ID: 903543490

View in Genome Browser
Species Human (GRCh38)
Location 1:24109789-24109811
Sequence AGATCAGAAGGGCTAGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 294}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903543490_903543502 22 Left 903543490 1:24109789-24109811 CCAACCCCTAGCCCTTCTGATCT 0: 1
1: 0
2: 2
3: 23
4: 294
Right 903543502 1:24109834-24109856 GCCAGGCCGTGGCAGAGGCTGGG 0: 1
1: 0
2: 1
3: 48
4: 490
903543490_903543500 17 Left 903543490 1:24109789-24109811 CCAACCCCTAGCCCTTCTGATCT 0: 1
1: 0
2: 2
3: 23
4: 294
Right 903543500 1:24109829-24109851 TCAAGGCCAGGCCGTGGCAGAGG 0: 1
1: 0
2: 1
3: 16
4: 247
903543490_903543504 23 Left 903543490 1:24109789-24109811 CCAACCCCTAGCCCTTCTGATCT 0: 1
1: 0
2: 2
3: 23
4: 294
Right 903543504 1:24109835-24109857 CCAGGCCGTGGCAGAGGCTGGGG 0: 1
1: 0
2: 8
3: 88
4: 735
903543490_903543497 5 Left 903543490 1:24109789-24109811 CCAACCCCTAGCCCTTCTGATCT 0: 1
1: 0
2: 2
3: 23
4: 294
Right 903543497 1:24109817-24109839 TCATATGTCCATTCAAGGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 149
903543490_903543501 21 Left 903543490 1:24109789-24109811 CCAACCCCTAGCCCTTCTGATCT 0: 1
1: 0
2: 2
3: 23
4: 294
Right 903543501 1:24109833-24109855 GGCCAGGCCGTGGCAGAGGCTGG 0: 1
1: 1
2: 0
3: 72
4: 679
903543490_903543498 11 Left 903543490 1:24109789-24109811 CCAACCCCTAGCCCTTCTGATCT 0: 1
1: 0
2: 2
3: 23
4: 294
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543490_903543506 29 Left 903543490 1:24109789-24109811 CCAACCCCTAGCCCTTCTGATCT 0: 1
1: 0
2: 2
3: 23
4: 294
Right 903543506 1:24109841-24109863 CGTGGCAGAGGCTGGGGACACGG 0: 1
1: 0
2: 2
3: 60
4: 593
903543490_903543496 0 Left 903543490 1:24109789-24109811 CCAACCCCTAGCCCTTCTGATCT 0: 1
1: 0
2: 2
3: 23
4: 294
Right 903543496 1:24109812-24109834 CTATGTCATATGTCCATTCAAGG 0: 1
1: 0
2: 0
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903543490 Original CRISPR AGATCAGAAGGGCTAGGGGT TGG (reversed) Intronic
900314151 1:2048771-2048793 AGACCAGGAGGGCGAGGGATGGG + Intergenic
901625326 1:10621276-10621298 AGATCAGAAGTCCTAAGGGCAGG - Intronic
902190742 1:14761336-14761358 AGAACAGAGGGGCTTGGGGGAGG - Intronic
902517353 1:16996552-16996574 GGGTCGGGAGGGCTAGGGGTGGG - Intronic
903543490 1:24109789-24109811 AGATCAGAAGGGCTAGGGGTTGG - Intronic
903789947 1:25886024-25886046 AGATCAGAATGTCTGGGGGTGGG - Intronic
904777314 1:32918493-32918515 AGGTCAGAAGGGCTTGGGAGGGG + Intergenic
906354908 1:45096668-45096690 TGATCCGAGGGGCAAGGGGTGGG - Intronic
910126466 1:83848145-83848167 AGATAAGAAGGACCAGAGGTAGG - Intergenic
912411441 1:109483430-109483452 GAATCAGAAGGGCAAGGGGAGGG - Intergenic
915278368 1:154805390-154805412 AAATCAGAATCCCTAGGGGTGGG + Intronic
915777809 1:158510254-158510276 AGATGAGAGGGACTTGGGGTTGG - Intergenic
917225571 1:172778130-172778152 AGAGGAGAAGGGCTAGGGGTGGG - Intergenic
917924281 1:179775992-179776014 TGATCAGATGGGGTGGGGGTTGG + Intronic
919640151 1:200038970-200038992 AGGTAAGTAGGGCCAGGGGTTGG - Intronic
920004774 1:202825111-202825133 TTGTCAGAAGGGTTAGGGGTTGG - Intronic
920039253 1:203085254-203085276 AGTGCAGAAGGGGTTGGGGTGGG - Intronic
920505619 1:206513419-206513441 CCCTCAGAAGGGCTGGGGGTGGG - Intronic
921096953 1:211895016-211895038 AGAACAGAGGGACTGGGGGTTGG - Intergenic
921799480 1:219385589-219385611 AGACCAGTAGGGCAAGGGGAAGG + Intergenic
1063573330 10:7237570-7237592 AGGGGTGAAGGGCTAGGGGTGGG + Intronic
1064586155 10:16841569-16841591 AGATTAGAAAGGTCAGGGGTGGG - Intronic
1065255063 10:23857589-23857611 AAATCAGAAGGTCTAGGGTCGGG + Intronic
1066323142 10:34325627-34325649 AGTTCCTAAGGGCTCGGGGTTGG - Intronic
1067323861 10:45247888-45247910 AGATCAGAAAGGTCAGGGGTGGG - Intergenic
1067803531 10:49376956-49376978 GGATCTGGAGGGCTAGGGGGTGG - Intronic
1068721735 10:60253217-60253239 AGAGGACAAGGGCTTGGGGTTGG + Intronic
1069514393 10:69065987-69066009 AGATCAGAAGAGCTACCGTTTGG + Intergenic
1071513674 10:86283015-86283037 AGTTCAGAAGGTGTAGGGGATGG - Intronic
1072465745 10:95660770-95660792 TGATCAGAATCTCTAGGGGTAGG + Intergenic
1073686554 10:105760675-105760697 GGATCAGAATCTCTAGGGGTTGG + Intergenic
1073918884 10:108436256-108436278 AGAACTGAAGGGCTATGAGTAGG - Intergenic
1074559430 10:114521910-114521932 AGAGAAGATGGCCTAGGGGTTGG + Intronic
1074811442 10:117109169-117109191 ATATCAGAAATTCTAGGGGTGGG - Intronic
1075017552 10:118921340-118921362 AAATCAGTAAGTCTAGGGGTTGG - Intergenic
1075091501 10:119446467-119446489 GGATGAGAAAGGCGAGGGGTGGG - Intronic
1075122813 10:119676680-119676702 ACAGCAGAAGGGCCAGGGCTGGG - Exonic
1075749305 10:124752288-124752310 ATATAAGAAGGGCAAGGGCTGGG + Intronic
1076513996 10:131033006-131033028 AGATCAGAAGGGACCTGGGTGGG - Intergenic
1076751323 10:132544909-132544931 AGATCACCCGGGTTAGGGGTGGG + Intronic
1077358142 11:2128051-2128073 AGATGAGGAGGGCTGGGGGTTGG - Intergenic
1077388775 11:2289527-2289549 AGATTAGATGGGGTGGGGGTGGG + Intergenic
1077852325 11:6085238-6085260 AGATGAGAAGCCCTAGGGGATGG + Intergenic
1077867519 11:6235018-6235040 AGATCAGAAGGGCGGGGCTTGGG + Intronic
1078194633 11:9125287-9125309 TGATCAGCAGGGCTGGAGGTTGG + Intronic
1078413332 11:11145643-11145665 AGACTAGAAAGGCTAGGAGTTGG - Intergenic
1080821113 11:35807421-35807443 TGATCTGAAGGTCTATGGGTGGG - Exonic
1081669954 11:44937274-44937296 AGATCTCAGGGGCTGGGGGTGGG + Intronic
1082631913 11:55553522-55553544 AGATCAGCAGGGAAAGGAGTGGG - Intergenic
1083848225 11:65349300-65349322 AGTTCAGAAGGGGAAGGGATAGG - Intronic
1084316152 11:68347060-68347082 AGATCAGGAATGCTTGGGGTGGG + Intronic
1084782984 11:71423551-71423573 AGAGCAGAAGGGTTGTGGGTGGG - Intergenic
1085309027 11:75505343-75505365 TGATCTGGAGGGCTGGGGGTGGG - Intronic
1085465167 11:76718134-76718156 AGATCAGAAGGGGAAAGTGTTGG - Intergenic
1085715032 11:78864907-78864929 AGACCAGAAGGCCTAGAGGAGGG + Intronic
1086210231 11:84309388-84309410 AGCACAGAAGGGCTAGGAGAGGG + Intronic
1087130329 11:94664246-94664268 AAATCAGAAGCACTAGGGGTGGG - Intergenic
1089299386 11:117489487-117489509 AGAAGGGAAGGGCTAGGGCTAGG + Intronic
1091005383 11:131948449-131948471 AAATGAGAAGGGCTAAGTGTTGG - Intronic
1091237764 11:134033280-134033302 AGCTCAGAAGGGCCAGGGAGAGG + Intergenic
1091281564 11:134384524-134384546 AGATGAGTAGGGCTAGGGAGGGG - Intronic
1091408143 12:221556-221578 AGAGCAGAAGAGAAAGGGGTTGG + Intronic
1092507390 12:9117603-9117625 AGGACAGAAGGGCTGAGGGTTGG + Intergenic
1092880286 12:12882650-12882672 AAGTCAAAAGGGATAGGGGTGGG - Intergenic
1093503485 12:19837852-19837874 AGATCAGAGTGCCTAGGGATGGG - Intergenic
1094382327 12:29856257-29856279 AGACCAGAATGGCATGGGGTTGG + Intergenic
1096412407 12:51386899-51386921 TGATCAAAAGGGTCAGGGGTGGG - Intronic
1096476248 12:51910947-51910969 AGGGCAGTATGGCTAGGGGTGGG - Intronic
1097825732 12:64173088-64173110 AGAGCAGATGGGGTGGGGGTGGG - Intergenic
1099165945 12:79307602-79307624 TGGTCGGAAGGGCTGGGGGTGGG + Intronic
1101287863 12:103334654-103334676 AGAACAGATGGGCTGGGGCTGGG - Intronic
1101389374 12:104286638-104286660 ACATCAGAATGTCTAGGGGTGGG + Intronic
1101489313 12:105196997-105197019 TGAACAGCAGGGGTAGGGGTGGG - Intronic
1101686696 12:107030914-107030936 AACTCAGAAGAGCTGGGGGTTGG + Intronic
1103367833 12:120395899-120395921 AGAACAGACTGGCTTGGGGTAGG - Intergenic
1104166015 12:126230333-126230355 AGAACAGAAGTGGGAGGGGTAGG + Intergenic
1104649435 12:130521090-130521112 GGATCAGAAGGGTGAGAGGTAGG - Intronic
1105055925 12:133099095-133099117 AGATCACAAGGTCTAGGAGTTGG - Intronic
1106634072 13:31508610-31508632 AGAACAGGAGGGCTAGGCCTAGG - Intergenic
1110404313 13:75132509-75132531 AGGTCAGAATAGCTAGGGCTTGG + Intergenic
1112752024 13:102592784-102592806 AGGTCAGTAGGCCTAGGCGTTGG - Intergenic
1113317432 13:109197124-109197146 AGATCTGAATGGCTAGTGGGCGG - Intronic
1113649772 13:112027270-112027292 AGATCAGCAGGGCTGGGGACAGG + Intergenic
1113816586 13:113175912-113175934 AGCTCAGCAGGGCTGTGGGTGGG - Intergenic
1113890370 13:113732249-113732271 AAGTCAGAAGGGAGAGGGGTGGG - Intronic
1117409863 14:55440675-55440697 AGCGGAGATGGGCTAGGGGTGGG + Intronic
1117503406 14:56376382-56376404 AAATTAGAGGGGCCAGGGGTGGG - Intergenic
1118239431 14:64042356-64042378 AGATGAAAAGGGATAGAGGTTGG + Intronic
1118262144 14:64257731-64257753 GGATCAGAAGGGGTGGGGGATGG + Intronic
1118470085 14:66067391-66067413 GAATCAGAAGCTCTAGGGGTGGG + Intergenic
1118541013 14:66825517-66825539 AAATCAGAAACTCTAGGGGTGGG - Intronic
1119682125 14:76600161-76600183 AAATCAGAAAGTCTGGGGGTGGG + Intergenic
1119762516 14:77161403-77161425 AGGTCAGAAGTGCTGGCGGTTGG + Intronic
1121258942 14:92552528-92552550 AGAGCAGAGGGGGTAGGGGGAGG - Intronic
1122230637 14:100304982-100305004 AGATCAGAAGCGGGAGGGGAAGG + Intronic
1122278098 14:100605501-100605523 AGAGCAGAGGGGCTGGGGGCTGG + Intergenic
1122753599 14:103958746-103958768 AGATGAGAAGGACAAGGTGTTGG - Intronic
1123186206 14:106519105-106519127 AGAGCAGCAGGGTCAGGGGTGGG + Intergenic
1125506619 15:40271251-40271273 AGAGCAGAAGGGCTTGGGCTCGG + Intronic
1126268771 15:46787761-46787783 AGAGCAGAAGGGTTGAGGGTAGG - Intergenic
1126684394 15:51234787-51234809 AGATCAGAACCTCTGGGGGTAGG - Intronic
1127546393 15:59997332-59997354 AGCTAAGAATGGCTAGGGGGCGG - Intergenic
1127966704 15:63928187-63928209 ATATCACAATTGCTAGGGGTAGG - Intronic
1129062316 15:72869868-72869890 AGATCAAAATGTCCAGGGGTGGG - Intergenic
1129104310 15:73295493-73295515 AGATCACAAGGGAGAGGGCTGGG - Intronic
1130322988 15:82855618-82855640 AGATCTGAGGGCCTAGGGCTTGG + Intronic
1131564319 15:93472163-93472185 AGGTCAGAAGCGGAAGGGGTAGG + Intergenic
1134002325 16:10792468-10792490 AGCTCAGGAGGCCTGGGGGTGGG - Intronic
1134641377 16:15831950-15831972 AGATCAGAAGGGCTAATGCTTGG + Intronic
1134897002 16:17897341-17897363 AAATTAGAACTGCTAGGGGTGGG + Intergenic
1135270099 16:21061727-21061749 AAATCAGGAAGTCTAGGGGTGGG - Intronic
1137926376 16:52546203-52546225 AGGTAAGAAGGACTGGGGGTGGG + Intronic
1138022343 16:53496067-53496089 TGATCAGAATGGCTGTGGGTGGG - Intronic
1138772024 16:59676720-59676742 AAATGAGCAGGGCTGGGGGTGGG - Intergenic
1139930042 16:70519062-70519084 AAATCAGAAAGTCTAGGGGTGGG - Intronic
1140278651 16:73533857-73533879 AGATAAGAAGTGGTTGGGGTTGG - Intergenic
1140280452 16:73550017-73550039 TGTTCAGACGGGCGAGGGGTGGG + Intergenic
1140676138 16:77332138-77332160 AGATCAGAAGTGTTAGGGTCAGG + Intronic
1141425811 16:83943726-83943748 AGATCAGAAGTTCTGGGTGTGGG - Intronic
1141493121 16:84388412-84388434 ACCTCAGAAGCCCTAGGGGTGGG - Intronic
1141753550 16:85975841-85975863 AGACCTGCAGGCCTAGGGGTTGG + Intergenic
1141783879 16:86185299-86185321 AGATCAGGATGGCAGGGGGTGGG - Intergenic
1142891447 17:2946726-2946748 GAATCAGAAGCTCTAGGGGTGGG + Intronic
1142898276 17:2996140-2996162 AGATGAGGAAGGCTGGGGGTGGG - Intronic
1143012850 17:3875794-3875816 AGAACAGAAGGGCTCAGGGTGGG - Intronic
1143025624 17:3940380-3940402 AGAAAAGATGGGCTAGGGATGGG + Intronic
1143499283 17:7329479-7329501 AGAACAGAAGGACACGGGGTCGG + Intergenic
1146640826 17:34540141-34540163 AGATCATATGGGTGAGGGGTTGG - Intergenic
1147323378 17:39659011-39659033 AGATGACAATGGCAAGGGGTGGG - Intronic
1147763773 17:42818994-42819016 AGGTCAGTCGGGCTAGGAGTGGG - Intronic
1148240191 17:45995357-45995379 AGAGCAGAATCTCTAGGGGTGGG - Intronic
1148596899 17:48863907-48863929 TGATCAAAAGGGCTATGGGAAGG + Intronic
1149432491 17:56605461-56605483 AGATCAGAAGGTTTGGGGATAGG - Intergenic
1150660615 17:67072951-67072973 AAATCAGAAATGCTGGGGGTGGG + Exonic
1152930097 17:83104959-83104981 AGATCAGAGGGGCGATGGGGAGG + Intergenic
1153958629 18:10121252-10121274 AGAGCAGAAGGGCGAGTGGAAGG + Intergenic
1155224560 18:23718188-23718210 AGATCGGAAGGTGTAGTGGTGGG + Intronic
1156045018 18:32868327-32868349 AGAACAAAAGGGGTGGGGGTGGG - Intergenic
1157213748 18:45764863-45764885 AGACTAGAAGGGCCAGGGGTGGG - Intergenic
1157315037 18:46579830-46579852 GGAGCAGCAGGGCTAGGGATGGG - Intronic
1160178304 18:76613511-76613533 AGAGCAGAAGGGTTAGGACTCGG + Intergenic
1160768725 19:821198-821220 TGGTCAGAGGGGCTGGGGGTCGG - Intronic
1161321289 19:3642816-3642838 AGAGCAGAGGGGCTGGGGGGCGG + Intronic
1162098157 19:8323046-8323068 AGGTCAGAAGGGGCAGAGGTTGG - Exonic
1162545119 19:11324582-11324604 AGAGCCGGAGTGCTAGGGGTTGG + Exonic
1162755378 19:12855324-12855346 AAATCAGAAGTTCTAGGGCTGGG + Intronic
1164836505 19:31358289-31358311 AGCTCAGCAGGGCTTGGAGTTGG + Intergenic
1165797613 19:38527997-38528019 AGATCTTTAGGTCTAGGGGTGGG + Intronic
1166266584 19:41688305-41688327 AGATCACATGGTCCAGGGGTGGG + Exonic
1166279375 19:41780807-41780829 ATTTCTGAAGGGCTAAGGGTAGG + Intergenic
1168142014 19:54394498-54394520 AGATCAGAGCTGCCAGGGGTTGG - Intergenic
1168269214 19:55240718-55240740 TGAGCTGAAGAGCTAGGGGTGGG - Intronic
925739891 2:6996183-6996205 AGAGCAGAAGGGCTTGGTGGGGG - Intronic
927431677 2:23031633-23031655 AGATCAGAAGGGATCTGGGGAGG - Intergenic
928332722 2:30369921-30369943 TGAGAAGGAGGGCTAGGGGTAGG + Intergenic
930085674 2:47495466-47495488 AGATGAGAAGAGGTAGAGGTGGG - Intronic
932096211 2:68851097-68851119 AAATTAGAAGAGCTGGGGGTTGG - Intergenic
932820161 2:74892794-74892816 AGCACAGAGGGGCTAGGGGCTGG + Exonic
933653803 2:84871058-84871080 AGATCAGAATGTCTGGAGGTAGG - Intronic
935155269 2:100478947-100478969 AAATCAGAAGTGCTTGGGGAGGG + Intronic
936092447 2:109510200-109510222 AGGTGAGAATGGCCAGGGGTAGG + Intergenic
937150663 2:119683522-119683544 AGAGCAGATGGGTTGGGGGTGGG - Intronic
939578190 2:143920347-143920369 ATTTGAGAAGGGCCAGGGGTGGG + Intergenic
940515438 2:154678498-154678520 AGATCAGAAGGGCAGGAGCTGGG + Intergenic
941884962 2:170518534-170518556 ATATCAGAATGTCTAGGGGCTGG + Intronic
942589815 2:177530590-177530612 AGAGTAAAAGGGCCAGGGGTTGG + Intronic
942895249 2:181045614-181045636 ACATCAGAATCTCTAGGGGTGGG + Intronic
943924282 2:193751999-193752021 AACTCAGAAGGGTGAGGGGTTGG - Intergenic
946378676 2:219330103-219330125 GCATCAGAAGCCCTAGGGGTGGG - Intronic
946456483 2:219830705-219830727 GGGTCAGAAGGTCTGGGGGTGGG + Intergenic
946912223 2:224475660-224475682 AGAAAAGAAGGGCAAAGGGTGGG - Intronic
948806236 2:240454418-240454440 AGAGCAGATGGGCCAGGGGCTGG + Intronic
1169298769 20:4423768-4423790 AGGACAGATGGGATAGGGGTGGG + Intergenic
1169362986 20:4967064-4967086 AGGTCAGAAGGGCTGGAGGCAGG + Intronic
1170307748 20:14958834-14958856 AGATCAGGTAGGCTTGGGGTGGG + Intronic
1170807100 20:19641738-19641760 AAATCAGAATCTCTAGGGGTGGG + Intronic
1170872004 20:20214525-20214547 TCAACAGAAGGGCTTGGGGTGGG - Intronic
1171049733 20:21844445-21844467 ACAGCTGAAGGGGTAGGGGTTGG + Intergenic
1173292979 20:41730555-41730577 AGCTCAGAAGGGACAGGGGCTGG - Intergenic
1173387591 20:42603344-42603366 AGATCCAGGGGGCTAGGGGTGGG + Intronic
1174011771 20:47455635-47455657 AGATCAGAAGAGCTGGTGGTTGG - Intergenic
1175055931 20:56198122-56198144 AGCTCTGAAGGGGTAGGGGTGGG + Intergenic
1177473893 21:21593932-21593954 AGAGCAGAAGGGAAATGGGTTGG - Intergenic
1178226393 21:30724285-30724307 AAATCAGAAGGTCTAGGAGTAGG + Intergenic
1179623183 21:42632287-42632309 GAATCAGAAGCGCTGGGGGTGGG + Intergenic
1180650405 22:17371226-17371248 AGATCAAAAGGGTTGGGGATGGG + Intronic
1181098124 22:20520129-20520151 AGAACAGAAGTTCCAGGGGTGGG - Intronic
1181440349 22:22932396-22932418 AGCTCAGAGGGGCCTGGGGTGGG + Intergenic
1182549947 22:31095464-31095486 AGATCCGGTGGGCTGGGGGTTGG + Intronic
1182811299 22:33119052-33119074 GGAGCAAAAGGGCTATGGGTAGG + Intergenic
1183195664 22:36351884-36351906 AGAGCAGAAGGGGCAGGGGATGG + Intronic
1184331893 22:43832795-43832817 AGGTCAGAAAGCCCAGGGGTAGG - Intronic
1185416628 22:50714207-50714229 AGTGGAGAAGGGCTTGGGGTTGG + Intergenic
951056328 3:18150251-18150273 AAATCAGAATCTCTAGGGGTGGG - Intronic
951989466 3:28660270-28660292 ACATCAGAATCTCTAGGGGTAGG + Intergenic
953907367 3:46874984-46875006 GGAACAGCAGGGCTGGGGGTGGG + Intronic
954442825 3:50531018-50531040 TTCTCAGAAGGGGTAGGGGTGGG + Intergenic
955190877 3:56760550-56760572 ATATCAGAAGTGCTACGTGTAGG - Intronic
956435950 3:69234769-69234791 GGATCAGAAAGGCTGAGGGTGGG + Intronic
956772077 3:72535179-72535201 AGATGAAAATGGCCAGGGGTTGG + Intergenic
957875331 3:86138908-86138930 GAATGAGAAGGGCTTGGGGTGGG - Intergenic
959521146 3:107324296-107324318 AGATCAGAGAGGTGAGGGGTGGG - Intergenic
960084912 3:113580103-113580125 TGATCAAAAGGGCAAGGGGGAGG + Intronic
960796780 3:121495890-121495912 AGATGAGAAGAGATAGTGGTAGG - Intronic
960947431 3:122976277-122976299 AGATCAGAAAGTCTGGGGGCAGG + Intronic
962144024 3:132821192-132821214 ACATCAGCAGGTCTATGGGTGGG - Intergenic
963606920 3:147420048-147420070 AGACCAGAAAGGGTAGGGTTTGG + Intronic
964341000 3:155708169-155708191 ACATCAGAATCTCTAGGGGTGGG + Intronic
964955355 3:162348827-162348849 AGAGAAGAAGTGCTAGGGGCAGG - Intergenic
966311877 3:178602809-178602831 ACATCAGAAACGCTGGGGGTAGG - Intronic
967149963 3:186639415-186639437 GGAAGAGAAGGGCTAGGAGTAGG + Intronic
969235495 4:5862475-5862497 AGAGCTGAAGGGAAAGGGGTTGG + Intronic
970175912 4:13339353-13339375 AGATCAGATGGGTTCAGGGTGGG - Intergenic
973587273 4:52405884-52405906 AGATAAGAAGGGTGAGGGGCAGG + Intergenic
974862973 4:67545711-67545733 AGAGCAGAGCGGCTAGAGGTAGG - Intergenic
975782951 4:77858841-77858863 GGATCAGAAGCTCTGGGGGTGGG + Intergenic
976640619 4:87333885-87333907 AGATCACAAGGTCAAGGGATAGG + Intergenic
977133554 4:93272407-93272429 TGAGCAGAAGGGCCAGAGGTGGG + Intronic
979324166 4:119360091-119360113 AGATGAATAGGGCTAGGCGTAGG + Intergenic
986254628 5:6091879-6091901 GAATCAGAAGCGCTGGGGGTGGG + Intergenic
987026524 5:13932341-13932363 AGTTGATAAGGGGTAGGGGTGGG + Intronic
988684529 5:33514381-33514403 ATCTCAGAAGGGATTGGGGTGGG - Intergenic
988966661 5:36425541-36425563 AGGTGAGTAGGGCAAGGGGTGGG + Intergenic
989293928 5:39801612-39801634 AGAGCAGAATGGATAGGGCTTGG - Intergenic
991230189 5:64323676-64323698 AGAGCAGAAGGGATGGGGGAGGG + Intronic
991770004 5:70031457-70031479 AGATGAGAAGGGTTAAGGGCTGG + Intronic
991849299 5:70906876-70906898 AGATGAGAAGGGTTAAGGGCTGG + Intronic
992409745 5:76493480-76493502 GGGTCAGAAGGGCCAGGGTTAGG - Intronic
994711341 5:103268438-103268460 AAATTAGAAGGCCTAGGGGTAGG + Intronic
995890738 5:116947859-116947881 AGAACAGAAGGGCTGGAGTTAGG + Intergenic
997032969 5:130153368-130153390 AGGTCAGAATGGCTAGGAGAAGG - Intronic
997525428 5:134549948-134549970 AGCTCAGTAGGGCTGGGGCTGGG - Intronic
997829129 5:137133939-137133961 GGAGCAGATGGGCTGGGGGTGGG + Intronic
998466807 5:142353159-142353181 AAATCTGAAAGCCTAGGGGTAGG - Intergenic
1000203462 5:159034720-159034742 AAATCTGCAGGGCAAGGGGTGGG - Intronic
1000378705 5:160609300-160609322 AGTTCTGAAGGGCCAGGGTTGGG + Intronic
1000934268 5:167289016-167289038 AGATCAGCAGGGCTGGGAGCTGG - Intronic
1001537075 5:172505603-172505625 AAATGGGAAGGGCTGGGGGTGGG - Intergenic
1002020830 5:176363473-176363495 AAATCAGAAGGAATAGGGGCTGG - Intergenic
1002021003 5:176364619-176364641 AAATCAGAAGGAATAGGGGCTGG + Intergenic
1002696142 5:181092450-181092472 ACCTCAGGAGGGCCAGGGGTGGG - Intergenic
1003891090 6:10564419-10564441 AGATCAGCAGGGATGAGGGTAGG - Intronic
1004478716 6:15998938-15998960 AGATAAGAAGGGACGGGGGTGGG + Intergenic
1004489600 6:16101607-16101629 AGATCAGAATGGGTAAGAGTTGG + Intergenic
1004490433 6:16109983-16110005 AGATCAGTAGGAGAAGGGGTAGG + Intergenic
1006136528 6:31899534-31899556 AGATAAGAAGGGTTGGGGGGTGG - Intronic
1006165055 6:32059514-32059536 AGAACAGGAGGGGCAGGGGTGGG + Intronic
1006449618 6:34098615-34098637 GGATCAGAAGGGCAAGGAGCAGG - Intronic
1006930694 6:37686385-37686407 AAATCAGAATGTCTAGGGGGTGG - Intronic
1007080350 6:39096953-39096975 AAATCAGTAGAGCTGGGGGTTGG + Intergenic
1007214384 6:40225885-40225907 AAATCAGAATCTCTAGGGGTAGG + Intergenic
1012446231 6:99309993-99310015 GGTTCAGAAGGGCTAGGGAATGG - Intronic
1015498551 6:133906735-133906757 AGATCAGCAGAGATAGGGGCAGG + Intergenic
1017727130 6:157283611-157283633 AAATCAGAAGCTCTGGGGGTGGG + Intergenic
1020459836 7:8416903-8416925 AGATAAGAAGTGCTAGGATTGGG - Intergenic
1021580337 7:22145695-22145717 GGATCAGAAGTTCTAGGGGTGGG - Intronic
1022780879 7:33582101-33582123 AGCAAAGAGGGGCTAGGGGTAGG - Intronic
1022821051 7:33961347-33961369 AGAATAAAAGGGCTAGGGGTGGG + Intronic
1024691836 7:51810957-51810979 AGTCCAGAAGGGCTAAGGGAAGG + Intergenic
1025899124 7:65729680-65729702 AGATCAGTAGGGCTGGGGGTTGG + Intergenic
1026570011 7:71521186-71521208 AGCTCAGAAGGGCTAAGGCATGG + Intronic
1028615859 7:92766042-92766064 AGATCAGAAAGGCAGGGGGTGGG + Intronic
1029551824 7:101240664-101240686 AGATCAGAGTGGCGAGGGGGTGG - Intronic
1030332186 7:108282929-108282951 AAATCAGAAGTTCTGGGGGTGGG + Intronic
1031153320 7:118080098-118080120 AAATCAGAACCTCTAGGGGTGGG + Intergenic
1032481926 7:132254220-132254242 AGATCACAAGAGCTAGGGAAAGG - Intronic
1032492492 7:132333863-132333885 AAATCAGCAGGGCTGGTGGTTGG - Intronic
1032536976 7:132672495-132672517 AGATGGGAAGGGATAGGGCTGGG + Intronic
1032693999 7:134317446-134317468 AAATCAGAATCGCTGGGGGTGGG - Intergenic
1033327280 7:140390261-140390283 TGGTCAAAAGGGCTGGGGGTGGG - Intronic
1034339220 7:150341336-150341358 GGATCAGAAGGGCTAGGAAGAGG - Exonic
1034463044 7:151209091-151209113 AGATCAGGAGGTTGAGGGGTTGG + Intronic
1034697742 7:153069108-153069130 AGATGAGAAGAGCAATGGGTGGG + Intergenic
1034697754 7:153069148-153069170 AGATGAGAAGAGCAATGGGTGGG + Intergenic
1034747558 7:153536631-153536653 AGACCAGCAGGGCTAGGGTCAGG + Intergenic
1034815516 7:154169069-154169091 CAATCAGAAGGGGTATGGGTAGG - Intronic
1034897490 7:154886750-154886772 AGCACAGCAGGGCTAGGGCTAGG - Intronic
1036418167 8:8570200-8570222 AAATCAGGATGTCTAGGGGTGGG - Intergenic
1036452107 8:8877929-8877951 ACTTCAGCAGGCCTAGGGGTGGG - Intronic
1037459089 8:19091284-19091306 AGACCAGAAAGCCTAGGTGTAGG + Intergenic
1037512615 8:19599074-19599096 TGAGCAGAAGGGCCAGAGGTGGG + Intronic
1039770905 8:40685898-40685920 AGCTCAGAATGGCTTGGGGTGGG + Intronic
1045061951 8:98418533-98418555 ACAGCAGAAGGGCGAGGGCTGGG + Intronic
1045549281 8:103155744-103155766 AAATCAGAAGTGCCTGGGGTGGG - Intronic
1045950049 8:107841235-107841257 AAATCAGATGGGCTATGGGTAGG - Intergenic
1046126859 8:109920828-109920850 AGATCAGATGGCCTAGGGCAGGG + Intergenic
1047065079 8:121272920-121272942 AAATCTGAAATGCTAGGGGTGGG - Intergenic
1047206550 8:122806945-122806967 AGATCAGAGGGTCTAAGGATGGG - Intronic
1049749654 8:144277166-144277188 AGAGAAGAGGGGCTCGGGGTGGG - Intronic
1050691721 9:8234624-8234646 TGAGTAGAAAGGCTAGGGGTGGG + Intergenic
1051371399 9:16362232-16362254 AAGTCAGAAGGGCAAGGGATAGG + Intergenic
1051376862 9:16410732-16410754 AGATCCGAAGAGCAAAGGGTGGG + Exonic
1051811604 9:21055562-21055584 AGATCAGTAGGGATGGGAGTAGG - Intergenic
1053475873 9:38381768-38381790 AGATCACAAGGGTTAGGGTTAGG + Intergenic
1054938426 9:70713844-70713866 ACATCAGAATCTCTAGGGGTGGG + Intronic
1054940117 9:70731837-70731859 ACATCAGAATCTCTAGGGGTGGG + Intronic
1055003619 9:71481705-71481727 AGTTCAGAAAAGCTAGAGGTGGG + Intergenic
1056604538 9:88076137-88076159 GGATCAGAAGGGCGGGAGGTGGG - Intergenic
1057726296 9:97571005-97571027 GGCGCAGAAGGGGTAGGGGTGGG - Intronic
1059245157 9:112843532-112843554 AGATCAGAAAGGCTGGGGAGTGG + Intronic
1059658406 9:116377533-116377555 AGGTCAGATGGGCTTGGGATTGG - Intronic
1060188689 9:121578880-121578902 AGATCAGAAGGACATGGGCTGGG - Intronic
1060491655 9:124089585-124089607 ATATCAGAATCTCTAGGGGTGGG + Intergenic
1060563395 9:124567258-124567280 AGATCAGAACTCCAAGGGGTGGG + Intronic
1060944096 9:127559790-127559812 AGATCAGAAGTGCCGGGTGTGGG - Intronic
1061180662 9:129023352-129023374 AGATCAGAGGGGCCAGGACTTGG - Intronic
1061941594 9:133887012-133887034 AGAGCAGGAGGGCCCGGGGTGGG - Intronic
1062527297 9:136983126-136983148 GGCTCAGCAGGGCTAGGGGCAGG + Exonic
1187651055 X:21406722-21406744 AGATCAGAAGAGGTAGGAGTAGG + Intronic
1187770398 X:22689533-22689555 AGATCTGAAGGGGTGGGGGAGGG - Intergenic
1188976083 X:36677052-36677074 AGATTTGAAGGGCCAGGGGCAGG - Intergenic
1190301948 X:49062164-49062186 AGCTGGGAAGGGCTGGGGGTTGG + Intronic
1190711573 X:53075341-53075363 AGATAGGAAGTGCTAGGGGTGGG - Intronic
1192497879 X:71628281-71628303 AGGACAGGAGGTCTAGGGGTTGG + Intergenic
1195457599 X:105086452-105086474 AGAGTAGAATGGCTGGGGGTGGG + Intronic
1196332628 X:114490598-114490620 AGATTTGAACGTCTAGGGGTGGG - Intergenic
1197240083 X:124114307-124114329 TGATGAGTAGGGCTAAGGGTGGG + Intronic
1200163497 X:154020644-154020666 AAGTCTGTAGGGCTAGGGGTGGG - Intergenic
1200230767 X:154442902-154442924 AGAGCAGAAGAATTAGGGGTGGG - Exonic
1202047067 Y:20745878-20745900 AGAACTGAAGGGAAAGGGGTAGG + Intergenic