ID: 903543488

View in Genome Browser
Species Human (GRCh38)
Location 1:24109783-24109805
Sequence GAAGGGCTAGGGGTTGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 624}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903543488_903543501 27 Left 903543488 1:24109783-24109805 CCTAGCCCAACCCCTAGCCCTTC 0: 1
1: 0
2: 4
3: 41
4: 624
Right 903543501 1:24109833-24109855 GGCCAGGCCGTGGCAGAGGCTGG 0: 1
1: 1
2: 0
3: 72
4: 679
903543488_903543502 28 Left 903543488 1:24109783-24109805 CCTAGCCCAACCCCTAGCCCTTC 0: 1
1: 0
2: 4
3: 41
4: 624
Right 903543502 1:24109834-24109856 GCCAGGCCGTGGCAGAGGCTGGG 0: 1
1: 0
2: 1
3: 48
4: 490
903543488_903543504 29 Left 903543488 1:24109783-24109805 CCTAGCCCAACCCCTAGCCCTTC 0: 1
1: 0
2: 4
3: 41
4: 624
Right 903543504 1:24109835-24109857 CCAGGCCGTGGCAGAGGCTGGGG 0: 1
1: 0
2: 8
3: 88
4: 735
903543488_903543498 17 Left 903543488 1:24109783-24109805 CCTAGCCCAACCCCTAGCCCTTC 0: 1
1: 0
2: 4
3: 41
4: 624
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543488_903543497 11 Left 903543488 1:24109783-24109805 CCTAGCCCAACCCCTAGCCCTTC 0: 1
1: 0
2: 4
3: 41
4: 624
Right 903543497 1:24109817-24109839 TCATATGTCCATTCAAGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 149
903543488_903543500 23 Left 903543488 1:24109783-24109805 CCTAGCCCAACCCCTAGCCCTTC 0: 1
1: 0
2: 4
3: 41
4: 624
Right 903543500 1:24109829-24109851 TCAAGGCCAGGCCGTGGCAGAGG 0: 1
1: 0
2: 1
3: 16
4: 247
903543488_903543496 6 Left 903543488 1:24109783-24109805 CCTAGCCCAACCCCTAGCCCTTC 0: 1
1: 0
2: 4
3: 41
4: 624
Right 903543496 1:24109812-24109834 CTATGTCATATGTCCATTCAAGG 0: 1
1: 0
2: 0
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903543488 Original CRISPR GAAGGGCTAGGGGTTGGGCT AGG (reversed) Intronic
900016673 1:155572-155594 GGAGGGATGGGGATTGGGCTGGG - Intergenic
900018092 1:168582-168604 GACGGGGTGGGGGTGGGGCTAGG - Intergenic
900046934 1:514164-514186 GGAGGGATGGGGATTGGGCTGGG - Intergenic
900048350 1:527178-527200 GACGGGGTGGGGGTGGGGCTAGG - Intergenic
900069137 1:755882-755904 GGAGGGATGGGGATTGGGCTGGG - Intergenic
900070575 1:769030-769052 GACGGGGTGGGGGTGGGGCTGGG - Intergenic
900952103 1:5863956-5863978 GGAGGGGTAGGGGTTGGTGTAGG + Exonic
900959517 1:5910145-5910167 GATGGGCTTGGGGTCTGGCTTGG - Intronic
901053106 1:6435576-6435598 AAAGGGCAAGGGCTTGGTCTGGG + Intronic
901075824 1:6554234-6554256 GTCGGGCTAGGGATCGGGCTGGG + Exonic
901415214 1:9111631-9111653 GAAGGGGTAGGTGTTGCCCTGGG + Intronic
901504593 1:9676550-9676572 AGAGGCCTAGGGGTTGGGCAAGG - Intronic
902413481 1:16225736-16225758 GAAGGGTTGGGGGATGGGCTGGG - Intergenic
902481135 1:16712473-16712495 AAAGGGCAAGGGCTTGGTCTGGG - Intergenic
902631162 1:17705515-17705537 GGAGGGCTGGGGCTGGGGCTGGG + Intergenic
902785615 1:18730897-18730919 GAAGGGGTTGGGGGTGGGGTAGG + Intronic
903144662 1:21363298-21363320 GAGGGGCTGGGGCTGGGGCTGGG - Intergenic
903187813 1:21639206-21639228 GTAGTGCCAGGGGTGGGGCTGGG - Intronic
903229553 1:21913550-21913572 TAAGGCCTGGGGGTTGGGCAGGG - Intronic
903511685 1:23880467-23880489 AAAGAGCTGGAGGTTGGGCTAGG - Intronic
903543488 1:24109783-24109805 GAAGGGCTAGGGGTTGGGCTAGG - Intronic
903580643 1:24368107-24368129 GTAGGGCTAGGGGCTGGGGCAGG - Intronic
903637189 1:24829313-24829335 GAAGGGCTAGTGGTTAGGTTGGG + Intronic
904360105 1:29965652-29965674 GAAGGGCCAGGGGTGGGTGTAGG - Intergenic
904453515 1:30632273-30632295 GCAGGGCGAGGGCTTGGGGTAGG + Intergenic
904718768 1:32490216-32490238 GAGGGGCAAAGGGTTGGGATGGG + Exonic
904896149 1:33819880-33819902 GAAGGACTTGGGGCGGGGCTTGG - Intronic
905363994 1:37438908-37438930 GAGGGGCTGGGGGCTGTGCTTGG - Intergenic
905548752 1:38819195-38819217 ATAGGGGTAGGGGTGGGGCTGGG + Intergenic
905581941 1:39088896-39088918 GAAGGGCTCATGTTTGGGCTAGG + Intronic
905883836 1:41481260-41481282 GAAGGGGTGGGGGCTGGGCTGGG - Intronic
906110233 1:43317682-43317704 GAAGGGGTAGGTGATGAGCTGGG - Intronic
906292882 1:44631592-44631614 GATGGCCTAGGGGTTGGGCGGGG + Intronic
906370178 1:45247402-45247424 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
906370181 1:45247408-45247430 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
906370184 1:45247414-45247436 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
906482101 1:46205832-46205854 GAAGGACAAGGGGTGGGGCAAGG + Intronic
906875503 1:49533877-49533899 GCAGGGCTAGTGTTGGGGCTAGG - Intronic
907203924 1:52752363-52752385 GAAGTGCTAGGGGTGGGGTAGGG - Intronic
907443875 1:54495132-54495154 GAAGGGCCAGGTGTTGACCTGGG - Intergenic
907462853 1:54615569-54615591 GCAGGGTTAGGGGTTAGGATTGG + Intronic
908166243 1:61462294-61462316 GCAGGGCTAAGGGTGGGGCGGGG - Intronic
908510315 1:64845800-64845822 GAAGAGCTTGGGGTTGAACTTGG - Intronic
911051578 1:93676037-93676059 GAAGGGCTGTATGTTGGGCTTGG - Intronic
911742638 1:101403826-101403848 GCAGGGATAGGGGTGGAGCTGGG - Intergenic
912801156 1:112720471-112720493 AGAGGGCAAGGGGGTGGGCTGGG - Exonic
914514508 1:148362622-148362644 GGAGGGCTGGGGGTGGGGGTGGG - Intergenic
914755745 1:150560841-150560863 GTGGGGCTAGGGGCTGGGCGGGG - Exonic
915130133 1:153690044-153690066 AAAGGGCGAGGGGCTGGGCCAGG - Intronic
915285358 1:154848753-154848775 GAAGAAGTAGGGGTTGAGCTGGG - Intronic
915320440 1:155053146-155053168 GAAGGGCTGGGGCTTGTGCTGGG + Intronic
915497548 1:156292606-156292628 GAAGGGCTAAGAGATGGGCTTGG - Intronic
915640605 1:157221634-157221656 CAGGGGCTGGGGGTTGGGGTGGG - Intergenic
916165063 1:161959335-161959357 GAAGGGCCAGTGGTGGGGTTTGG + Exonic
916309140 1:163375147-163375169 GGAGGGCTGGGGGTTGTGCTGGG - Intergenic
916445033 1:164864260-164864282 GAAGGGCTAGGGCCTGGGAGAGG - Intronic
917135472 1:171784544-171784566 CAGGGGCTGGGGCTTGGGCTGGG + Intronic
917626061 1:176847363-176847385 GAAGGGCTTAGGGTAGGGTTGGG + Intergenic
919761915 1:201103495-201103517 GAAGGGGCATGGGTTGGGATGGG + Intronic
919822233 1:201480756-201480778 GAATCTCTAGGGGTGGGGCTGGG + Intergenic
919940220 1:202281204-202281226 GAAGGCATGGGGGTGGGGCTGGG + Intronic
920286291 1:204882217-204882239 GCATGGCCAGGGGTTGGGGTGGG - Intronic
920515251 1:206580488-206580510 GAAGGTATAGGGGTAGGGCCAGG + Intronic
921181950 1:212638270-212638292 GATGGGCTAGGAGTTGGGTGAGG - Intergenic
922104498 1:222501274-222501296 GGAGGGATGGGGATTGGGCTGGG - Intergenic
922105935 1:222514446-222514468 GACGGGGTGGGGGTGGGGCTAGG - Intergenic
922264816 1:223973787-223973809 GGAGGGATGGGGATTGGGCTGGG - Intergenic
922266274 1:223987057-223987079 GAGGGGGTGGGGGTGGGGCTAGG - Intergenic
922775641 1:228213194-228213216 GAGGGGCTAAGGGTTGGGAAGGG - Intronic
924346673 1:243078793-243078815 GGAGGGATGGGGATTGGGCTGGG - Intergenic
924348120 1:243092013-243092035 GACGGGGTGGGGGTGGGGCTAGG - Intergenic
924627527 1:245708078-245708100 GAGGGGCTAGGCCTTGAGCTAGG + Intronic
924800607 1:247327352-247327374 AAGGAGCTAGGGGTTGGGCGCGG - Intronic
1062765844 10:64361-64383 TAAGGGTTAAGGGTTGGGGTTGG - Intergenic
1062800859 10:379253-379275 GATGGGGAAGGGGTTGGGGTGGG - Intronic
1063145151 10:3289520-3289542 GAAGGGCCCTGTGTTGGGCTCGG - Intergenic
1063276968 10:4579984-4580006 GAAGGAGGAGGGGTTGGGGTAGG + Intergenic
1063280011 10:4617922-4617944 GCAGAGCTAGGGGAGGGGCTAGG + Intergenic
1063578578 10:7284295-7284317 GAAGGGGTGGGGCATGGGCTGGG - Intronic
1064123328 10:12638163-12638185 AAAGGGCTAGGGGGTGGGAGGGG + Intronic
1066728239 10:38412888-38412910 GAAGGGGTGGGGGTGGGGCTAGG + Intergenic
1066729676 10:38426056-38426078 GGAGGGATGGGGATTGGGCTGGG + Intergenic
1066962156 10:42233851-42233873 GAAGGGCTAGGGTCTGGGACAGG + Intergenic
1067008759 10:42690886-42690908 GAGGGGCCGGGGGTTGGGCGGGG - Intergenic
1067047779 10:42995075-42995097 CAAGGGCTAGGGGTGGGGGATGG + Intergenic
1067274465 10:44821682-44821704 GTGGAGCTAGGGATTGGGCTAGG - Intergenic
1067803529 10:49376950-49376972 GGAGGGCTAGGGGGTGGGCTTGG - Intronic
1068694974 10:59958071-59958093 CTAGGGCTAGGGGTTGGGAATGG - Exonic
1068811170 10:61257383-61257405 GAAGTGCCTGGGGTTGGGTTGGG - Intergenic
1069121973 10:64577898-64577920 GAAGGGCGTGGGCTTGGGCAAGG + Intergenic
1069557417 10:69407316-69407338 GGAGGGCTGGGGCTGGGGCTTGG - Intronic
1069757722 10:70783284-70783306 GGAGGGCTTGGGGTAGGGCAGGG - Intronic
1069866069 10:71503611-71503633 GATGGGCAGGGGGTTGGGGTAGG + Intronic
1070391276 10:75972868-75972890 GAGGGGCTGGGGCTGGGGCTGGG + Intronic
1070599404 10:77855294-77855316 GGAGGGCTGGGGCTGGGGCTAGG - Intronic
1070651493 10:78240137-78240159 CCAGGGCTAGGGGTAGGGGTGGG + Intergenic
1071811464 10:89186418-89186440 GAAGGTCTAGGGCCTGGGTTGGG - Intergenic
1071867770 10:89755556-89755578 GAAGGGGAAGGGGATGGGCACGG - Intronic
1072493035 10:95927799-95927821 GGAGGGCTTGGGATTGGGTTAGG - Intronic
1073127729 10:101162345-101162367 AAAGGACTAGGGGCTTGGCTGGG - Intergenic
1073208059 10:101779148-101779170 GAGGGGCCGGGGGATGGGCTGGG - Intronic
1073323066 10:102627465-102627487 CAAGGGCTGGGGGTAGGGCAGGG - Intronic
1074613665 10:115044710-115044732 GATGGGCCAGGGGCTGTGCTAGG + Intergenic
1076440790 10:130480249-130480271 GAAGAGCTAGGGTTTGGCCTTGG + Intergenic
1076677206 10:132153358-132153380 TCAGGGCTAGGGGTGGGACTAGG - Intronic
1076727103 10:132419120-132419142 GAAGGGCAAGGGCTGGGGCTGGG - Intergenic
1076973263 11:150641-150663 GGAGGGATGGGGATTGGGCTGGG - Intergenic
1076974694 11:163778-163800 GACGGGGTGGGGGTGGGGCTAGG - Intergenic
1076976575 11:176522-176544 GAAGGGTTAGGGTTAGGGTTAGG - Intronic
1077046263 11:547074-547096 GCTGGGCTTGGGCTTGGGCTTGG + Intronic
1077121656 11:911485-911507 GAACGGCTAGGGCTGGGGGTGGG - Intronic
1077491345 11:2862370-2862392 GAAGGTCTGGGGGTCGGGCCGGG - Intergenic
1077533487 11:3108063-3108085 GCAGGGCCAGGGGTGGGTCTGGG - Intronic
1077581685 11:3421383-3421405 ACAGGGCCAGGGGTTGGGCCAGG + Intergenic
1077662803 11:4084572-4084594 GAAGGGCTGGGGGCAGGGATTGG - Intronic
1079002516 11:16769922-16769944 GAAGTTCTAGGGGTGGGGGTTGG - Intergenic
1079320809 11:19449826-19449848 GAAGGGCCAGGGGGTGGGAGGGG - Intronic
1079408109 11:20162830-20162852 GAATGGCTGGGGCTTGGGGTGGG - Intergenic
1081633210 11:44703186-44703208 CAGAGGCTAGGAGTTGGGCTCGG - Intergenic
1083777046 11:64899193-64899215 GAAGGGGTAGGGGCCGGGCATGG - Intronic
1084044311 11:66560065-66560087 GATGCGCTAGAGGTGGGGCTGGG + Exonic
1084238596 11:67804201-67804223 ACAGGGCCAGGGGTTGGGCCAGG + Intergenic
1084410250 11:69002644-69002666 GAAGGGCCACGGGTTGGGGGAGG + Intergenic
1084440505 11:69170072-69170094 GCAGGACGAGGGCTTGGGCTTGG + Intergenic
1084460123 11:69292536-69292558 GATGGGCTGGTGGTTGGGTTGGG + Intergenic
1084670605 11:70604439-70604461 GGAGGGCCAGGGGGTGGCCTGGG + Intronic
1084938007 11:72597486-72597508 TAAGGGCTAGGGGCTGGGCAGGG - Intronic
1084947648 11:72647283-72647305 GAAGGGCTAGGGTTTGAACCTGG - Intronic
1085309024 11:75505337-75505359 GGAGGGCTGGGGGTGGGGCTGGG - Intronic
1085338740 11:75717743-75717765 GGAGGCCTTGGGGCTGGGCTGGG + Intergenic
1086453400 11:86938727-86938749 GAGGGGCTGGGGGTAGGGGTGGG + Intronic
1086948501 11:92867478-92867500 GAAAGGCCAGGGGTTGGACAGGG - Intronic
1088907103 11:114163201-114163223 GAAGGGGTGGGGGTGGGGTTGGG - Intronic
1089260490 11:117220796-117220818 GCAGGGCTCGGGGGTGGGCAAGG - Intronic
1089428503 11:118401116-118401138 AAAGGGCTATGGGTTGAGCCTGG + Intronic
1090081249 11:123614274-123614296 GAAGTGCTAGGGGTAAAGCTAGG - Intronic
1090386050 11:126358083-126358105 GAGGGGCCAGGAGCTGGGCTAGG - Intronic
1091216071 11:133903004-133903026 GGAGGGCAGGGGGTTGGGCTGGG - Intergenic
1091373102 12:10186-10208 TTAGGGTTAGGGGTTGGGTTGGG - Intergenic
1091445690 12:543216-543238 GAAGTGCTGGGTGCTGGGCTGGG + Intronic
1091599089 12:1907288-1907310 GAAGGGCTAAAGTGTGGGCTTGG + Intronic
1091741637 12:2963825-2963847 GAAGGGCCAGAGGATGGGCCAGG + Intronic
1092098922 12:5866973-5866995 GTTGGTCTAGGGGTTGGTCTGGG + Intronic
1092409283 12:8241824-8241846 ACAGGGCAAGGGGTTGGGCCAGG + Intergenic
1094142756 12:27198087-27198109 GTTGAGCTAGGGGCTGGGCTGGG - Intergenic
1094311410 12:29087421-29087443 TCAGGGCTAGGGGAGGGGCTGGG - Intergenic
1094721344 12:33067755-33067777 GGGGGGCTAGGGGTTAGGTTGGG - Intergenic
1097246598 12:57610891-57610913 GAGGGGCCAGGGGTGGGGCGCGG - Intronic
1097285251 12:57872257-57872279 GAGGGGATAGGGATTGGCCTGGG - Intergenic
1098028983 12:66235185-66235207 GAGGGGCCATGGGGTGGGCTGGG + Intronic
1098311784 12:69156074-69156096 GGATGGCTTGGGCTTGGGCTTGG + Intergenic
1098740861 12:74171620-74171642 GGAAGGCGAGGGGCTGGGCTCGG + Intergenic
1099165949 12:79307608-79307630 GAAGGGCTGGGGGTGGGGGTGGG + Intronic
1100555208 12:95686466-95686488 GGAGGGCAAGGGGCTGGGCGTGG + Intronic
1100879416 12:98999766-98999788 GAAGGGCATGTGGTTGGGCTGGG + Intronic
1101360652 12:104023691-104023713 CAAGGGCTGGGTGTTGGGCAGGG - Intronic
1101610585 12:106287771-106287793 GAAGAACTAAAGGTTGGGCTGGG + Intronic
1101913322 12:108877417-108877439 GAAGGAGGAGGGGTTGGGTTAGG - Intronic
1101955078 12:109205784-109205806 GCAGGGCTAGGGGTGGGGATGGG + Intronic
1102567061 12:113803641-113803663 GAGGGGCTGGGGGCTGGGGTTGG + Intergenic
1102796354 12:115692052-115692074 GAAGGGCAAGAGGTTGAGGTGGG - Intergenic
1102880753 12:116482715-116482737 GAGAGGCTAGGGATGGGGCTGGG + Intergenic
1103245268 12:119451392-119451414 GCAGGGGTTGGGGTGGGGCTGGG - Intronic
1103303037 12:119942673-119942695 GAAGGGCATGGCCTTGGGCTGGG - Intergenic
1103363492 12:120367696-120367718 GCAGAGCTTGGGGTGGGGCTAGG - Intronic
1103463460 12:121123299-121123321 GAAGGGCCAGGAGTTCGGCCAGG - Intergenic
1103885566 12:124197731-124197753 GAGGGGCCAGAGGTTGGCCTGGG + Intronic
1104163837 12:126206676-126206698 AAATGGCGTGGGGTTGGGCTTGG + Intergenic
1105261976 13:18786279-18786301 GAATGGCTGGGGGTTGGGGAGGG - Intergenic
1105358623 13:19685214-19685236 CAAGGGCCAAAGGTTGGGCTGGG - Intronic
1107994574 13:45847871-45847893 GTAGTGCTAGGGGTCGGTCTGGG - Intronic
1108342945 13:49515596-49515618 CATGGGCTTGGTGTTGGGCTGGG - Intronic
1110622643 13:77615303-77615325 TAAAGACTAGGAGTTGGGCTGGG - Intronic
1111086582 13:83382773-83382795 GAAGGGCTAGGACTAGGGCAAGG + Intergenic
1112508380 13:99988965-99988987 GCAGGGATAGGGGTGGGGTTGGG - Intergenic
1113910775 13:113840241-113840263 GATGGGCTAGGGGCTGGCCAGGG - Intronic
1113939619 13:114011630-114011652 GAAGTGCTGGGGGCCGGGCTTGG + Intronic
1114030293 14:18572877-18572899 TAGGGATTAGGGGTTGGGCTTGG + Intergenic
1114460525 14:22883543-22883565 CAAGGGATTGGGGCTGGGCTAGG + Intronic
1115528146 14:34301894-34301916 AGGGGGCTAGGGGTGGGGCTGGG - Intronic
1115746534 14:36443740-36443762 GAATGCCTGGGGGTTGGACTGGG - Intergenic
1115862881 14:37709131-37709153 TAAGGGGTAGGGGTGGGGCCAGG - Intronic
1117141124 14:52791716-52791738 GGAGGGCGAGGGGCGGGGCTCGG + Intergenic
1117309879 14:54510350-54510372 GAAGGGCTTGGGCTTGGGCTTGG + Intronic
1118262147 14:64257737-64257759 GAAGGGGTGGGGGATGGGGTAGG + Intronic
1118457426 14:65957727-65957749 CAAGGGCTAGGGGATGGGGCAGG - Exonic
1119543828 14:75457626-75457648 GAAAGGCCTGGGGCTGGGCTTGG + Intronic
1119703162 14:76768733-76768755 GAAGGGAAGGGGGTAGGGCTGGG - Intronic
1119916815 14:78409889-78409911 GAAAGTCTAGGGGTTGCTCTGGG + Intronic
1121560771 14:94873709-94873731 GAAGGGCCAGGGGTGGGACAGGG + Intergenic
1122266381 14:100548783-100548805 AAGGGGCTATGGGGTGGGCTCGG + Intronic
1122267343 14:100552857-100552879 GATGGACTGGGGGTTGGCCTGGG + Intronic
1122402813 14:101477290-101477312 GCAGGGCTGGGGGTGGCGCTGGG - Intergenic
1125420480 15:39499546-39499568 CAAGGGCTAGGGTTTGGGCTAGG + Intergenic
1125507635 15:40276217-40276239 GAAGGGCAGAGGGTGGGGCTGGG - Exonic
1125722801 15:41853221-41853243 GGTGGGCCTGGGGTTGGGCTGGG - Intronic
1126580190 15:50235837-50235859 CAAGGGGTAGGGGTGGGGCATGG - Intronic
1126916795 15:53475013-53475035 AAAGGGATGGGGGTGGGGCTGGG - Intergenic
1127069774 15:55277584-55277606 GAAGGGGTAGGGGTTGTCCCAGG - Intronic
1127752474 15:62060009-62060031 GCAGGGCCAGGGCTTGGCCTCGG + Intronic
1128553027 15:68610346-68610368 GAAGGGCTGGGGGCTGGCTTGGG + Intronic
1128690282 15:69719382-69719404 AAATGGGGAGGGGTTGGGCTGGG + Intergenic
1128999276 15:72319528-72319550 GCAGGGCTAGGGCTGGGGCTGGG + Intronic
1129200361 15:73994915-73994937 GTAGGGCTGGGGCTGGGGCTGGG - Exonic
1129244492 15:74271323-74271345 GTTGGGCTAGGGGTAGGGCTAGG - Intronic
1129780031 15:78264229-78264251 GAAGGGCAAGGGGGCGGCCTCGG + Exonic
1130301489 15:82682341-82682363 GAAGGGCTTGGGGCCGGGCGTGG - Intronic
1130712272 15:86294900-86294922 GAAGGGTCAGGGGATGGGGTGGG - Intronic
1131014105 15:89043263-89043285 GAAGAGCTGGGGTTTGGGCTGGG + Intergenic
1131061217 15:89405819-89405841 GAGGGGTTAGGGTTTGGGATTGG + Intergenic
1132072432 15:98790233-98790255 GAAGGGAAAGGGGGTGGCCTGGG + Intronic
1132600061 16:769250-769272 GGAGGGCTGGGGCTGGGGCTGGG - Intergenic
1132885856 16:2181653-2181675 GCCGGGCTAGGGGCGGGGCTGGG + Intronic
1133058615 16:3160058-3160080 AAAGGGCTAGGAGCCGGGCTTGG - Intergenic
1133101455 16:3482628-3482650 GTAGGGCAAGGGGGTGGGGTGGG - Intronic
1133165941 16:3947234-3947256 GGAGGGCCACAGGTTGGGCTGGG + Intergenic
1133370142 16:5240407-5240429 GAAGGGGCGGGGGTTGCGCTGGG + Intergenic
1134233529 16:12447985-12448007 GAAGGCCTAGGATTGGGGCTTGG + Intronic
1134523174 16:14927755-14927777 GAAGGGCTAGGGGAGGGGAGGGG - Intronic
1134549418 16:15132210-15132232 GAAGGGGGAGGGGAGGGGCTAGG + Intronic
1134549506 16:15132401-15132423 GAAGGGGCAGGGGAGGGGCTAGG + Intronic
1134710841 16:16326406-16326428 GAAGGGCTAGGGGAGGGGAGGGG - Intergenic
1134948760 16:18342239-18342261 GAAGGGCTAGGGGAGGGGAGGGG + Intergenic
1134955746 16:18381464-18381486 GAAGGGCTAGGGGAGGGGAGGGG + Intergenic
1135352303 16:21739343-21739365 GGTGGGCTGGGGGTTGGCCTAGG + Intronic
1135450792 16:22555465-22555487 GGTGGGCTGGGGGTTGGCCTAGG + Intergenic
1135955452 16:26953055-26953077 GAAGGGCTGGGAGTTAGGGTTGG - Intergenic
1136187585 16:28597156-28597178 GAAGGGGTAGGGTTGGGGGTGGG + Intergenic
1136601219 16:31290236-31290258 CAGGGGCTGGGGGTTGGACTGGG + Intronic
1136626203 16:31463696-31463718 GAAGCGCTGGGGGCTGGGCATGG - Intronic
1137867695 16:51917754-51917776 GTAGGGACAGGGATTGGGCTGGG - Intergenic
1138106060 16:54287592-54287614 GAAGGGGTAGGGGTCGCGCAAGG - Intergenic
1138657996 16:58501693-58501715 GAAGGGCTGGGGCTGGGCCTGGG - Intronic
1138910419 16:61390536-61390558 GAAGGCCTAGGAGTGGGGCGAGG + Intergenic
1139290007 16:65849459-65849481 CAGGAGCAAGGGGTTGGGCTGGG + Intergenic
1139733012 16:68963405-68963427 GTAGGGCAAGGGGCTGGGCATGG - Intronic
1141174506 16:81710070-81710092 GAGGGGTTTGGGGGTGGGCTGGG + Exonic
1141355983 16:83347364-83347386 GTGGGGGTAGGGGTTGGGGTTGG + Intronic
1141527626 16:84622056-84622078 AAAGGGTTAGGGATTGGGGTAGG + Intergenic
1141959133 16:87392659-87392681 GGAGGGCCAGGGGCTGGTCTGGG + Intronic
1142128315 16:88421018-88421040 GAAGGGCCAGGGGTGGGACCAGG + Intergenic
1142142730 16:88479771-88479793 GATGGGAGAGGGGTGGGGCTGGG - Intronic
1142284282 16:89165443-89165465 GAAGGGCACGGGGTAGGGATGGG - Intergenic
1142443839 16:90121652-90121674 GAAGGGTTAGGGTTAGGGTTAGG + Intergenic
1142443861 16:90121714-90121736 TTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1142446988 16:90146885-90146907 GGAGGGATGGGGATTGGGCTGGG + Intergenic
1142460504 17:88446-88468 GGAGGGATGGGGATTGGGCTGGG - Intergenic
1142461942 17:101591-101613 GACGGGGTGGGGGTGGGGCTAGG - Intergenic
1142463564 17:113501-113523 TTAGGGCTAGGGCTAGGGCTAGG - Intergenic
1142463586 17:113563-113585 GAAGGGTTAGGGTTAGGGTTGGG - Intergenic
1142959748 17:3545132-3545154 CCAGGGCAAGGGGTTGGGCTGGG + Intronic
1143141800 17:4745315-4745337 GGAGCGGAAGGGGTTGGGCTGGG - Exonic
1143175620 17:4953348-4953370 GAAGGGCTAGCGGTGGGGAAGGG + Intronic
1143183871 17:4999145-4999167 GAAGTGCTGGGGGCTGGGCAAGG + Intronic
1143632015 17:8144924-8144946 GTGGGGCTGGGGGCTGGGCTGGG + Exonic
1144454051 17:15404557-15404579 CCAGGGCTCGTGGTTGGGCTGGG + Intergenic
1144579601 17:16450889-16450911 GAGGGTCTAGGCTTTGGGCTTGG + Intronic
1144954781 17:19013546-19013568 GGAGGGCGTGGGGTTGGACTTGG + Intronic
1145270450 17:21401897-21401919 GAAGCACAAGGGGTGGGGCTTGG + Intronic
1145308660 17:21689294-21689316 GAAGCACAAGGGGTGGGGCTTGG + Intergenic
1145397637 17:22507619-22507641 GAAGGGCTGGAGGCTGGGCATGG + Intergenic
1145789683 17:27618440-27618462 TCTGGGCTAGGGGTTGGGCCAGG + Intronic
1146263288 17:31435543-31435565 AAAGGTTTGGGGGTTGGGCTGGG - Intronic
1146899945 17:36577466-36577488 ATAGGGGTAGGGGTTGGGGTGGG - Intronic
1147197638 17:38778236-38778258 GCTGGGCTAGGGGCTGGGGTGGG + Intronic
1147610819 17:41801029-41801051 AAAGGCCTAGGGGAGGGGCTTGG + Intergenic
1147783891 17:42964272-42964294 AGAGGGCTAGGGCTAGGGCTGGG - Intronic
1148630772 17:49106661-49106683 CAGGGGCTAGGGCTGGGGCTGGG - Intergenic
1148680597 17:49471240-49471262 GCAGGGCTAGGGGTTGGAAGGGG + Intronic
1148789884 17:50167215-50167237 GAAGGGATTGGGGTGGGGATGGG - Intronic
1148806984 17:50268901-50268923 GAAGGACTCGTGGTTGGGGTGGG - Intergenic
1150206914 17:63416072-63416094 GAAGGGCTAAGGAGAGGGCTTGG + Intronic
1150763687 17:67986612-67986634 GAAGAGCTATGGGTCGGGCGTGG + Intergenic
1151232324 17:72693950-72693972 AAAGAGCTGGGGGCTGGGCTCGG - Intronic
1151356192 17:73559984-73560006 GAAGGGCTGGGGGTTCCTCTGGG + Intronic
1151357932 17:73571470-73571492 GATGGGCTCAGGGTTGGGCCTGG - Intronic
1151480834 17:74369326-74369348 GCAGGGGAAGGGGTCGGGCTGGG - Intronic
1152294065 17:79456489-79456511 GAGGGGCTGGGGCTTGGTCTGGG - Intronic
1152317924 17:79591555-79591577 GATGGGCTGGGGGTTGGGGGTGG - Intergenic
1152637816 17:81437335-81437357 GGAGGGCTGGGGCTGGGGCTGGG + Intronic
1152952445 17:83247182-83247204 TTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1152952447 17:83247188-83247210 CTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1152952449 17:83247194-83247216 CTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1152952451 17:83247200-83247222 CTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1152952740 18:10581-10603 GTAGGGGTAGGGGTAGGGTTGGG - Intergenic
1152958691 18:63876-63898 GTAGGGTTAGGGTTAGGGCTAGG - Intronic
1152963369 18:94514-94536 TTAGGGCTAGGGTTTGGGTTAGG - Intergenic
1153783917 18:8517491-8517513 GTTGGGCTTGGGCTTGGGCTCGG + Intergenic
1154497765 18:14975053-14975075 CAGGGGCTGGGGGTGGGGCTGGG - Intergenic
1155243437 18:23884930-23884952 ACAGAGCTAGGGGTGGGGCTGGG + Intronic
1155661067 18:28248806-28248828 GAAGGAGGAGGGGTTGGGGTAGG + Intergenic
1156154943 18:34290545-34290567 CAAGGGCTAGGAGTTGGGAAAGG + Intergenic
1156231856 18:35161031-35161053 GAAGTGCTAATGGTTGTGCTGGG - Intergenic
1156527205 18:37778402-37778424 GAAGGGCTGGGGGAGGGGGTGGG - Intergenic
1156721324 18:40073429-40073451 GATGTGCTAGGGGAAGGGCTAGG + Intergenic
1157236225 18:45967456-45967478 CCAGGGCTAGGGGTGGGGCCTGG - Intergenic
1157576836 18:48749276-48749298 GAATGGCCAGGCTTTGGGCTGGG + Intronic
1159773454 18:72575738-72575760 AAAGGGCCAGGGGTAGGACTTGG + Intronic
1160238979 18:77109051-77109073 GCAGGGCTAGGGTTAGGGTTGGG + Intronic
1160404223 18:78634192-78634214 GAAGGGCCAGGGGCTCAGCTGGG - Intergenic
1160461698 18:79043525-79043547 GATGGGGTTGGGGTTGGGGTTGG - Intergenic
1160462341 18:79048617-79048639 GAAGGGCTGGGGGCTGCCCTGGG - Intergenic
1160650219 19:220946-220968 GGAGGGATGGGGATTGGGCTGGG - Intergenic
1160651646 19:233959-233981 GACGGGGTGGGGGTGGGGCTAGG - Intergenic
1160892927 19:1388626-1388648 GAAGGGATGGGGGTGGGGCGAGG - Intronic
1161093890 19:2377596-2377618 GAAGGGGTAGGGGTAGGGGAGGG - Intergenic
1161202961 19:3025956-3025978 GAAGGAGAAGGGGGTGGGCTGGG - Intronic
1161256274 19:3311587-3311609 GAGGGGCGAGGGGAAGGGCTGGG - Intergenic
1161293581 19:3508101-3508123 GTGGGGGTAGGGGTTGGGGTGGG + Intronic
1161421992 19:4181084-4181106 GAAGGGCTAGGGCTTTGACAAGG - Intronic
1162148941 19:8631382-8631404 GCAGGGCTGGGGGCTGGGCTTGG + Intergenic
1162408688 19:10491547-10491569 GCAGGGCCTGGGGGTGGGCTCGG - Intronic
1162453713 19:10769745-10769767 GCAGGGCTGGGGGTGGGGGTGGG + Intronic
1162905005 19:13818072-13818094 GCGGGGCTAGGGGCGGGGCTGGG - Intronic
1163033544 19:14559342-14559364 GAGGGGCCAGGGGCTGGGCGGGG - Intronic
1163113910 19:15178085-15178107 GAACGGCTGGGGGTCGGGTTTGG + Exonic
1163454312 19:17397293-17397315 GAAAGGCCAGGGGTTGGGAATGG - Intergenic
1163828063 19:19534928-19534950 GAAGGGATGGGGCTTGGGCCTGG - Intronic
1164560836 19:29291034-29291056 GAAGGACTAGAGATTGGGCGTGG + Intergenic
1164634395 19:29781858-29781880 GAAGGACAAGGGCTTGGGTTGGG + Intergenic
1164753569 19:30673255-30673277 GAAGGGCCAGGCGCTGTGCTTGG - Intronic
1164884134 19:31762341-31762363 TAAGGGTTAGGGGCTGGGCACGG - Intergenic
1165233179 19:34400189-34400211 GAGGGGCTGGGGGTTAGGCTGGG - Exonic
1165326756 19:35118600-35118622 GTAGGGTCAGGGGCTGGGCTGGG + Intronic
1165445799 19:35856296-35856318 GTGGGGAGAGGGGTTGGGCTGGG + Intronic
1165601468 19:37058485-37058507 AAAGGGCAAGGGCTGGGGCTGGG + Intronic
1165767868 19:38362062-38362084 GCAGGGTTTGGGGATGGGCTGGG + Intronic
1165925005 19:39321102-39321124 GCGGGGCTGGGGGTGGGGCTGGG - Intergenic
1165940784 19:39413740-39413762 GGAGGGCGAGGGGCAGGGCTGGG - Intronic
1166072477 19:40395195-40395217 GGAGGGCAAGGGCTGGGGCTGGG - Exonic
1166226001 19:41395746-41395768 GAAGGCCTAGGGCTTGGTCCTGG + Intronic
1166257161 19:41614922-41614944 GAAGGGATAGGGGTGGGGAGGGG + Intronic
1166392902 19:42419723-42419745 GAAGGGCCAGGTGTGGGGCCTGG + Intronic
1166525511 19:43507551-43507573 GAAGGAGGAGGGGCTGGGCTGGG - Intronic
1166525556 19:43507667-43507689 GAGGGAGTAGGGGCTGGGCTGGG - Intronic
1166657599 19:44623523-44623545 GAAGGGCAAGGGGTTGGACTGGG + Intronic
1166681544 19:44770702-44770724 TAAGGTGTAGGGGTGGGGCTAGG + Intergenic
1166701779 19:44886264-44886286 GAAGGGCCAGGGGTCAGGCCTGG + Intronic
1166929966 19:46296614-46296636 GCAGGGCTAGGGGTTTGGAAGGG + Intergenic
1167278112 19:48551108-48551130 GGAGGGCCAGGGTTTGGGGTGGG + Intergenic
1167306993 19:48715104-48715126 GAAGGGCGAAGGGAGGGGCTGGG + Intronic
1167420439 19:49399519-49399541 GAAGGGGTGGGGGTGGTGCTGGG - Intronic
1167717680 19:51154392-51154414 GGAGGGCTTGGGCTTGGACTTGG - Intergenic
1167862233 19:52294550-52294572 TAAGGGATAGGGCTTGGGCAGGG + Exonic
1168246114 19:55113928-55113950 GAATGGGGAGGGGTTGGGCCTGG - Intronic
1168293492 19:55368459-55368481 TAAGGGCAAGGGAGTGGGCTGGG - Intronic
1168378992 19:55904381-55904403 GAAAGGCCTGAGGTTGGGCTGGG - Intronic
1202715170 1_KI270714v1_random:38377-38399 AAAGGGCAAGGGCTTGGTCTGGG - Intergenic
924958257 2:10544-10566 CTAGGGCTAGGGCTAGGGCTAGG - Intergenic
924958259 2:10550-10572 TTAGGGCTAGGGCTAGGGCTAGG - Intergenic
925379642 2:3416459-3416481 GAAGGGGTAGGGGTGTGCCTAGG - Intronic
925950896 2:8910211-8910233 GAAGGGTTGGGGATTGGGTTGGG + Intronic
926142246 2:10374679-10374701 AAAGGGCCTGGGGTTGAGCTGGG + Intronic
927576688 2:24207029-24207051 AAAGAGCTAGGGATGGGGCTGGG + Intronic
927690093 2:25202197-25202219 GAAGGGCCGTGGGGTGGGCTAGG - Intergenic
927777223 2:25911630-25911652 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
927777226 2:25911636-25911658 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
927777229 2:25911642-25911664 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
927862416 2:26568377-26568399 GAAGAGATAGGGGCTGGCCTTGG - Intronic
927971049 2:27306582-27306604 GAGGGGCTTGGGGTGGGGCCTGG + Intronic
928067560 2:28181826-28181848 GAGGGAGTAGGGGTTGGGGTGGG + Intronic
929516448 2:42607066-42607088 GTAGGGGTAGGGGTAGGGGTAGG + Intronic
929516451 2:42607072-42607094 GTAGGGGTAGGGGTAGGGGTAGG + Intronic
932336172 2:70932662-70932684 GAAGGGCATGGGGTTGGGGCAGG - Intronic
933658210 2:84906143-84906165 GCAGGGTGAGGGGCTGGGCTGGG - Intronic
934520629 2:95018094-95018116 GCAGGGCTAGAGGCAGGGCTAGG - Intergenic
934563501 2:95325205-95325227 GAAGGGCTTGGGCTTGGGCCTGG + Intronic
934713946 2:96532452-96532474 GAGGGGCGAGGAGTTGGGCTGGG - Intergenic
934744255 2:96748471-96748493 GAAGGGCTGGGGGCTGGGTGGGG + Intergenic
935173256 2:100627032-100627054 AAAGGGCTACGGATTGGGATTGG + Intergenic
935226582 2:101058175-101058197 GTGGGGTTAGGGGGTGGGCTAGG - Intronic
936569541 2:113602763-113602785 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
936569565 2:113602839-113602861 TAAGGGTTAAGGGTTGGGGTTGG + Intergenic
936569608 2:113602965-113602987 GTAGGGGTAGGGGTAGGGTTGGG - Intergenic
936569637 2:113603033-113603055 GTAGGGTTAGGGTTTGGGTTAGG - Intergenic
936569763 2:113603395-113603417 CTAGGGCTAGGGGTTAGGGTAGG - Intergenic
936569768 2:113603407-113603429 TTAGGGCTAGGGCTAGGGCTAGG - Intergenic
939118596 2:138089371-138089393 GAAGGGGTCGGGGTCGGGGTCGG - Intergenic
940848431 2:158665179-158665201 GAAGGGAGACGGGCTGGGCTGGG + Intronic
941016849 2:160367358-160367380 GAGGGGCCATGGGGTGGGCTGGG + Exonic
941987174 2:171521234-171521256 GAAGGCAGAGGGGTTGGGGTAGG + Intergenic
942428450 2:175883976-175883998 GCAGAGCTAGAGGCTGGGCTCGG - Intergenic
945048250 2:205800483-205800505 GAAGGGCTGGAGATGGGGCTGGG + Intergenic
945097023 2:206229908-206229930 GAAGAGCTGGGGCTGGGGCTGGG + Intergenic
946346880 2:219118158-219118180 GAAGGGCCAGGAGTAGAGCTAGG - Intronic
946353263 2:219169268-219169290 CAAGGGGTAAGGGTGGGGCTGGG - Exonic
946543554 2:220712386-220712408 GAAGGTCTGGGGTATGGGCTAGG + Intergenic
946619468 2:221545589-221545611 TAAGGGGTAGGGGTTTGGCATGG - Intronic
947635828 2:231680489-231680511 GAAGGGGTGGGGCTTGGGCTGGG - Intergenic
947855395 2:233320504-233320526 GAGGGGATAGGGGCTGGGATTGG - Intronic
948164288 2:235849696-235849718 GAAGGGCCAGGCGAGGGGCTGGG - Intronic
948249573 2:236515076-236515098 GCAGAGCTGGAGGTTGGGCTGGG + Intergenic
948808421 2:240462844-240462866 GAAGGGCCAGGGGCTGGGGCTGG + Intronic
948857790 2:240738265-240738287 AGAGTGCCAGGGGTTGGGCTGGG + Intronic
1169338361 20:4776180-4776202 GAAGGGCATGGAGTTTGGCTGGG - Intergenic
1170413557 20:16116070-16116092 GGAGGTCTGGGGGTTTGGCTGGG + Intergenic
1171049734 20:21844451-21844473 GAAGGGGTAGGGGTTGGAGCTGG + Intergenic
1172016737 20:31879997-31880019 GAATGGGTAGGGGTGGGGCGGGG + Intronic
1172641429 20:36442676-36442698 GAAGGACCAGGGCTGGGGCTGGG - Intronic
1172966450 20:38838784-38838806 CAAGGGGTAGGGGCTGGGCAGGG - Intronic
1174787319 20:53444867-53444889 AAGGAGCCAGGGGTTGGGCTGGG - Intronic
1175055934 20:56198128-56198150 GAAGGGGTAGGGGTGGGGATGGG + Intergenic
1175107387 20:56625272-56625294 GAAGGGCGAGGGGTGGCGCTGGG + Intergenic
1175171968 20:57087063-57087085 GAAGGGGTCGGGGTTGGGGTGGG - Intergenic
1175199470 20:57267539-57267561 GAAGCCCTAGTGGTGGGGCTGGG - Intergenic
1175410567 20:58765071-58765093 GAAAGGCAAGGGCTTGGTCTTGG - Intergenic
1175447913 20:59037769-59037791 GCAGGGTCAGGGGGTGGGCTTGG - Intronic
1176140263 20:63541851-63541873 GAAGAGCCAGAGGCTGGGCTGGG + Intronic
1176278269 20:64286717-64286739 TAGGGGTTAGGGGTTGGGGTTGG + Intronic
1178757357 21:35364241-35364263 GAAGGGCTTGGGGCTGGGCATGG - Intronic
1179229599 21:39489444-39489466 GAAGGGCCTGGGCATGGGCTTGG + Intronic
1179656558 21:42849535-42849557 CAAGGGCTACGGCTGGGGCTGGG + Exonic
1179895109 21:44357451-44357473 GAAGGCCTACGTGATGGGCTTGG + Intronic
1180016611 21:45090335-45090357 AAAAGACTAGGGGTAGGGCTGGG - Intronic
1180184813 21:46134322-46134344 TTAGGGTTAGGGGTTGGGGTTGG + Intergenic
1180454406 22:15499927-15499949 TAGGGATTAGGGGTTGGGCTTGG + Intergenic
1181023243 22:20114160-20114182 GGAGGGCTAGGTGTGGGGGTGGG - Intronic
1181029334 22:20142411-20142433 CATGGGCTTGGGCTTGGGCTTGG - Intronic
1181355150 22:22292669-22292691 GCAGGGCTAGGGTCTGGGCCAGG + Intergenic
1181390309 22:22576015-22576037 GAAGGGTCAGGGGTCAGGCTGGG - Intergenic
1181513903 22:23400907-23400929 CATGGGCTTGGGCTTGGGCTAGG + Intergenic
1182358781 22:29734830-29734852 GCAGGGCTGGGGCTGGGGCTGGG - Intronic
1182743016 22:32582550-32582572 GACGGGCTGGGGGTGGGGGTGGG + Intronic
1183302641 22:37065840-37065862 GAAGGGCTGGGTGTGGGCCTGGG + Exonic
1183828862 22:40407631-40407653 AAAGGGGTTGGGGTGGGGCTTGG - Intronic
1183828864 22:40407637-40407659 GCAGGGAAAGGGGTTGGGGTGGG - Intronic
1184110193 22:42389687-42389709 GCTGGGCTGGGGGCTGGGCTGGG + Intronic
1184257352 22:43294814-43294836 TGAGGGCTTGGGGGTGGGCTGGG - Intronic
1184348326 22:43926297-43926319 GGCTGGCCAGGGGTTGGGCTGGG + Intronic
1184453350 22:44595824-44595846 GAACGGCTGGGGGTTGGCCCAGG - Intergenic
1184510947 22:44932815-44932837 GGAGGGCCAGGGGTTGGGGATGG - Intronic
1185314705 22:50174063-50174085 GAAGGGCCAGGGCCTGGCCTCGG + Intronic
1185380364 22:50505022-50505044 GCAGGGCTGGGGGATGGGCTGGG - Intronic
949089326 3:10579-10601 GTAGGGTTAGGGGTAGGGTTGGG - Intergenic
949089392 3:10762-10784 GTAGGGGTAGGGGTAGGGTTAGG - Intergenic
949089394 3:10768-10790 GTAGGGGTAGGGGTAGGGGTAGG - Intergenic
949089397 3:10774-10796 GTAGGGGTAGGGGTAGGGGTAGG - Intergenic
949089403 3:10786-10808 TAAGGGTTAGGGGTAGGGGTAGG - Intergenic
949988910 3:9561077-9561099 GAAGGGCGAGGGGGTGGGAGGGG - Intergenic
950113087 3:10432932-10432954 GCTGGGGTAGGGGATGGGCTGGG + Intronic
950538237 3:13594286-13594308 GATGGGCTGGGGGTGGTGCTGGG + Intronic
950645364 3:14373756-14373778 GAAGGGTTGGGTTTTGGGCTGGG - Intergenic
952845688 3:37686256-37686278 GGAGGGGCAGGGGATGGGCTGGG + Intronic
953338389 3:42113369-42113391 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
953338392 3:42113375-42113397 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
954648223 3:52144253-52144275 GAAGGGCTGGGGCTTGGGGATGG - Intronic
955060475 3:55488321-55488343 GAAGGGCTGGGGGGTGGGAGGGG - Intronic
955063714 3:55516529-55516551 AAAGGGCTGGGGGCTGGGATGGG + Intronic
955502152 3:59595989-59596011 GAAGGGCTAGGGGTTTGGTGGGG + Intergenic
955808522 3:62761850-62761872 CAAGGGCTGGGGGCTGGGATGGG - Intronic
956747430 3:72320787-72320809 CAAGGGATAGGGGTTGGGGAGGG + Intergenic
957054550 3:75433996-75434018 ACAGGGCCAGGGGTTGGGCCAGG + Intergenic
957875329 3:86138902-86138924 GAAGGGCTTGGGGTGGGTGTGGG - Intergenic
960500516 3:118432263-118432285 GAAGGTCCAGGGGTAGGGCCAGG - Intergenic
961001035 3:123374140-123374162 GAGGGGGTAAGGTTTGGGCTGGG + Intronic
961281282 3:125767100-125767122 GAAGGGGCGGGGGTTGCGCTGGG + Intergenic
961708315 3:128807085-128807107 AATGGGCTAGGGGTTGGGGAAGG + Intronic
961819904 3:129570732-129570754 GATGGGCCAGGGGTGGGGCCAGG + Intronic
961831703 3:129626485-129626507 CCAGGGCTAGGGCTGGGGCTGGG + Intergenic
961873091 3:130002482-130002504 GAAGGGGCGGGGGTTGCGCTGGG - Intergenic
961888204 3:130110358-130110380 ACAGGGCCAGGGGTTGGGCCAGG + Intronic
961907229 3:130275544-130275566 GAAGGAGGAGGGGTTGGGGTAGG + Intergenic
963239876 3:142992451-142992473 GAACGGCTTGGAGTTTGGCTGGG - Intronic
964203624 3:154146218-154146240 GAAGGGTTAGGGGTTTCTCTGGG + Intronic
964813815 3:160695077-160695099 CAAGGCCCAGGGGTGGGGCTAGG - Intergenic
964847152 3:161056703-161056725 GAGGGGCTAAGGATTGGGGTAGG - Intronic
965087480 3:164117658-164117680 GATGGGGTGGGGGTTGGGGTTGG - Intergenic
966769385 3:183490874-183490896 AAAGGTCTGGGGGATGGGCTTGG - Exonic
967817978 3:193815296-193815318 GAAGGGAAGGGGGTTGGGCATGG - Intergenic
968364136 3:198172700-198172722 GAAGGGTTAGGGTTAGGGTTGGG + Intergenic
968364153 3:198172749-198172771 TTAGGGCTAGGGCTAGGGCTAGG + Intergenic
968366186 3:198186010-198186032 GACGGGGTGGGGGTGGGGCTAGG + Intergenic
968367627 3:198199183-198199205 GGAGGGATGGGGATTGGGCTGGG + Intergenic
968498432 4:931940-931962 GAAGGGCGTGGGTTAGGGCTGGG - Intronic
968517338 4:1020776-1020798 GCAGGGGAAGGGGTGGGGCTGGG + Intronic
968606511 4:1538108-1538130 GAAGGGCTGGGGATGGGGCTGGG + Intergenic
968655560 4:1777105-1777127 GAAGGGGTATGGGATGGGCTGGG + Intergenic
968790696 4:2659184-2659206 GGAGGGCAAGGGGTCGGCCTCGG - Intronic
968964068 4:3760635-3760657 GAAGGGCTGTGGGTTGAGGTTGG + Intergenic
969057814 4:4413241-4413263 GAGGGCCCAGGGGTTGGGCATGG + Intronic
969202760 4:5618719-5618741 GAAAGCCTGGGGGCTGGGCTGGG + Intronic
969408719 4:7013700-7013722 GAAGTGCCAGGGGTTGGACGAGG + Intronic
969716448 4:8870472-8870494 GAAGAGAGAGGGGTTGGACTGGG + Intronic
969756658 4:9154388-9154410 ACAGGGCCAGGGGTTGGGCCAGG - Intergenic
969937320 4:10695473-10695495 GAAGGGCTTGGAGTTGGCCAGGG - Intergenic
972412238 4:38806819-38806841 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
972412241 4:38806825-38806847 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
972412244 4:38806831-38806853 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
973959716 4:56097546-56097568 GAAGAGGTAGGGATTGGGTTTGG + Intergenic
974145888 4:57946594-57946616 AAATGGCAAGGGGTTGGGGTGGG + Intergenic
976300272 4:83509656-83509678 GAAGGGGTAGGGGCTGGGAGGGG + Intronic
979256042 4:118608895-118608917 GGAGGGATGGGGATTGGGCTGGG + Intergenic
979332302 4:119431642-119431664 GGAGGGATGGGGATTGGGCTGGG - Intergenic
979333731 4:119444846-119444868 GACGGGGTGGGGGTGGGGCTAGG - Intergenic
980515604 4:133854679-133854701 GAAGGACTAGAAGTTGTGCTGGG - Intergenic
982652116 4:158099293-158099315 GTAGGGGTAGGGGTTGGGGGAGG - Intergenic
983899578 4:173119496-173119518 GAATGGCAAGGGGTGGGGTTGGG - Intergenic
985640685 5:1062165-1062187 GAGGGGCTGGGGGTGCGGCTGGG + Intronic
985745170 5:1642699-1642721 CAAGGGCTGGGGGTCAGGCTGGG + Intergenic
986847311 5:11770460-11770482 GAAGGGGTAGGGGTAGGGGAAGG + Intronic
989586024 5:43074409-43074431 GAAGAGGTAGGGGTTGGGAGGGG + Intronic
990168609 5:53021958-53021980 GAAGGGCCAGGGGCAGGGATGGG - Intronic
991764518 5:69960132-69960154 GCAGGGCTAGGAGTTGCTCTGGG - Intergenic
991782806 5:70158015-70158037 GCAGGGCTAGGAGTTGCTCTGGG + Intergenic
991843750 5:70835204-70835226 GCAGGGCTAGGAGTTGCTCTGGG - Intergenic
991875248 5:71158346-71158368 GCAGGGCTAGGAGTTGCTCTGGG + Intergenic
992409742 5:76493474-76493496 GAAGGGCCAGGGTTAGGGCTGGG - Intronic
992484409 5:77181056-77181078 GTAGGGGTAGGGGTAGGGGTGGG - Intergenic
993498160 5:88631836-88631858 GAAAGGGTAGGAATTGGGCTGGG - Intergenic
994218181 5:97162401-97162423 GAAGAGTTAGGGGTTGGGGAAGG - Exonic
995294268 5:110500746-110500768 CAAGGTCTAAGGGTTAGGCTAGG + Intronic
997796876 5:136819427-136819449 GATGTGCTAGGTGCTGGGCTAGG + Intergenic
997976707 5:138445382-138445404 GCAGGGCCCGGGGTTGGGGTGGG + Intronic
998039900 5:138945334-138945356 GGAGGACTTGGGGCTGGGCTGGG - Intergenic
998137609 5:139682338-139682360 GAAGGGCTGGGGCTGGGGCTGGG - Intronic
998504972 5:142665288-142665310 GAAGGGCAAGGGGGTGGACGAGG - Intronic
998679031 5:144444190-144444212 GAGGGGGGAGGGGTTGGGGTGGG - Intronic
999656008 5:153811267-153811289 GAAGGGTTTGGGATGGGGCTGGG - Exonic
1000203460 5:159034714-159034736 GCAGGGCAAGGGGTGGGGCTTGG - Intronic
1000241478 5:159412520-159412542 GATGTGCTTGGGGTAGGGCTGGG - Intergenic
1000535258 5:162470967-162470989 TAATGGATAGGGTTTGGGCTGGG - Intergenic
1000685608 5:164245369-164245391 GAAAGGCCAGGGGGTAGGCTTGG - Intergenic
1001104555 5:168842109-168842131 GAAGGTCTAGGGGTGGGGAGGGG + Intronic
1001206552 5:169768876-169768898 GCATGGCTAGGGGTTGAGGTAGG - Intronic
1001298453 5:170515901-170515923 AAAGAGCTAGGGGTTGGCCCAGG + Intronic
1002080960 5:176737140-176737162 GAAGGGGTAGGGGGAGGGTTGGG + Intergenic
1002461967 5:179378376-179378398 GCAGGGATAGGAGTTGGGGTGGG - Intergenic
1002593541 5:180307083-180307105 GGAGGGCAGGGCGTTGGGCTTGG - Intronic
1002725412 5:181291235-181291257 GACGGGGTGGGGGTGGGGCTAGG + Intergenic
1002726850 5:181304412-181304434 GGAGGGATGGGGATTGGGCTGGG + Intergenic
1003297313 6:4843131-4843153 AAGGGACTAGGGGTTGGGGTGGG - Intronic
1003486264 6:6582287-6582309 GCAGAGCCAGGGGTTGGGCAGGG + Intergenic
1005039528 6:21588492-21588514 CAAGGGCCAGGGGATGGGGTAGG + Intergenic
1005830915 6:29670528-29670550 GAAGAGCCTGGGGTTGGGCATGG - Intronic
1005887417 6:30107357-30107379 GGGGGGCTGGGGGTTGGGGTGGG + Intronic
1005967205 6:30735170-30735192 GAGGGGGTTGGGGTTGGGGTTGG + Intronic
1005997972 6:30942992-30943014 GGAGGGCTTGAGGCTGGGCTCGG + Intronic
1006083555 6:31581131-31581153 GAAGGGGCAGGGGCTAGGCTGGG - Exonic
1006232611 6:32596800-32596822 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1006340180 6:33442617-33442639 GAAGGGATGGGGGCAGGGCTGGG - Intronic
1006460326 6:34154297-34154319 GAGGGCCCAGGGGCTGGGCTGGG - Intronic
1006645472 6:35512026-35512048 GGAGGGATTGGGGTTGGGGTTGG - Intronic
1006809213 6:36809158-36809180 GGAGGGATAGAGGTTGGGCAGGG - Intronic
1006914445 6:37585351-37585373 GCAGGGCTGGGGGCAGGGCTGGG - Intergenic
1007125599 6:39423172-39423194 GCAGGGGCAGGGGCTGGGCTTGG + Intronic
1007255270 6:40523969-40523991 GAAGGGCAGGGGGAGGGGCTGGG + Intronic
1007255281 6:40523991-40524013 GAAGGGCAGGGGGAGGGGCTGGG + Intronic
1007408049 6:41646121-41646143 GGAGGGATAGGGTCTGGGCTAGG - Exonic
1009421801 6:63472198-63472220 GAAGGGCCAGAGTTTGGGATGGG - Intergenic
1010029256 6:71256155-71256177 ACAGGGATAGGGGTGGGGCTGGG + Intergenic
1010745068 6:79551593-79551615 GAAGGAGGAGGGGTTGGGGTAGG + Intergenic
1015363770 6:132373675-132373697 AAAGGGCTATGGGTTGGGGAGGG + Intronic
1016721804 6:147306787-147306809 GAAGGGATGGCAGTTGGGCTGGG - Intronic
1019251662 7:16904-16926 TTAGGGCTAGGGCTAGGGCTAGG - Intergenic
1019251684 7:16966-16988 GAAGGGTTAGGGTTAGGGTTAGG - Intergenic
1019486310 7:1291017-1291039 GAAAGGCTCGGGGTGGGGGTGGG - Intergenic
1019518778 7:1451290-1451312 GGAGGGCCTGGGGCTGGGCTGGG - Intronic
1019635372 7:2072763-2072785 GAAGGGTAAGGGGCTGCGCTGGG + Intronic
1020084207 7:5301852-5301874 GGAGGGGTTGGGGTTGGGTTTGG + Intronic
1020240752 7:6393077-6393099 GGAGGGATTGGGGTTGGGGTTGG + Intronic
1020255766 7:6502508-6502530 CAAAGGCTGGGGATTGGGCTGGG - Intronic
1022231270 7:28415247-28415269 GTAGGGCTAGGGGAGGGCCTCGG + Intronic
1022800242 7:33769947-33769969 GAATGGCTAGGGATGGGGTTGGG + Intergenic
1023241920 7:38157719-38157741 AAAGGAATAGGGGTTGGGGTAGG + Intergenic
1024070314 7:45778837-45778859 GACGGGGTGGGGGTGGGGCTAGG + Intergenic
1024071743 7:45792025-45792047 GGAGGGATGGGGATTGGGCTGGG + Intergenic
1024112970 7:46164984-46165006 CAATGGTTAGGGGTTGGGCTGGG + Intergenic
1024353749 7:48393997-48394019 GAACAGCTGGGGGTTGGGTTTGG - Intronic
1024549765 7:50552952-50552974 GGAGGGCTAGATGTTGGGCAGGG - Intronic
1024919833 7:54545158-54545180 GAAGGGAGAGGGGGTGGGGTGGG - Intronic
1024939561 7:54747601-54747623 GAATGGCTAGGAGTTTGGTTTGG - Intergenic
1025210078 7:57015344-57015366 GGAGGGGTTGGGGTTGGGTTTGG - Intergenic
1025661873 7:63561507-63561529 GGAGGGGTTGGGGTTGGGTTTGG + Intergenic
1025899127 7:65729686-65729708 GTAGGGCTGGGGGTTGGGACGGG + Intergenic
1026545260 7:71316688-71316710 GAAGGGCTTGGCTTTGGCCTGGG + Intronic
1028895717 7:96039683-96039705 GATGGGGTTGGGGTTGGGGTAGG - Intronic
1029747301 7:102523298-102523320 GCAGGGCTGGGGGCTGTGCTAGG - Intergenic
1029765254 7:102622388-102622410 GCAGGGCTGGGGGCTGTGCTAGG - Intronic
1032047720 7:128623138-128623160 GACGGGGTGGGGGTGGGGCTAGG + Intergenic
1032048360 7:128629631-128629653 GGAGGGATGGGGATTGGGCTGGG + Intergenic
1032578552 7:133081814-133081836 GGAGGGCCAGTGGTTGGACTCGG - Intronic
1033037569 7:137889044-137889066 CAAGGGGTAGGGGATGGGCAGGG - Intronic
1033349419 7:140550121-140550143 GAGGGGATAGGGGTGGGGTTAGG + Intronic
1034348849 7:150403789-150403811 GATGGGGTGGGGGTTGGGGTAGG + Intronic
1034410416 7:150938484-150938506 GCAGGTCTGAGGGTTGGGCTGGG - Intergenic
1034433135 7:151050848-151050870 GGAGGGCTGGGGCTGGGGCTGGG - Exonic
1035203862 7:157282170-157282192 GCAGGGCTAGGGCTAGGGCTGGG + Intergenic
1035514403 8:220449-220471 GTAGGGGTAGGGGTAGGGTTAGG - Intergenic
1036379894 8:8229696-8229718 ACAGGGCCAGGGGTTGGGCCAGG - Intergenic
1036642486 8:10593016-10593038 GAGGTGCTGGGGGCTGGGCTCGG - Intergenic
1036770086 8:11572657-11572679 GAAGGGCTAGGGGTCCATCTAGG + Intergenic
1036849667 8:12192957-12192979 ACAGGGCCAGGGGTTGGGCCAGG + Intronic
1036871031 8:12435230-12435252 ACAGGGCCAGGGGTTGGGCCAGG + Intronic
1038047444 8:23777693-23777715 GAAGGCCCAGGGTTTGGGATGGG + Intergenic
1038266818 8:26044413-26044435 GCAGGACTAGGGGCTGAGCTGGG + Intronic
1040301687 8:46191296-46191318 GAAAGGCCAGAGGGTGGGCTGGG + Intergenic
1041796847 8:61754088-61754110 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796850 8:61754094-61754116 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796853 8:61754100-61754122 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796856 8:61754106-61754128 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796859 8:61754112-61754134 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1041796862 8:61754118-61754140 GTAGGGGTAGGGGTAGGGGTAGG + Intergenic
1043402210 8:79894916-79894938 CAAAGGCTAGGGGTAGGGATAGG - Intergenic
1043452153 8:80378670-80378692 TAAGGGGTAGGAGTGGGGCTTGG - Intergenic
1043463742 8:80486117-80486139 GCTGGGCTTGGGGCTGGGCTGGG - Intronic
1044750712 8:95412866-95412888 GAAAGAGGAGGGGTTGGGCTGGG - Intergenic
1045065426 8:98439753-98439775 GAAGGGCTCAGGTTTGGGTTTGG - Intronic
1047199741 8:122755122-122755144 GAAGGGATGGGGGTTGGCGTGGG + Intergenic
1047520901 8:125594651-125594673 CAAGGGCTGGGAGGTGGGCTGGG - Intergenic
1047521589 8:125599202-125599224 GAAGGGGTAGGGGCAGGGCCAGG + Intergenic
1048018642 8:130519348-130519370 GCAGGGCCATGGGGTGGGCTGGG + Intergenic
1048577792 8:135706562-135706584 GAAGGAGCAGGGGTTGGGCTGGG - Intergenic
1048883209 8:138887176-138887198 GAGGGGCTAGGGGTGGGGAGAGG - Intronic
1049205619 8:141362164-141362186 GAACAGCTTGGGGTTGGGCCTGG - Intronic
1049217071 8:141413132-141413154 GAAGGGGTAGGGGCTGTGCCTGG + Intronic
1049716892 8:144097169-144097191 GAAGGGCTGGGAGCTGGGCAGGG + Intronic
1049808366 8:144551680-144551702 GAAGGGCCAGGTGATGGGGTTGG - Intronic
1051007726 9:12367801-12367823 AAAGGGCCCGGGGTTGGACTGGG + Intergenic
1051370522 9:16355304-16355326 GCATGGCTAGGGCTTGGGCAGGG - Intergenic
1052068123 9:24048212-24048234 GGAGGGCTGGAGGTTGGGGTTGG + Intergenic
1052589941 9:30479112-30479134 GTAGGGTTAGGGTTAGGGCTAGG - Intergenic
1052787855 9:32846354-32846376 GAACTGCTTGGGGTAGGGCTGGG + Intergenic
1053129827 9:35608609-35608631 AAAAGGCTGGGGGTCGGGCTGGG + Intronic
1053283019 9:36833568-36833590 GCAGGGCTAGGGGTGGGACTTGG - Exonic
1053393447 9:37752161-37752183 GTAGGGGTAGGGGTAGGGGTAGG - Intronic
1053691576 9:40589718-40589740 GCAGGGCTAGGGTCTGGGCCAGG - Intergenic
1054273226 9:63047767-63047789 GCAGGGCTAGGGTCTGGGCCAGG + Intergenic
1054302832 9:63390684-63390706 GCAGGGCTAGGGTCTGGGCCAGG - Intergenic
1054401613 9:64717200-64717222 GCAGGGCTAGGGTCTGGGCCAGG - Intergenic
1054435216 9:65201509-65201531 GCAGGGCTAGGGTCTGGGCCAGG - Intergenic
1054495174 9:65820172-65820194 GCAGGGCTAGGGTCTGGGCCAGG + Intergenic
1056965140 9:91159244-91159266 GAAGGGGAAGGGGTGGGGCAGGG + Intergenic
1057299713 9:93870797-93870819 GAAGGCCTGAGGGTTTGGCTGGG - Intergenic
1057506315 9:95636297-95636319 GAAGGGCAAGGAGGTGGTCTTGG - Intergenic
1057851691 9:98571222-98571244 GAAGGGGCAGGAGGTGGGCTGGG + Intronic
1059391606 9:114002693-114002715 GAGGGGCGAGGGCTTGGGGTGGG + Intronic
1060703366 9:125779075-125779097 CAAGGGCTAGGGGTGGGGGATGG - Intronic
1060984079 9:127809842-127809864 GCAGGGCTGGGGGTGGGGCCGGG + Intronic
1061487791 9:130929040-130929062 GACAGGCTAGGGGTCTGGCTGGG + Intronic
1061579287 9:131527014-131527036 GAACGGCTCTGGGTGGGGCTGGG + Intronic
1061828165 9:133274742-133274764 GAAGGGCTGGGGGGCGGGCAGGG + Intronic
1062243816 9:135553129-135553151 GAGGGGCTCGGGGGTGGGCCAGG - Intergenic
1062273802 9:135721393-135721415 GAAGGGCCAGGGGCAGGACTGGG - Intronic
1062586550 9:137252294-137252316 GGAGGGCTAGGGCTGGGGCATGG + Intronic
1062597816 9:137306966-137306988 GCCGGGCTGGGGGCTGGGCTCGG + Exonic
1062734720 9:138129191-138129213 TTAGGGCTAGGGTTTGGGTTAGG + Intergenic
1062739401 9:138159903-138159925 TAAGGGTTAAGGGTTGGGGTTGG + Intergenic
1062748828 9:138236647-138236669 GAAGGGTTAGGGTTAGGGTTAGG + Intergenic
1062748850 9:138236709-138236731 TTAGGGCTAGGGCTAGGGCTAGG + Intergenic
1062750554 9:138248876-138248898 GACGGGGTGGGGGTGGGGCTAGG + Intergenic
1062751968 9:138261888-138261910 GGAGGGATGGGGATTGGGCTGGG + Intergenic
1185672778 X:1825564-1825586 CAAGTGTTAGGGGTGGGGCTGGG - Intergenic
1185672968 X:1826434-1826456 CAAGTGTTAGGGGTGGGGCTGGG - Intergenic
1185673034 X:1826721-1826743 CAAGTGTTAGGGGTGGGGCTGGG - Intergenic
1186251952 X:7677935-7677957 CTAGGGCTAGGGCTAGGGCTGGG + Intergenic
1186329737 X:8519338-8519360 GGAGGGCTAGGGGTGGGTCCAGG - Intergenic
1186765742 X:12769045-12769067 GAAGGGATAGGAGTTGGGGAAGG + Intergenic
1187497135 X:19804867-19804889 GGGGGGGTAGGGTTTGGGCTGGG - Intronic
1188621280 X:32227555-32227577 GAAGGGCGAGAGGGTGGGATGGG + Intronic
1188688388 X:33098487-33098509 GAAGGGCTTGGGTTTGCCCTAGG - Intronic
1189022051 X:37350800-37350822 GCAGGGGTGGGGGTTGGGCGGGG - Intronic
1190333092 X:49247782-49247804 GAGGGGCTGCGCGTTGGGCTAGG + Intronic
1190474454 X:50813418-50813440 GCAGGGCTAGGGGCTGGTGTGGG - Intronic
1196031702 X:111099694-111099716 GGAGGGCTAGGGCCTGGTCTGGG + Intronic
1197253525 X:124238886-124238908 GCAGGGATAGAGGTTGGGATAGG + Intronic
1198447746 X:136735346-136735368 GAAGTGGTAGGGGTCGGGGTGGG - Intronic
1198582567 X:138082118-138082140 GGAGGTGTAGGGGTTGGGATGGG + Intergenic
1199938299 X:152599399-152599421 GTAGGGGCAGGGGTTGGGGTAGG - Intergenic
1200040447 X:153362269-153362291 GAAGGAGGAGGGGTTGGGCTAGG - Intergenic
1200402930 X:156029977-156029999 GTAGGGGTAGGGGTGGGGTTGGG + Intergenic