ID: 903543498

View in Genome Browser
Species Human (GRCh38)
Location 1:24109823-24109845
Sequence GTCCATTCAAGGCCAGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903543495_903543498 -1 Left 903543495 1:24109801-24109823 CCTTCTGATCTCTATGTCATATG 0: 1
1: 0
2: 0
3: 13
4: 180
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543490_903543498 11 Left 903543490 1:24109789-24109811 CCAACCCCTAGCCCTTCTGATCT 0: 1
1: 0
2: 2
3: 23
4: 294
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543488_903543498 17 Left 903543488 1:24109783-24109805 CCTAGCCCAACCCCTAGCCCTTC 0: 1
1: 0
2: 4
3: 41
4: 624
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543487_903543498 18 Left 903543487 1:24109782-24109804 CCCTAGCCCAACCCCTAGCCCTT 0: 1
1: 0
2: 1
3: 37
4: 438
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543489_903543498 12 Left 903543489 1:24109788-24109810 CCCAACCCCTAGCCCTTCTGATC 0: 1
1: 0
2: 1
3: 19
4: 225
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543494_903543498 0 Left 903543494 1:24109800-24109822 CCCTTCTGATCTCTATGTCATAT 0: 1
1: 1
2: 0
3: 28
4: 335
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543493_903543498 5 Left 903543493 1:24109795-24109817 CCTAGCCCTTCTGATCTCTATGT 0: 1
1: 0
2: 1
3: 12
4: 229
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543491_903543498 7 Left 903543491 1:24109793-24109815 CCCCTAGCCCTTCTGATCTCTAT 0: 1
1: 0
2: 0
3: 7
4: 142
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543486_903543498 23 Left 903543486 1:24109777-24109799 CCAATCCCTAGCCCAACCCCTAG 0: 1
1: 0
2: 2
3: 45
4: 444
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96
903543492_903543498 6 Left 903543492 1:24109794-24109816 CCCTAGCCCTTCTGATCTCTATG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903543498 Original CRISPR GTCCATTCAAGGCCAGGCCG TGG Intronic
900656779 1:3762536-3762558 GTCCCTTCTAGGACAGGCAGTGG + Intronic
901211148 1:7526747-7526769 GGGCATCCAAGGCCAGGCCAGGG + Intronic
901868748 1:12125311-12125333 GCCCAGGCCAGGCCAGGCCGGGG - Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
903954135 1:27013096-27013118 GTCCCTTTAAGTCCAGGCCCGGG - Intergenic
916040825 1:160959998-160960020 GGCCATGCAAGACCAGGCCATGG + Intergenic
1063878663 10:10508464-10508486 GGCCATTCAAGAGCATGCCGAGG - Intergenic
1065860251 10:29866629-29866651 GTCTTTTTAAGGCCAGGCTGTGG + Intergenic
1069920963 10:71815367-71815389 GACCCTCCAAGGCCAGGCCTTGG + Exonic
1076152128 10:128170923-128170945 TTAAATTCAAGGCCAGGCCAAGG - Intergenic
1077119104 11:898681-898703 GTCCAGTCCAGGCCAGGTGGGGG + Intronic
1077145141 11:1041249-1041271 GTCCACTCAAGGCCACACAGTGG - Intergenic
1082177251 11:49075090-49075112 TTCCTTTCAAGGCCAGGCATAGG + Intergenic
1083347669 11:62004871-62004893 ATCCATGCATGGCCAGGCCTCGG - Intergenic
1083633402 11:64107346-64107368 AACCATTCAAGGCCAGGAGGGGG - Intronic
1087246905 11:95849959-95849981 GTCCTTTCATGGCCAGGCTTTGG - Intronic
1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG + Intronic
1092756925 12:11772432-11772454 GTCTATCCAAGGCCAGGCATGGG - Intronic
1101318945 12:103655959-103655981 GGCCATTCAGGGCCAGGTCTAGG + Intronic
1105424831 13:20285190-20285212 GTCCACTCAAGTCCAGGAGGAGG - Intergenic
1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG + Intergenic
1108502912 13:51084501-51084523 TCCCCTTCAAGGCCAGGCCAAGG - Intergenic
1110931527 13:81224313-81224335 GTCCATTTAAGACCCGGCCTGGG - Intergenic
1111051272 13:82885247-82885269 GGCCAGTGAAGGCCAGGCTGAGG - Intergenic
1114430134 14:22653695-22653717 GGCCATCCAAGGGAAGGCCGGGG - Intergenic
1115648871 14:35388913-35388935 GTCCCTCCAAGGGAAGGCCGTGG - Intergenic
1118315094 14:64721345-64721367 TTCCTTCCAAGGTCAGGCCGAGG + Intronic
1118778815 14:68992465-68992487 TTCCATTCAAGTCCAGGTCCCGG + Intergenic
1120789158 14:88563260-88563282 GTCCAGCGGAGGCCAGGCCGCGG - Intronic
1125433973 15:39626357-39626379 GTTCATTTAAGGCCAGGTCAGGG + Intronic
1128161176 15:65423414-65423436 GTCCATTCCAGCCCAGGTCCTGG + Intergenic
1128564958 15:68695071-68695093 CTCCATTCAAGGCCACCCCAGGG + Intronic
1128758062 15:70196523-70196545 GTGGATTCCAGGCCAGGCCCGGG - Intergenic
1131215335 15:90530681-90530703 GTCCATCCAGGGCCCGGCCCTGG + Intronic
1136651950 16:31680613-31680635 GTCCCTTCCAGGCCAGTCCTTGG + Intergenic
1137546184 16:49405227-49405249 GTACATTCAGAGCCAGGCCTGGG + Intergenic
1139449513 16:67018353-67018375 GTCCTTTCCAGGCCATGCCCTGG + Intergenic
1140623285 16:76762645-76762667 GGACATTGAAGGCCAGGCTGAGG + Intergenic
1146574372 17:33978673-33978695 GTCGAGTCAAGGCCAGACTGAGG + Intronic
1146743307 17:35305410-35305432 GACCATTGAAGGCCAGGAAGTGG + Intergenic
1151938943 17:77281153-77281175 GACCAGACCAGGCCAGGCCGGGG - Intronic
1158670494 18:59469659-59469681 GTCCTTTCCAGGCCAGGGCCAGG - Intronic
1160511637 18:79456407-79456429 GTTCCTTCAAGGCCAGGGGGAGG + Intronic
1160528134 18:79549048-79549070 GTCCACTCGAGGGCAGGCAGGGG + Intergenic
1168663003 19:58182663-58182685 GTCCACTCAAGGTCAGGGAGGGG - Intergenic
926456597 2:13074712-13074734 GTACAATGAAGGCCAGGCTGAGG - Intergenic
931496285 2:62810675-62810697 ATGCATTCAAGTCCAGGCCGTGG + Intronic
937754112 2:125515522-125515544 GTCAATTCAAGCTCAGGCCAAGG - Intergenic
938159452 2:128972669-128972691 GTCCACTCAAGGCCAGGGCCAGG - Intergenic
938319730 2:130355196-130355218 GTCTCTTCAAGGACAGGCCTAGG - Intergenic
939306987 2:140425030-140425052 GTCCCTCCAAGACCAGGCCAGGG - Intronic
941693358 2:168525163-168525185 GTCTGTTCAAGTCCAGGCCAAGG + Intronic
945197620 2:207251821-207251843 GACCATGCAGGGCCAGGCCCAGG + Intergenic
946180690 2:217947213-217947235 GTCCCTTCAAGGGTAGGCCTGGG + Intronic
1172244062 20:33433675-33433697 GGCCCTTGAAGGCCAGGCCTGGG - Intronic
1175773304 20:61637027-61637049 GTCCATTCGGGGGCAGGCAGGGG + Intronic
1175804360 20:61819197-61819219 GTCCCTACAGGGCCTGGCCGTGG - Intronic
1175888258 20:62304264-62304286 GCCCATGAAAGGCAAGGCCGGGG - Intronic
1176093360 20:63328699-63328721 GGCCCTGGAAGGCCAGGCCGAGG - Intronic
1181053489 22:20248615-20248637 GCCCATACAAGACCAGGCCGAGG + Intronic
1181856284 22:25783687-25783709 GTTCATTCCAAGCCAGGCCTAGG + Intronic
1183179358 22:36248332-36248354 GGCCATTCAAGGCTATGCAGGGG + Intergenic
1183191131 22:36322669-36322691 CTCCAACCAAGGCCAGGCCCCGG + Intronic
1184167115 22:42736117-42736139 TTCCATTCAAGCCCAGGACCTGG + Intergenic
1184715155 22:46277769-46277791 GTGCATTCCAGGCCGGGCAGGGG + Intronic
1184818383 22:46889819-46889841 GTCCATCCCAGCCCTGGCCGGGG - Intronic
1184876807 22:47281489-47281511 GTCCATGCAGTGCCAGGCAGGGG - Intergenic
953558895 3:43969451-43969473 TTCCAGTCAAGGTCAGGCAGAGG - Intergenic
954380151 3:50215033-50215055 GCCCACACAAGGCCTGGCCGTGG - Intronic
957916411 3:86693418-86693440 GACCATTAAAGGCCAGGAAGCGG - Intergenic
961565988 3:127763633-127763655 GTCCACTCCAGGCCAGGTCAGGG - Intronic
961829599 3:129616680-129616702 GGCCACCCAAGGTCAGGCCGAGG - Intergenic
969477261 4:7428673-7428695 GTGTGTGCAAGGCCAGGCCGGGG + Intronic
986025047 5:3842854-3842876 GTCCATTCTGGGCCAGCCAGAGG - Intergenic
986339766 5:6778989-6779011 TCCCATTCAAGGCCAGGCACGGG - Intergenic
996727542 5:126685741-126685763 GTCCTTTCTAGGCCAGGTTGTGG + Intergenic
999953244 5:156672486-156672508 GTAAATTCATGGCCAGGCCCAGG - Intronic
1001558158 5:172650286-172650308 GTCCATTCAAGGGCAGGAGATGG + Intronic
1002105254 5:176876808-176876830 GGCCCTTCAATGCCAGGCCAGGG + Intronic
1006511537 6:34524156-34524178 GTCCAGAAAAGGCCAGGCCCAGG - Intronic
1021921085 7:25485832-25485854 GTCCCTTCAAGGCCATGCTTGGG - Intergenic
1023752731 7:43387227-43387249 ATCCATTCAAAGCCAGCCCAAGG - Intronic
1024007112 7:45232710-45232732 GCCTATTCAAGGCCCGGGCGTGG - Intergenic
1029098242 7:98106295-98106317 GTCCACACAGGGCCAGGGCGGGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1036413691 8:8527155-8527177 GTCCATTCTAGGCGAGGCCAGGG + Intergenic
1039482108 8:37881865-37881887 GACAATTCCAGGCCAGGCCCTGG - Intronic
1046840227 8:118848004-118848026 GTCCATACAACAACAGGCCGTGG - Intergenic
1049978006 9:878117-878139 GTTCATTCCAGGCAAGGCTGTGG - Intronic
1053285044 9:36844814-36844836 GCCCCTTGAAGGCCAGGCTGGGG - Intronic
1055062106 9:72079840-72079862 GCCCATTCAGGGCCAGGACAAGG + Intergenic
1055822875 9:80288855-80288877 GTCCATTCATGGATAGGCAGGGG - Intergenic
1057161613 9:92892714-92892736 GGACATTGAAGGCCAGGCTGAGG - Intergenic
1057172388 9:92970821-92970843 GTGCCTTGAAGGCCAGGCAGTGG + Intronic
1057898138 9:98925823-98925845 GCCCATTCAGGGCCAGGACCAGG + Intergenic
1060939605 9:127535883-127535905 GTCCAAACAAGGGAAGGCCGTGG + Intronic
1187254118 X:17626476-17626498 GTCCATTCCAGGGCTGGCTGGGG - Intronic
1188096746 X:26032960-26032982 GTACATTGCAGGCCAGGCAGAGG + Intergenic
1188987485 X:36780485-36780507 ATCCATTCAAGGGCAGGCCCAGG - Intergenic
1192585731 X:72316908-72316930 GACCATTCAAGGCCAGGACAAGG - Intergenic
1196031582 X:111098950-111098972 GTCCATTCCAGGCCCTGCAGAGG - Intronic
1198809482 X:140521004-140521026 GAACATTGAAGGCCAAGCCGAGG + Intergenic
1199575948 X:149314005-149314027 CTCCATTAAAGGCGAAGCCGTGG + Intergenic