
972412238 4:38806819-38806841 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
972412241 4:38806825-38806847 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
972412244 4:38806831-38806853 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
972683211 4:41326889-41326911 CTAGGGCTTGGGGGAGGAATGGG + Intergenic
972928879 4:44046904-44046926 GTAGGGGTTGGGGAAGGGGTAGG + Intergenic
973587944 4:52411029-52411051 CTGGGGGCTGGGGTGGGGATGGG - Intergenic
979333727 4:119444840-119444862 GTGGGGGTGGGGCTAGGGAGGGG - Intergenic
980005444 4:127537123-127537145 CCAGGGGCTGGGGTAGGGAAAGG - Intergenic
980892254 4:138828408-138828430 CTAGGGGTTGGGGTAGATGTTGG + Intergenic
985462955 4:190122820-190122842 GTTGGGGTTGGGTTAGGGTTAGG + Intergenic
985824926 5:2185020-2185042 TTAGGGCTTGGGTTAGGGTTAGG + Intergenic
985824943 5:2185064-2185086 TTAGGGCTTGGGTTAGGGTTAGG + Intergenic
985923708 5:2999528-2999550 CTAGGGGTAGGGGTAGGGTTAGG + Intergenic
987793244 5:22595619-22595641 TTAGGTGTTGGGTTAGGCATAGG - Intronic
988918932 5:35922967-35922989 ATAGGGGTTGGGGTGGGGATGGG - Intronic
989074843 5:37553279-37553301 TTAGGGGTGGAGTTAGGGATTGG + Intronic
992484409 5:77181056-77181078 GTAGGGGTAGGGGTAGGGGTGGG - Intergenic
992484416 5:77181068-77181090 GTGGGGGTTGGGGTAGGGGTAGG - Intergenic
993099195 5:83516115-83516137 TTAGGGTTTGGGTTAGGGACTGG - Intronic
993099203 5:83516139-83516161 CTAGGGATAGGGTTAGGGTTAGG - Intronic
994626409 5:102225781-102225803 CTAGGGTTTGGGTTGAGGATTGG - Intergenic
995185638 5:109267646-109267668 CTAGGGGTTGGCCTGGTGCTAGG - Intergenic
997119982 5:131164489-131164511 CTTGGGGTGGAGATAGGGATAGG + Intronic
997796877 5:136819433-136819455 CTAGGTGCTGGGCTAGGCACAGG + Intergenic
998133567 5:139663118-139663140 CCAGGGGTTGGGGGAGGGATGGG + Intronic
998143633 5:139713288-139713310 CTGGGGCTTGGGGTAGGGAGTGG - Intergenic
998705246 5:144751718-144751740 GGAGAGGTTGGGCTAGGGAAAGG + Intergenic
999889410 5:155960382-155960404 CTTGGCGCTGGGCTAGGGAAAGG - Intronic
1001206550 5:169768870-169768892 CTAGGGGTTGAGGTAGGGAATGG - Intronic
1002004800 5:176223306-176223328 CTATGGGTAGGAATAGGGATTGG + Intergenic
1002023695 5:176382785-176382807 CTAGGGGTGGGGCTAGTGGTAGG + Intronic
1002186129 5:177455618-177455640 CTCGGGTTCGGGCTAGGGCTGGG + Intronic
1002221576 5:177687314-177687336 CTATGGGTAGGAATAGGGATTGG - Intergenic
1002725416 5:181291241-181291263 GTGGGGGTGGGGCTAGGGAGGGG + Intergenic
1002754652 6:147948-147970 TTAGGGGTTAGGGTAGGGTTAGG - Intergenic
1004764039 6:18704141-18704163 CTAGGGGTTGGGGTATGGAGAGG - Intergenic
1005875467 6:30007264-30007286 CTAGGGGCCGGGCCAGGGCTCGG + Intergenic
1006232611 6:32596800-32596822 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1007752133 6:44077022-44077044 TTAGGAGTTGGGGAAGGGATTGG + Intergenic
1008153313 6:47982808-47982830 CTAGGTGTTGTGCTAGGTAGAGG - Intronic
1008916602 6:56794652-56794674 CTGGGGGTTGGGCAAGGGAGAGG - Intronic
1010029260 6:71256161-71256183 ATAGGGGTGGGGCTGGGGGTGGG + Intergenic
1010828254 6:80498827-80498849 GAAAGGGTTGGGATAGGGATAGG - Intergenic
1012403119 6:98861215-98861237 CTGGGGGTGGGGATAGGGGTAGG + Intergenic
1015034232 6:128633861-128633883 CTAAGGGTTGGGGAAGGGGTAGG - Intergenic
1016750292 6:147624315-147624337 CTGGGGGGTGGGCTAGGGATGGG - Intronic
1016918717 6:149269597-149269619 CCAGGGGCTGGGGTAGGGAGAGG - Intronic
1017959335 6:159208170-159208192 GTGGGGATTGGGCTGGGGATGGG + Intronic
1018604647 6:165584392-165584414 CTGGGGGAAGGGCTAGGTATGGG - Intronic
1019215235 6:170438955-170438977 CTAGGGGGTGGTCTGGGGCTGGG + Intergenic
1019251660 7:16892-16914 CTAGGGCTAGGGCTAGAGTTAGG - Intergenic
1019251662 7:16904-16926 TTAGGGCTAGGGCTAGGGCTAGG - Intergenic
1020708333 7:11573381-11573403 CTAAGTGCTGGGCTAGGAATTGG - Intronic
1022137916 7:27466595-27466617 ATAGGGATAGGGATAGGGATAGG + Intergenic
1022605247 7:31806785-31806807 CCAGGGATTGGTCTAGGGGTAGG + Intronic
1023766637 7:43517711-43517733 TTAGGGGTAGGGCTGGGGCTGGG - Intronic
1024070318 7:45778843-45778865 GTGGGGGTGGGGCTAGGGAGGGG + Intergenic
1026042295 7:66878192-66878214 GTAGGGGGTGGGCCAGGGAAGGG + Intergenic
1026096795 7:67352921-67352943 TTAGGGGTAGGGTTAGGGATAGG - Intergenic
1026442930 7:70459730-70459752 AAAGGGGATGGGCCAGGGATTGG + Intronic
1026991352 7:74587729-74587751 GTGGGGGTTGGGCTGGAGATGGG - Intronic
1028301904 7:89210489-89210511 CCAGGGGTTGGGTGGGGGATGGG - Intronic
1028376088 7:90147564-90147586 AAAGGAGCTGGGCTAGGGATGGG - Intergenic
1028770254 7:94611477-94611499 CTAGGGGTAGGGGTGGGGGTGGG + Intronic
1029967601 7:104756053-104756075 CCAGGGGTTGGGATGGGGAGTGG + Intronic
1031809474 7:126347718-126347740 CTAGAGGATGGACTGGGGATGGG + Intergenic
1032037358 7:128530849-128530871 CGAGGGGTTGGGCAGGGGTTGGG + Intergenic
1032047724 7:128623144-128623166 GTGGGGGTGGGGCTAGGGAGGGG + Intergenic
1033114149 7:138610638-138610660 ATAGGAGCTGGGCTAGGGTTCGG - Intronic
1033349423 7:140550127-140550149 ATAGGGGTGGGGTTAGGGGTGGG + Intronic
1034202758 7:149292773-149292795 CAAGGGGATGGGCTGGGGGTTGG + Intronic
1034875940 7:154724755-154724777 CCAGGGGCTGGGGGAGGGATGGG + Intronic
1035512705 8:205346-205368 CTAGGGTTAGGGTTAGGGTTGGG - Intergenic
1035512794 8:205590-205612 CTAGGGGTAGGGTTAGGGTTAGG - Intergenic
1035512825 8:205677-205699 GTTGGGGTTGGGGTAGGGTTAGG - Intergenic
1035514403 8:220449-220471 GTAGGGGTAGGGGTAGGGTTAGG - Intergenic
1035514405 8:220455-220477 TTAGGGGTAGGGGTAGGGGTAGG - Intergenic
1036272062 8:7314884-7314906 CCCGAGGTTGGGCAAGGGATGGG - Intergenic
1036349283 8:7995461-7995483 CCCGAGGTTGGGCAAGGGATGGG + Intergenic
1037503748 8:19510149-19510171 CTGGGGATTTGGCCAGGGATAGG - Intronic
1037702688 8:21289379-21289401 CTAGGGGTTGGGGAAGGGCTCGG - Intergenic
1037787223 8:21910298-21910320 CCAGGGCTTGGGTTAGGGATGGG - Intronic
1038101231 8:24378208-24378230 CTAGGGGTTGGGATAGCATTAGG + Intergenic
1038598222 8:28910045-28910067 CTGGGGTTGGGGCTAGGAATAGG - Intronic
1039245896 8:35607855-35607877 CTAGGGTTAGGGTTAGGGTTAGG - Intronic
1039466513 8:37788831-37788853 ATGGGGGGTGGGCTAGGGAGAGG - Intronic
1039928399 8:41960135-41960157 CCAGGGGTGGGGGTAGGGGTGGG + Intronic
1041796835 8:61754064-61754086 ATAGGGATAGGGATAGGGATAGG + Intergenic
1041796844 8:61754082-61754104 ATAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796847 8:61754088-61754110 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796850 8:61754094-61754116 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796853 8:61754100-61754122 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796856 8:61754106-61754128 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796859 8:61754112-61754134 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796862 8:61754118-61754140 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1042634673 8:70860654-70860676 ATAGGGGTAGGGGTGGGGATGGG - Intergenic
1045030936 8:98135572-98135594 TTAGGGCTGGGGCTAGGGGTAGG - Intronic
1045136792 8:99229531-99229553 CTAGGGTTAGGGCTGGGTATGGG + Intronic
1045971091 8:108081234-108081256 CTAGGGGCAGAGCTAGAGATTGG - Intronic
1047222756 8:122931705-122931727 CTTGGGGTAGGGCCAGGTATTGG - Intronic
1047754255 8:127906590-127906612 CTAGGGGTTGAGAGGGGGATGGG + Intergenic
1049882830 9:10144-10166 TTAGGGGTTAGGGTAGGGTTAGG - Intergenic
1050218621 9:3359557-3359579 CTTGGGCCAGGGCTAGGGATGGG - Intronic
1050708156 9:8427721-8427743 CTAAGGGTTTGGCCTGGGATAGG + Intronic
1053167049 9:35852444-35852466 TTAGAGCTTGGGCCAGGGATGGG + Intronic
1053389846 9:37726766-37726788 CTTGGGGTGGGGCTAGGGTGAGG + Intronic
1053393447 9:37752161-37752183 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
1053393453 9:37752173-37752195 GTAGGGGTGGGGGTAGGGGTAGG - Intronic
1054172631 9:61855663-61855685 CTGGGGCTGGGGCTGGGGATGGG + Intergenic
1054447482 9:65384674-65384696 CTGGGGCTGGGGCTGGGGATGGG + Intergenic
1054664909 9:67725138-67725160 CTGGGGCTGGGGCTGGGGATGGG - Intergenic
1055623432 9:78149399-78149421 CTGGTTGTTGGCCTAGGGATAGG + Intergenic
1056013065 9:82353293-82353315 GTAGGGGTGGGGCTAGGGGCAGG - Intergenic
1060005651 9:119997318-119997340 CTAGACGTTGGGCAAGGGAAGGG - Intergenic
1060099518 9:120826678-120826700 CAGGGGGTTGGGGTAGGGAGTGG - Intronic
1060142371 9:121221385-121221407 CTGGGGGCTGGGCTGGGAATTGG - Intronic
1060260737 9:122071596-122071618 CTAGGGGCTGGGCTGGGGGGCGG - Intronic
1061043943 9:128154270-128154292 CTAGGGTTAGGGTTAGGGTTAGG + Intergenic
1061451647 9:130670183-130670205 CTTGGGGTTGGGCTAGGGCTTGG + Intronic
1062289954 9:135789993-135790015 CTTGGGGCTGGGCTAGGGGGCGG - Intronic
1062504293 9:136865558-136865580 ATTGGGGTTGGGATAGGGCTGGG - Intronic
1062542708 9:137048614-137048636 ACAGGGGTTGGGGGAGGGATGGG + Exonic
1062630004 9:137459229-137459251 CTCGGGCTTGGGCTCGGGGTCGG + Exonic
1062630009 9:137459241-137459263 CTCGGGGTCGGGCTCGGGGTCGG + Exonic
1062640596 9:137516110-137516132 CAGGGGGTTAGGTTAGGGATGGG - Intronic
1062739387 9:138159858-138159880 TTAGGGTTAGGGCTAGGGTTGGG + Intergenic
1062739425 9:138159978-138160000 TTAGGGTTTGGGTTAGGGTTTGG + Intergenic
1062748850 9:138236709-138236731 TTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1062748852 9:138236721-138236743 CTAGGGCTAGGGCTAGAGTTAGG + Intergenic
1062750558 9:138248882-138248904 GTGGGGGTGGGGCTAGGGAGGGG + Intergenic
1185722126 X:2390636-2390658 ATAGGGGTTGGGCGAGGAAAAGG - Intronic
1185839221 X:3373124-3373146 CTAGGGTTAGGGTTAGGGTTAGG + Intergenic
1185839469 X:3375277-3375299 TTAGGGGTAGGGGTAGGGTTAGG - Intergenic
1185839471 X:3375283-3375305 CTAGGGTTAGGGGTAGGGGTAGG - Intergenic
1186251952 X:7677935-7677957 CTAGGGCTAGGGCTAGGGCTGGG + Intergenic
1186251954 X:7677941-7677963 CTAGGGCTAGGGCTGGGGTTTGG + Intergenic
1187719974 X:22140000-22140022 CTAGGGGTGGGGCTGGCAATTGG - Intronic
1190817347 X:53939940-53939962 GTAGAGGGTGGGCTAGAGATGGG - Intronic
1190823041 X:53992633-53992655 CTAGGGGTTGGGACATGGGTAGG - Intronic
1191714131 X:64182533-64182555 CTGGGGGTTGGGTGGGGGATGGG + Intergenic
1194810661 X:98383243-98383265 GCAGGGGATGGGATAGGGATGGG + Intergenic
1198301338 X:135336628-135336650 CTAGGAGTAGGGCTAGGGCTAGG - Intronic
1198812133 X:140546733-140546755 CTAGGGATGGGGGTAGGGACAGG + Intergenic
1199354746 X:146848970-146848992 CTAGGTATTGTGCTAGGGCTTGG - Intergenic
1199607520 X:149587538-149587560 GTAGGGGTGGGGATGGGGATAGG + Intergenic
1199631603 X:149781829-149781851 GTAGGGGTGGGGATGGGGATAGG - Intergenic
1199716096 X:150508352-150508374 CAAGGGGTGGGGGTGGGGATGGG - Intronic
1199750559 X:150813055-150813077 CCAGGGGTTAGGAAAGGGATGGG + Intronic
1199949898 X:152699175-152699197 ATAGGGGTGGGGGTGGGGATGGG - Intronic
1199954570 X:152733621-152733643 GTAGGGGTAGGGATAGGGACGGG - Intronic
1199954573 X:152733627-152733649 TTGGGGGTAGGGGTAGGGATAGG - Intronic
1199959776 X:152769286-152769308 ATAGGGGTGGGGGTGGGGATGGG + Intronic
1200391674 X:155951949-155951971 CTTGGGGTTGGGTTAGGGTTAGG + Intergenic
1200402950 X:156030019-156030041 TTAGGGGTTGGGGTTGGGGTTGG + Intergenic
1200402999 X:156030143-156030165 TTAGGGGTTAGGGTAGGGTTAGG + Intergenic
1200786009 Y:7261048-7261070 CTAGGGTTAGGGTTAGGGTTAGG - Intergenic
1201970799 Y:19792531-19792553 TGAGGGGTTGGGGGAGGGATAGG - Intergenic