ID: 903543489

View in Genome Browser
Species Human (GRCh38)
Location 1:24109788-24109810
Sequence GATCAGAAGGGCTAGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 225}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903543489_903543506 30 Left 903543489 1:24109788-24109810 CCCAACCCCTAGCCCTTCTGATC 0: 1
1: 0
2: 1
3: 19
4: 225
Right 903543506 1:24109841-24109863 CGTGGCAGAGGCTGGGGACACGG 0: 1
1: 0
2: 2
3: 60
4: 593
903543489_903543504 24 Left 903543489 1:24109788-24109810 CCCAACCCCTAGCCCTTCTGATC 0: 1
1: 0
2: 1
3: 19
4: 225
Right 903543504 1:24109835-24109857 CCAGGCCGTGGCAGAGGCTGGGG 0: 1
1: 0
2: 8
3: 88
4: 735
903543489_903543500 18 Left 903543489 1:24109788-24109810 CCCAACCCCTAGCCCTTCTGATC 0: 1
1: 0
2: 1
3: 19
4: 225
Right 903543500 1:24109829-24109851 TCAAGGCCAGGCCGTGGCAGAGG 0: 1
1: 0
2: 1
3: 16
4: 247
903543489_903543498 12 Left 903543489 1:24109788-24109810 CCCAACCCCTAGCCCTTCTGATC 0: 1
1: 0
2: 1
3: 19
4: 225
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543489_903543497 6 Left 903543489 1:24109788-24109810 CCCAACCCCTAGCCCTTCTGATC 0: 1
1: 0
2: 1
3: 19
4: 225
Right 903543497 1:24109817-24109839 TCATATGTCCATTCAAGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 149
903543489_903543502 23 Left 903543489 1:24109788-24109810 CCCAACCCCTAGCCCTTCTGATC 0: 1
1: 0
2: 1
3: 19
4: 225
Right 903543502 1:24109834-24109856 GCCAGGCCGTGGCAGAGGCTGGG 0: 1
1: 0
2: 1
3: 48
4: 490
903543489_903543496 1 Left 903543489 1:24109788-24109810 CCCAACCCCTAGCCCTTCTGATC 0: 1
1: 0
2: 1
3: 19
4: 225
Right 903543496 1:24109812-24109834 CTATGTCATATGTCCATTCAAGG 0: 1
1: 0
2: 0
3: 13
4: 138
903543489_903543501 22 Left 903543489 1:24109788-24109810 CCCAACCCCTAGCCCTTCTGATC 0: 1
1: 0
2: 1
3: 19
4: 225
Right 903543501 1:24109833-24109855 GGCCAGGCCGTGGCAGAGGCTGG 0: 1
1: 1
2: 0
3: 72
4: 679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903543489 Original CRISPR GATCAGAAGGGCTAGGGGTT GGG (reversed) Intronic
900701467 1:4051127-4051149 GATCAGAAAGGATCGAGGTTTGG + Intergenic
902517352 1:16996551-16996573 GGTCGGGAGGGCTAGGGGTGGGG - Intronic
903543489 1:24109788-24109810 GATCAGAAGGGCTAGGGGTTGGG - Intronic
903637187 1:24829308-24829330 AAATAGAAGGGCTAGTGGTTAGG + Intronic
903789946 1:25886023-25886045 GATCAGAATGTCTGGGGGTGGGG - Intronic
904214791 1:28910834-28910856 GAACACAAGGGGTAGGGGGTGGG + Intronic
904874999 1:33647382-33647404 GGTCAGAATAGCTAAGGGTTAGG - Intronic
910183159 1:84506707-84506729 GGTCAGCGGGGCTGGGGGTTGGG - Intergenic
912877786 1:113379801-113379823 TATAAGGAGGGTTAGGGGTTGGG + Intergenic
913231381 1:116743195-116743217 GGTCCAAAGGGCTAGGGATTAGG + Intergenic
914223306 1:145699514-145699536 GATAAGAGGAGCTAGGAGTTTGG + Intronic
916054196 1:161056550-161056572 GGTCAGGAGTGGTAGGGGTTGGG + Intronic
916296091 1:163222130-163222152 GATCAGGCGGCCTGGGGGTTGGG - Intronic
917225570 1:172778129-172778151 GAGGAGAAGGGCTAGGGGTGGGG - Intergenic
917735890 1:177919989-177920011 GATCAGAAGGTGAGGGGGTTTGG + Intergenic
917790998 1:178498792-178498814 GGTGAGAAGGGGTAGGGGGTAGG - Intergenic
917835780 1:178940589-178940611 AATCAGAATCGCTGGGGGTTGGG - Intergenic
917924282 1:179775993-179776015 GATCAGATGGGGTGGGGGTTGGG + Intronic
919296574 1:195709361-195709383 GATCTGAAGAGCAAGGGGTTTGG - Intergenic
919640150 1:200038969-200038991 GGTAAGTAGGGCCAGGGGTTGGG - Intronic
919835289 1:201569093-201569115 GAACAGAAGTTCTAGGGGCTGGG - Intergenic
920004773 1:202825110-202825132 TGTCAGAAGGGTTAGGGGTTGGG - Intronic
920050584 1:203162360-203162382 GGTCAGAAGGGTGAGGGGTGAGG + Intronic
920194949 1:204220612-204220634 GATCAAAAAGGCAAGGGGTATGG + Exonic
920505617 1:206513418-206513440 CCTCAGAAGGGCTGGGGGTGGGG - Intronic
922892409 1:229072189-229072211 GATCTGAGGTGCTGGGGGTTAGG + Intergenic
923326020 1:232880910-232880932 GATCTCAGGGGCTCGGGGTTTGG - Intergenic
923345955 1:233052921-233052943 AATCAGAAGGGCTAGCTGTTAGG - Intronic
1063042575 10:2358436-2358458 CTTCAGAGGGGCTGGGGGTTAGG + Intergenic
1064123325 10:12638158-12638180 AATGAAAAGGGCTAGGGGGTGGG + Intronic
1066323141 10:34325626-34325648 GTTCCTAAGGGCTCGGGGTTGGG - Intronic
1066638255 10:37529189-37529211 AATCAGATGGGCTTGGGTTTTGG - Intergenic
1067803530 10:49376955-49376977 GATCTGGAGGGCTAGGGGGTGGG - Intronic
1069954603 10:72042472-72042494 GCTTAGAAGGGCTTGGCGTTTGG - Intergenic
1072397964 10:95064559-95064581 CATCAGAAGTGCAAGGGGTCAGG - Intronic
1072465746 10:95660771-95660793 GATCAGAATCTCTAGGGGTAGGG + Intergenic
1073686555 10:105760676-105760698 GATCAGAATCTCTAGGGGTTGGG + Intergenic
1073859395 10:107720281-107720303 GATCAAAAGCGCTAGAGGTCTGG - Intergenic
1074559431 10:114521911-114521933 GAGAAGATGGCCTAGGGGTTGGG + Intronic
1075017551 10:118921339-118921361 AATCAGTAAGTCTAGGGGTTGGG - Intergenic
1075562056 10:123475021-123475043 GGGCAGCAGGGATAGGGGTTTGG + Intergenic
1077852326 11:6085239-6085261 GATGAGAAGCCCTAGGGGATGGG + Intergenic
1078194634 11:9125288-9125310 GATCAGCAGGGCTGGAGGTTGGG + Intronic
1080821112 11:35807420-35807442 GATCTGAAGGTCTATGGGTGGGG - Exonic
1081612853 11:44573496-44573518 GTTCAGAAAGGCCAGGGGTCAGG - Intronic
1081793613 11:45805247-45805269 GGTCAGAGGGGCTCGGGGCTTGG - Exonic
1083055981 11:59820228-59820250 ATTCTGAAGTGCTAGGGGTTAGG + Intergenic
1083443897 11:62694499-62694521 GATCAGAATGGGTAGGGGGCTGG - Intronic
1085018041 11:73188230-73188252 GCTCTGAAGGGCTTGGGGCTGGG + Intergenic
1085309026 11:75505342-75505364 GATCTGGAGGGCTGGGGGTGGGG - Intronic
1085465166 11:76718133-76718155 GATCAGAAGGGGAAAGTGTTGGG - Intergenic
1086009819 11:82087552-82087574 GACGAGAAGGGCAAGGGGTATGG + Intergenic
1088553925 11:111042507-111042529 GATCAGAAGGGCCAGTGATGAGG + Intergenic
1088704947 11:112453764-112453786 TATCATAATGGCTAGGAGTTTGG - Intergenic
1089059531 11:115615082-115615104 GATTAGAAGGAATATGGGTTTGG - Intergenic
1090484765 11:127103053-127103075 GATCACTAGGGCCTGGGGTTTGG + Intergenic
1090508744 11:127348696-127348718 GCTCAGAAGGGCTCTGGGATTGG + Intergenic
1091408144 12:221557-221579 GAGCAGAAGAGAAAGGGGTTGGG + Intronic
1092507391 12:9117604-9117626 GGACAGAAGGGCTGAGGGTTGGG + Intergenic
1093143699 12:15539148-15539170 AATCAGAAGGGTGAGGGGGTGGG + Intronic
1099165946 12:79307603-79307625 GGTCGGAAGGGCTGGGGGTGGGG + Intronic
1100993726 12:100279413-100279435 GATCTGGCGGCCTAGGGGTTGGG + Intronic
1101323974 12:103698373-103698395 GGTAAGAAGGGTTAGTGGTTGGG + Intronic
1101489312 12:105196996-105197018 GAACAGCAGGGGTAGGGGTGGGG - Intronic
1101686697 12:107030915-107030937 ACTCAGAAGAGCTGGGGGTTGGG + Intronic
1102378825 12:112446033-112446055 GATCAGAGGGACTGGGGGCTAGG - Intronic
1102419657 12:112793770-112793792 GATCAGAATGGCTAGGGTCCTGG + Intronic
1103253889 12:119523659-119523681 GATAAGAAGGGCTTGGGGAATGG - Intronic
1103463461 12:121123304-121123326 GAGCTGAAGGGCCAGGAGTTCGG - Intergenic
1103983931 12:124754863-124754885 GATCAGCAGTGCCAGGGGTCCGG + Intergenic
1104468926 12:129012960-129012982 GATCACAAGGGCCAGAGGTAAGG - Intergenic
1104478062 12:129086396-129086418 GTTCAGAAGGGTTGGAGGTTAGG - Intronic
1106699320 13:32211901-32211923 AATCAGAAGTGCTAGGTGCTTGG + Intronic
1108951944 13:56105261-56105283 TATCAGGAGGGCTAGGATTTTGG + Intergenic
1112253550 13:97806697-97806719 CATCAGAAGTGCCAGGGATTCGG + Intergenic
1113441230 13:110330280-110330302 GATTAGAAGGGGTAAGGTTTCGG + Intronic
1113575138 13:111390045-111390067 GAGCAGAAGGGCTACGGGGCAGG - Intergenic
1114555894 14:23562175-23562197 GAACCTAAGGGCTAGGGGGTAGG + Intronic
1116900078 14:50353473-50353495 GATGGGAAGGGCTGGGGGTCTGG + Intronic
1118239432 14:64042357-64042379 GATGAAAAGGGATAGAGGTTGGG + Intronic
1118262145 14:64257732-64257754 GATCAGAAGGGGTGGGGGATGGG + Intronic
1119537420 14:75413844-75413866 GGTCAGAAGGGCCAGATGTTTGG + Intergenic
1121245426 14:92458342-92458364 GACCAGAAGGCCGAGGGGATTGG + Intronic
1122278099 14:100605502-100605524 GAGCAGAGGGGCTGGGGGCTGGG + Intergenic
1122380499 14:101301219-101301241 GACCAGAGGGGGTAGGAGTTTGG - Intergenic
1125128549 15:36253934-36253956 GAAAAAAAGGGTTAGGGGTTGGG + Intergenic
1125447344 15:39772208-39772230 GAGCAGAAGAGCAGGGGGTTAGG - Intronic
1126679281 15:51188051-51188073 GAACAGAATGGCAAGGGCTTCGG - Intergenic
1127423338 15:58830534-58830556 GATCAGAAGGGTTTTGGGTGTGG - Intronic
1127893977 15:63278207-63278229 AATCAGAATGTCTAGGGGATGGG + Intronic
1130123045 15:81068783-81068805 GATCAGTAGGGCTAGAGGAGAGG - Intronic
1131622519 15:94082726-94082748 GATTAGAAGGGTCAGGGGTTTGG - Intergenic
1132987634 16:2776413-2776435 AGTCAGAATGGCTTGGGGTTTGG - Intronic
1133290055 16:4714390-4714412 GATGAGGAGGGCTGGGGGCTGGG + Intronic
1133710561 16:8397346-8397368 GATCAGAACGGCTGGGGCTGAGG + Intergenic
1133847423 16:9468309-9468331 GATAAGAAGTGCTTGGGCTTGGG - Intergenic
1134641378 16:15831951-15831973 GATCAGAAGGGCTAATGCTTGGG + Intronic
1135867836 16:26121002-26121024 GATCAAAAGGCTTAGTGGTTAGG - Intronic
1137278188 16:46951400-46951422 AATCAGGAGGGCTTGGGGCTAGG + Intergenic
1138448315 16:57078245-57078267 GCTGAGAAGGGGCAGGGGTTTGG - Intronic
1139511824 16:67432121-67432143 GACCAGGAGGGCTTGGGGGTGGG - Intronic
1139930041 16:70519061-70519083 AATCAGAAAGTCTAGGGGTGGGG - Intronic
1140692132 16:77494644-77494666 ATTCAGAAGTGCCAGGGGTTAGG + Intergenic
1141356142 16:83348519-83348541 GCTCAGAAGGGCCTGGGGCTTGG + Intronic
1141426908 16:83950017-83950039 GATCAGAAGAGCCCGGAGTTTGG - Intronic
1141740403 16:85887939-85887961 GATAAGAGGGTGTAGGGGTTTGG - Intergenic
1142891448 17:2946727-2946749 AATCAGAAGCTCTAGGGGTGGGG + Intronic
1143012849 17:3875793-3875815 GAACAGAAGGGCTCAGGGTGGGG - Intronic
1143584872 17:7846050-7846072 GAGCAGAAGGGGTGGGGGTGTGG - Intronic
1144797725 17:17903797-17903819 AATCAGGAGGGGAAGGGGTTAGG + Intronic
1148596900 17:48863908-48863930 GATCAAAAGGGCTATGGGAAGGG + Intronic
1152940593 17:83170741-83170763 GACTAGAAGGGCCTGGGGTTCGG + Intergenic
1154021008 18:10663955-10663977 GATCCGAAAGGCTAAGGGGTTGG - Intergenic
1156153779 18:34276609-34276631 AATCAGAACTTCTAGGGGTTGGG + Intergenic
1156206270 18:34889333-34889355 AATCAGAAGCTCTGGGGGTTGGG + Intronic
1156460056 18:37316567-37316589 GAACACAAGGCCAAGGGGTTGGG - Intronic
1157334668 18:46729194-46729216 GATGAGAAGGTGTAGGGGGTTGG - Intronic
1159900232 18:74038519-74038541 GAACAGAAGGGCAAGGTGTGTGG + Intergenic
1160768724 19:821197-821219 GGTCAGAGGGGCTGGGGGTCGGG - Intronic
1161156777 19:2735901-2735923 GAAAAGCAGGGCCAGGGGTTGGG + Intronic
1162146747 19:8617125-8617147 CAGCAGATGGGCTAAGGGTTAGG - Intergenic
1162545120 19:11324583-11324605 GAGCCGGAGTGCTAGGGGTTGGG + Exonic
1162925654 19:13929650-13929672 CATCCGACGGGGTAGGGGTTTGG + Exonic
1163823743 19:19511242-19511264 AACCAGAGGGGCTAGGGGCTAGG + Intergenic
1164399499 19:27892864-27892886 GATCAGAAGGTCCAGGAGTCTGG - Intergenic
1166046407 19:40233297-40233319 GAGCTGCAGGGCTGGGGGTTAGG - Exonic
1166122564 19:40694211-40694233 GAGCAGACGGGCTAGAAGTTGGG - Intronic
1167795332 19:51704768-51704790 GGTCTGAAGGAGTAGGGGTTTGG - Intergenic
1167800694 19:51739450-51739472 GTTCTGAGGGGCTGGGGGTTAGG + Intergenic
1168142013 19:54394497-54394519 GATCAGAGCTGCCAGGGGTTGGG - Intergenic
1168294746 19:55373165-55373187 GGTCTGAAGGGGAAGGGGTTGGG - Intergenic
926320243 2:11744337-11744359 GATCAAAAGCGCCAGGGCTTTGG + Intronic
926681288 2:15665827-15665849 GCTGAGAAGGGCTAGGGGGCAGG + Intergenic
927943643 2:27121571-27121593 GATCAGAAGGGTTGGGGGTGAGG + Intergenic
930482362 2:51965091-51965113 GTACAAAAGGGCTATGGGTTTGG + Intergenic
931184469 2:59936807-59936829 GGTCAGAAGGGGTAGCTGTTAGG - Intergenic
936388744 2:112054429-112054451 GACGAGAAGGGCTTGGGGTTAGG - Intergenic
936620408 2:114090487-114090509 GATCAGCAGGGAAGGGGGTTTGG + Intergenic
939781218 2:146450430-146450452 GATCAAAAGGGTTATGGTTTAGG - Intergenic
942589816 2:177530591-177530613 GAGTAAAAGGGCCAGGGGTTGGG + Intronic
943686005 2:190819056-190819078 GTTCAGAAGTACTAGGGGTTAGG - Intergenic
943924281 2:193751998-193752020 ACTCAGAAGGGTGAGGGGTTGGG - Intergenic
944612233 2:201422826-201422848 GATCTGAAAGTCTAGGTGTTAGG - Intronic
945018460 2:205546128-205546150 TATCAGGAGGGCTTGGTGTTTGG - Intronic
946456484 2:219830706-219830728 GGTCAGAAGGTCTGGGGGTGGGG + Intergenic
947128718 2:226898775-226898797 GATCAGAAGCTCTGGGGTTTGGG - Intronic
947779279 2:232742862-232742884 GATGAGTAGGGTTAGGGTTTTGG + Intronic
948806237 2:240454419-240454441 GAGCAGATGGGCCAGGGGCTGGG + Intronic
948808419 2:240462839-240462861 GATGGGAAGGGCCAGGGGCTGGG + Intronic
949027217 2:241771909-241771931 AAGCAGAAGGGCAAGTGGTTGGG + Intergenic
1169618888 20:7481869-7481891 GATCTGAAGGAGTAAGGGTTAGG + Intergenic
1170872003 20:20214524-20214546 CAACAGAAGGGCTTGGGGTGGGG - Intronic
1171872249 20:30537847-30537869 GATGGGAAGCGCTTGGGGTTTGG + Intergenic
1175055932 20:56198123-56198145 GCTCTGAAGGGGTAGGGGTGGGG + Intergenic
1177010489 21:15726038-15726060 ATTCTGAAGTGCTAGGGGTTAGG - Intergenic
1177802643 21:25842928-25842950 GTACAGAAGGGCTTGGGTTTGGG + Intergenic
1181436053 22:22911582-22911604 GATCAGATGGGCTTAGGGTGAGG + Intergenic
1183535395 22:38398161-38398183 ATTCAGAAGGGCTTGGGGTGCGG - Intronic
1184856652 22:47150025-47150047 GAGCAGATGGGCCAGGGGCTGGG + Intronic
1185416629 22:50714208-50714230 GTGGAGAAGGGCTTGGGGTTGGG + Intergenic
949469990 3:4384476-4384498 GTTAAGAAGGGGTTGGGGTTGGG - Intronic
949988913 3:9561082-9561104 AGTCAGAAGGGCGAGGGGGTGGG - Intergenic
952164116 3:30727780-30727802 GATCAGAAGCTCTGGGGGTGAGG - Exonic
954442826 3:50531019-50531041 TCTCAGAAGGGGTAGGGGTGGGG + Intergenic
955060479 3:55488326-55488348 GGCCAGAAGGGCTGGGGGGTGGG - Intronic
955502149 3:59595984-59596006 CAGGGGAAGGGCTAGGGGTTTGG + Intergenic
956435951 3:69234770-69234792 GATCAGAAAGGCTGAGGGTGGGG + Intronic
956772078 3:72535180-72535202 GATGAAAATGGCCAGGGGTTGGG + Intergenic
959157271 3:102682133-102682155 GAACAGAAGGAATAGGGGTTTGG - Intergenic
960093226 3:113663193-113663215 GACCAGACAGGCCAGGGGTTAGG - Intronic
962899495 3:139746717-139746739 GATTAGAGGGGCCTGGGGTTTGG - Intergenic
964006236 3:151832719-151832741 CATCACAAGGGCTAGGAGTGAGG + Intergenic
967149964 3:186639416-186639438 GAAGAGAAGGGCTAGGAGTAGGG + Intronic
968479419 4:826717-826739 GAGCGGAGGGGCCAGGGGTTGGG + Intergenic
969235496 4:5862476-5862498 GAGCTGAAGGGAAAGGGGTTGGG + Intronic
969459038 4:7317931-7317953 ATTCTGAAGTGCTAGGGGTTCGG - Intronic
972144535 4:36006111-36006133 GATGAGAAGGGAGAAGGGTTAGG + Intronic
972888020 4:43517125-43517147 GATCAGAAGGACCAGCGTTTAGG + Intergenic
973740915 4:53918769-53918791 GCTCAGAAGGGCCAAGGCTTTGG - Intronic
975782952 4:77858842-77858864 GATCAGAAGCTCTGGGGGTGGGG + Intergenic
976364162 4:84214487-84214509 GATGAGGAAGGCTATGGGTTTGG + Intergenic
976848059 4:89512606-89512628 AATCAGAAGGGTTAGGGGCCAGG + Intergenic
981692297 4:147523090-147523112 GACAAGAAGTGCTTGGGGTTAGG + Intronic
982301021 4:153879603-153879625 GAGCAGCAAGGATAGGGGTTAGG + Intergenic
991770005 5:70031458-70031480 GATGAGAAGGGTTAAGGGCTGGG + Intronic
991849300 5:70906877-70906899 GATGAGAAGGGTTAAGGGCTGGG + Intronic
992409744 5:76493479-76493501 GGTCAGAAGGGCCAGGGTTAGGG - Intronic
993469713 5:88292380-88292402 GATCAGTAGTGCCAGGGGTTAGG + Intergenic
994218183 5:97162406-97162428 TAGCAGAAGAGTTAGGGGTTGGG - Exonic
997829130 5:137133940-137133962 GAGCAGATGGGCTGGGGGTGGGG + Intronic
998022991 5:138787133-138787155 GATCATAAGGGCTCTGGGCTGGG + Intronic
999509426 5:152232913-152232935 GTTCACAAGTGCCAGGGGTTAGG - Intergenic
1001456439 5:171864342-171864364 GCTCAGAAAGGCTAAGTGTTTGG + Intronic
1002020829 5:176363472-176363494 AATCAGAAGGAATAGGGGCTGGG - Intergenic
1002021004 5:176364620-176364642 AATCAGAAGGAATAGGGGCTGGG + Intergenic
1002117686 5:176976753-176976775 GTTGTCAAGGGCTAGGGGTTTGG + Intronic
1002710557 5:181192287-181192309 AATCAGGAGGGCCAGGTGTTTGG + Intergenic
1004898354 6:20170639-20170661 GATCAGAAGGACTAAGGGGGAGG - Intronic
1005473279 6:26182894-26182916 GAGGAGAAGGGCTAGGGGGCTGG + Intergenic
1006136527 6:31899533-31899555 GATAAGAAGGGTTGGGGGGTGGG - Intronic
1011216910 6:85014791-85014813 GAACAGGAGGGCAAGGGGCTGGG + Intergenic
1011221432 6:85058321-85058343 AAGCAGAAGGGCTTGGGGTTTGG + Intergenic
1012446230 6:99309992-99310014 GTTCAGAAGGGCTAGGGAATGGG - Intronic
1012902341 6:105020702-105020724 ACTCAGAAGGGTGAGGGGTTGGG - Intronic
1013329166 6:109081523-109081545 CATGAAAAGGGCTAAGGGTTAGG + Intronic
1019648365 7:2142926-2142948 GATCAGACGGGTTAGGCGGTGGG - Intronic
1021876980 7:25058676-25058698 GATCAGAAGGGGTGAGGGTTAGG - Intergenic
1023435002 7:40133677-40133699 GCTCAAAAGGGGTAGGGGGTTGG + Intronic
1023943450 7:44785008-44785030 GCTCAGAAGGGCTTCGTGTTTGG + Intergenic
1024342611 7:48282600-48282622 GATCAGATGAGCTAGGGGGCAGG - Intronic
1025899125 7:65729681-65729703 GATCAGTAGGGCTGGGGGTTGGG + Intergenic
1027451369 7:78335240-78335262 CCCCAGAAGGGCTAGGGATTCGG + Intronic
1028615860 7:92766043-92766065 GATCAGAAAGGCAGGGGGTGGGG + Intronic
1029122945 7:98280944-98280966 GCTCAGAAGGGGGAGGGATTTGG - Intronic
1029311721 7:99673347-99673369 TGTCAGAGGGGCTAGAGGTTTGG - Intronic
1029316589 7:99721070-99721092 TGTCAGAGGGGCTAGAGGTTTGG - Intronic
1029551823 7:101240663-101240685 GATCAGAGTGGCGAGGGGGTGGG - Intronic
1032420946 7:131778629-131778651 GGCCAGAGGGCCTAGGGGTTAGG - Intergenic
1033327279 7:140390260-140390282 GGTCAAAAGGGCTGGGGGTGGGG - Intronic
1034339219 7:150341335-150341357 GATCAGAAGGGCTAGGAAGAGGG - Exonic
1034815515 7:154169068-154169090 AATCAGAAGGGGTATGGGTAGGG - Intronic
1038821210 8:30953483-30953505 ATTCAGAAGTGCTAGGGATTAGG - Intergenic
1039770906 8:40685899-40685921 GCTCAGAATGGCTTGGGGTGGGG + Intronic
1042139037 8:65661041-65661063 GATCAGAGATGCCAGGGGTTGGG + Intronic
1044877974 8:96691421-96691443 CATCAAAAGTACTAGGGGTTAGG + Intronic
1048193846 8:132315416-132315438 GAGCAGAAGGGATAATGGTTAGG + Intronic
1048577752 8:135706346-135706368 GGTCAGCAGGGCTAGTGGTCAGG + Intergenic
1049580520 8:143408621-143408643 GAGGAGAGGGGCTAGGGGGTGGG - Intergenic
1051328671 9:16000154-16000176 AATGAGGAGGACTAGGGGTTGGG - Intronic
1053475874 9:38381769-38381791 GATCACAAGGGTTAGGGTTAGGG + Intergenic
1056708209 9:88969391-88969413 GATGAGAAGGGCGAGGGCATAGG + Intergenic
1057726295 9:97571004-97571026 GCGCAGAAGGGGTAGGGGTGGGG - Intronic
1059658405 9:116377532-116377554 GGTCAGATGGGCTTGGGATTGGG - Intronic
1061487620 9:130928419-130928441 CATCAGCAGGGCTGGGGGCTGGG - Intronic
1061516080 9:131091378-131091400 GAGCAGAAGGGCTGGGAGGTGGG - Intronic
1062527298 9:136983127-136983149 GCTCAGCAGGGCTAGGGGCAGGG + Exonic
1185549705 X:973207-973229 GATCAGAAGGCCAAGGGGCCAGG + Intergenic
1187651056 X:21406723-21406745 GATCAGAAGAGGTAGGAGTAGGG + Intronic
1190245383 X:48687335-48687357 GATGAGAAGGGCTGGTGGGTAGG + Intronic
1190301949 X:49062165-49062187 GCTGGGAAGGGCTGGGGGTTGGG + Intronic
1190711572 X:53075340-53075362 GATAGGAAGTGCTAGGGGTGGGG - Intronic
1192497880 X:71628282-71628304 GGACAGGAGGTCTAGGGGTTGGG + Intergenic
1196157985 X:112452007-112452029 AATCAGAATTGCTAGGGATTGGG + Intergenic
1197240084 X:124114308-124114330 GATGAGTAGGGCTAAGGGTGGGG + Intronic
1198403797 X:136292299-136292321 GATGAGATGGTCAAGGGGTTGGG + Intergenic
1199663785 X:150080773-150080795 GAACACTAGGCCTAGGGGTTGGG - Intergenic