ID: 903545322

View in Genome Browser
Species Human (GRCh38)
Location 1:24120358-24120380
Sequence CTTCTGTCATTGTTCAAAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903545322_903545330 25 Left 903545322 1:24120358-24120380 CCACCTTTGAACAATGACAGAAG 0: 1
1: 0
2: 0
3: 18
4: 168
Right 903545330 1:24120406-24120428 GCTAGATTGTGAAACTGGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 107
903545322_903545329 20 Left 903545322 1:24120358-24120380 CCACCTTTGAACAATGACAGAAG 0: 1
1: 0
2: 0
3: 18
4: 168
Right 903545329 1:24120401-24120423 GTCGAGCTAGATTGTGAAACTGG 0: 1
1: 0
2: 0
3: 4
4: 42
903545322_903545331 30 Left 903545322 1:24120358-24120380 CCACCTTTGAACAATGACAGAAG 0: 1
1: 0
2: 0
3: 18
4: 168
Right 903545331 1:24120411-24120433 ATTGTGAAACTGGCCAGGAATGG 0: 1
1: 1
2: 4
3: 46
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903545322 Original CRISPR CTTCTGTCATTGTTCAAAGG TGG (reversed) Exonic
900547782 1:3238065-3238087 CTTCTCTCATTGGCCAAAGAGGG + Intronic
900926325 1:5708528-5708550 CTTCTGACAAGGTTCAAAGCTGG + Intergenic
903545322 1:24120358-24120380 CTTCTGTCATTGTTCAAAGGTGG - Exonic
904038763 1:27572348-27572370 CTTCTATCTTTGTACAGAGGGGG - Intronic
904913276 1:33951201-33951223 CTTGTCTCATTGCTCAAGGGAGG - Intronic
911957156 1:104251726-104251748 TTTCTCTCATTGTGAAAAGGTGG - Intergenic
917152153 1:171956918-171956940 CTCCAGTCATGGTTAAAAGGGGG - Intronic
918732615 1:188016831-188016853 CTTATGTCATTTTTTAAAGATGG - Intergenic
919071967 1:192767099-192767121 CTGCTGGAATTGTTCAGAGGAGG + Intergenic
920861593 1:209712599-209712621 CATCTCTCAGTATTCAAAGGGGG - Intronic
921696760 1:218220224-218220246 GTGCTTCCATTGTTCAAAGGAGG - Intergenic
1063219443 10:3952725-3952747 CTTCTAACATTTTTTAAAGGTGG - Intergenic
1063382294 10:5593223-5593245 TTGCTGTCCATGTTCAAAGGTGG + Intergenic
1064180810 10:13112941-13112963 TTTCTGTCATTTTTCAAACTAGG + Intronic
1064710573 10:18119964-18119986 CTGCTGTCAGTGTTCAGATGTGG + Intergenic
1066056376 10:31684901-31684923 CTTCTGCCATTGTTGAAAGCTGG - Intergenic
1069421438 10:68250055-68250077 CTTCTGTCATATTTCTCAGGTGG - Intergenic
1071614816 10:87065829-87065851 CTACTGTCATTTTGCATAGGAGG + Intronic
1072858078 10:98970785-98970807 CTTCTTTCATTTTACAAATGTGG - Intronic
1076106880 10:127830634-127830656 CTTCTGTGATTATTCATAAGGGG + Intergenic
1076560021 10:131356363-131356385 TCTCTGTCCTTTTTCAAAGGCGG + Intergenic
1077714013 11:4563387-4563409 CTTGTGCCAGTTTTCAAAGGGGG - Intergenic
1080847899 11:36042419-36042441 GTTCTGTCATTTCTCAAAGAAGG + Intronic
1088262265 11:107955325-107955347 CTTCTGTAATTGTCCAGTGGAGG + Intronic
1090810262 11:130233698-130233720 CTTCTTCCATTGTTAAAAGTAGG - Exonic
1092507011 12:9112687-9112709 CTTCTGCCATTTTACAAATGGGG + Intronic
1092830931 12:12443718-12443740 CATATGTCATTGTCCAAAAGCGG - Intronic
1093644074 12:21563105-21563127 ATTCTGTTAATGTACAAAGGGGG + Intronic
1093852343 12:24055866-24055888 TTCCTGTTAGTGTTCAAAGGTGG + Intergenic
1094168002 12:27462605-27462627 CTTCTGTCATTAATAAAATGGGG - Intergenic
1096890458 12:54765310-54765332 CTTCTCTGATTGTTCACAAGTGG - Intergenic
1097601607 12:61699535-61699557 CTGATGTCATTGTGCACAGGGGG + Intergenic
1097941573 12:65313547-65313569 CTTCTGAAACTCTTCAAAGGGGG + Intronic
1099940513 12:89182667-89182689 CTACTTTCAATGTTCAGAGGGGG - Intergenic
1101208841 12:102515830-102515852 CTTCTTTCAGTGTTAAAAGTGGG + Intergenic
1101476378 12:105052919-105052941 CTTCTCTCAGATTTCAAAGGAGG - Exonic
1101696718 12:107133997-107134019 CTACTTTCATTTTGCAAAGGAGG - Intergenic
1106870283 13:34011836-34011858 CTCCTGTCAGTGTCCAAAAGAGG + Intergenic
1107747193 13:43523149-43523171 CTTCTGTTATTCTCAAAAGGTGG + Intronic
1108716613 13:53085360-53085382 CTTCTGTTATTGTGCTATGGTGG - Intergenic
1109843395 13:67950934-67950956 CTACTGTCATTATTAAAAGCAGG - Intergenic
1109925725 13:69136102-69136124 CTTTTGTCTATATTCAAAGGTGG + Intergenic
1110167231 13:72457943-72457965 CTTCTGTCATTGTGAAGAGAAGG + Intergenic
1110344833 13:74433760-74433782 AATCTGTCATTGTTCATAGTTGG - Intergenic
1110530613 13:76593066-76593088 CTTCTTCCATTGTTAAAAGTAGG + Intergenic
1110552795 13:76827359-76827381 CTTCTTTCATTTTTCAGATGAGG - Intergenic
1117660122 14:57995444-57995466 TCTCTGTCATTGTTAAAAAGAGG - Intergenic
1119602705 14:75987560-75987582 CTGCTGTCATTTTACAAAGGAGG - Intronic
1120606276 14:86582584-86582606 CTTGTGCCAGTTTTCAAAGGGGG + Intergenic
1120853617 14:89193541-89193563 CTTCTGTTATTCATCAAAGATGG + Intronic
1127896518 15:63304725-63304747 CTTTTGTAATTGTTTAAAAGAGG + Intronic
1128569955 15:68726683-68726705 GTTCTGTCATTTGTCAAAGGGGG - Exonic
1128708306 15:69853279-69853301 CATCTGTCAGTGCTCAGAGGGGG + Intergenic
1130161743 15:81408157-81408179 CCTCTCTCCTTGTCCAAAGGTGG + Intergenic
1130869480 15:87959068-87959090 CTGCTGTCATGGCTCTAAGGTGG - Intronic
1133979728 16:10624195-10624217 CTTCTGTCATTATTTAAAAGAGG - Intergenic
1136034971 16:27532283-27532305 CTGATTTCATTGTTCACAGGGGG - Intronic
1138629303 16:58280754-58280776 CTTCTGTCTTTTATCACAGGGGG - Exonic
1139287653 16:65829978-65830000 TTGCTGTCATGGTTCAAGGGGGG + Intergenic
1143796376 17:9340238-9340260 CTTCTCTCATTTATCAAAGCTGG + Intronic
1144100636 17:11939329-11939351 CTTCAGTCAAGGTTCAAAGAAGG + Intronic
1144214066 17:13039248-13039270 CTTCTGGGATTGTTCAGAGTTGG - Intergenic
1145847313 17:28051911-28051933 CTTCTAAAATTGTTTAAAGGAGG + Intronic
1146309589 17:31756962-31756984 CTTCTGTCCTGGTTCATAGATGG - Intergenic
1148113798 17:45162728-45162750 TTTCTGTTGTTGTTCAAAGCAGG + Exonic
1152041246 17:77905269-77905291 TTTCTGTCATTTTGCAAAGAGGG + Intergenic
1155016523 18:21846526-21846548 CTCCTGTCATTGTTTCAAGTTGG + Intronic
1156819173 18:41351404-41351426 CTTCAGTCACAGTTAAAAGGTGG + Intergenic
1157552726 18:48592689-48592711 CTTTTGTCATTGTTAACAGTTGG + Intronic
1157927429 18:51781426-51781448 CTTCTGTGGCTATTCAAAGGAGG - Intergenic
1160319380 18:77875937-77875959 CTTTTGTGATGGTTTAAAGGAGG + Intergenic
1167669111 19:50839370-50839392 CTTCTGCGTTTGTTCATAGGAGG + Intergenic
927344546 2:22022584-22022606 CTCATTTCATTGTTCAAATGTGG - Intergenic
929754790 2:44755771-44755793 CTACTGTCCTTGCTCAGAGGGGG - Intronic
930875517 2:56211152-56211174 TTTTTGTCAGTGTTCATAGGAGG + Intronic
930972814 2:57418107-57418129 CTTAAGTCATTGTTCATGGGAGG + Intergenic
931644599 2:64410477-64410499 ATTCTGTCACTGTCCAAAGGCGG + Intergenic
932363939 2:71134772-71134794 TTCCTGTCTTTTTTCAAAGGAGG - Exonic
932436795 2:71706490-71706512 CTTCTGGCCATGGTCAAAGGGGG - Intergenic
933555884 2:83830183-83830205 CTCCTGTCATTTTTCAATGGAGG - Intergenic
933875486 2:86616781-86616803 CTTTTGTCATAGTTCAAAGAAGG - Intronic
935286227 2:101565999-101566021 ATTCAGGAATTGTTCAAAGGGGG - Intergenic
937896231 2:126978536-126978558 CTTATGTAATTGTTTAAAGCAGG - Intergenic
938166185 2:129028986-129029008 CCTCTTTCCTTGTTCAGAGGAGG + Intergenic
938749075 2:134311628-134311650 CTTCTGCCAATGCTTAAAGGTGG - Intronic
939427936 2:142064921-142064943 CTTCTGTCATTGTTACATGGAGG - Intronic
940936887 2:159506016-159506038 TCTCTGTCATTGTTGACAGGAGG - Intronic
941065823 2:160901572-160901594 CTACTTTCATTGTTCAGAGTGGG - Intergenic
941383758 2:164827775-164827797 CTGCTGTAATTATTCAAATGGGG + Intronic
945959032 2:216113080-216113102 CTTCTTTGCTTGTTCAAATGGGG - Exonic
947163450 2:227237560-227237582 CTGCTGTCATAGTTAAAAAGTGG - Intronic
948447951 2:238048128-238048150 CTTTTGTCATTGTTCCATTGAGG - Intronic
1170419482 20:16178549-16178571 AGCCTGTCATTGTCCAAAGGGGG + Intergenic
1170854712 20:20040581-20040603 CTTCTGTCACTCTTTAAAGTAGG + Intronic
1172763059 20:37335765-37335787 CTTCTCTCATTGGTAAAACGGGG - Intergenic
1178456631 21:32760255-32760277 CCTCTTTCATTGATCAAAGGTGG - Intronic
1181620004 22:24084560-24084582 CTTCTGTCTTTTTTTCAAGGTGG + Exonic
1182146064 22:27997499-27997521 CTGGTGTCATTTTCCAAAGGTGG - Intronic
1182948893 22:34352672-34352694 CTTCTGTCATTTTCTAGAGGAGG + Intergenic
1184230264 22:43154946-43154968 CTTCTGGCACCGTTCAGAGGTGG + Intronic
1184579270 22:45402889-45402911 CTTCTTTCAGTTTACAAAGGAGG - Intronic
949995565 3:9613896-9613918 CCTCTCTCCTTGTTCTAAGGAGG - Intergenic
950080386 3:10217931-10217953 CTTCCCTCATTTTTCAAAAGAGG + Intronic
950366564 3:12489788-12489810 CTTCTGCCATTTTTCAGAGGAGG - Exonic
950389193 3:12683226-12683248 CTGCTCTCATTGTATAAAGGTGG - Intergenic
951031514 3:17887098-17887120 CTTCTGTCATTTTTCAGCTGTGG + Intronic
951378676 3:21955834-21955856 ATTCTTTCATAATTCAAAGGAGG + Intronic
953118480 3:40015990-40016012 CTTTTGGCATTGGGCAAAGGTGG + Intronic
954642455 3:52109154-52109176 ATTGTGTCATTGTTCAAATAAGG - Intronic
954966581 3:54616805-54616827 ATTCTCTCATTCTTAAAAGGAGG + Intronic
955660874 3:61297792-61297814 TTTCTGTCACTTTTTAAAGGTGG - Intergenic
956570004 3:70683585-70683607 CTCCTGTCATAGTACCAAGGTGG + Intergenic
958124214 3:89334531-89334553 CATCTGTCATTTTTTAAATGAGG + Intronic
960839415 3:121941118-121941140 CTTCTGTCATTGGAGAAAGGTGG - Exonic
963863561 3:150335606-150335628 ATTCTCTCTTTGTTAAAAGGAGG - Intergenic
964329795 3:155589775-155589797 CTGCTGTCATTGCTAAAAAGAGG - Intronic
965185913 3:165463231-165463253 CTTCTATCATTTTTCAAACATGG + Intergenic
967221116 3:187248913-187248935 CTCCTGCCATTGTCCCAAGGGGG - Intronic
967411301 3:189169033-189169055 CTTCTGCCATTTTTCAAATGGGG - Intronic
970172045 4:13300056-13300078 CTGCTGTCATGGTTCACATGCGG + Intergenic
970986756 4:22167823-22167845 ATTCTGTCATTGTACAAATATGG - Intergenic
972257172 4:37369645-37369667 CTTCCTTGATTGTTTAAAGGAGG - Intronic
973946956 4:55967468-55967490 TTTCTCTCAATGTTCAAAGAAGG - Intronic
974622165 4:64371060-64371082 CTTCTGTGATTATTCAATGTGGG - Intronic
974764661 4:66327893-66327915 CTTGTTTCCTTGTTCATAGGTGG - Intergenic
974932957 4:68381013-68381035 CTTTTGTGATTATTCAAAGGAGG - Intergenic
975158647 4:71100517-71100539 CTTGTGTCAGTTTTCAAGGGGGG - Intergenic
975371587 4:73595034-73595056 CTTCTGACACTGTTTAAAAGGGG - Intronic
976365911 4:84231790-84231812 CTTCTGGCATTGGTCAAAATAGG + Intergenic
981584249 4:146284201-146284223 CTTCTGTCAGAGTTCAGAGCAGG - Intronic
983351328 4:166594145-166594167 CTTCTGTGATCCTTCACAGGAGG + Intergenic
983590622 4:169407056-169407078 CTTCTCCCAGTTTTCAAAGGTGG - Intronic
986282203 5:6332791-6332813 CATCTGCCTTTGTTCCAAGGAGG + Intergenic
986525529 5:8670324-8670346 TTTCTTTCATTGTTCAAAGCAGG + Intergenic
988260237 5:28876563-28876585 CTTGTGCCAGTTTTCAAAGGGGG + Intergenic
990455781 5:55986185-55986207 CTTCTATCATTGTTCAAAAAGGG + Intronic
991014861 5:61920371-61920393 GTTGTGTCATTGGACAAAGGAGG + Intergenic
991131947 5:63132613-63132635 CATCTCTCATTGTTAAAAGTAGG + Intergenic
994243424 5:97450370-97450392 CTTCTTTCATTGTTCACAGATGG + Intergenic
1000854782 5:166384509-166384531 CCTCTCTAACTGTTCAAAGGAGG - Intergenic
1001953448 5:175831959-175831981 CTTCTGACACTGTTCTAAAGAGG + Intronic
1003633457 6:7809573-7809595 TTTCTGGCATTCTTCAGAGGAGG - Intronic
1005362678 6:25046032-25046054 ATTCTGTCATTGATCAGTGGAGG - Intergenic
1005468604 6:26140148-26140170 CTTCTGTCCATTTTCAAATGTGG + Intergenic
1007330403 6:41102310-41102332 ATTGACTCATTGTTCAAAGGGGG + Intergenic
1007497954 6:42274375-42274397 CTTCTTTCATTGAACAAATGAGG - Intronic
1007604718 6:43109018-43109040 TTTCTAACATTCTTCAAAGGTGG + Intronic
1009370866 6:62900798-62900820 TTTCTCTCATTATTCCAAGGAGG - Intergenic
1009478436 6:64125011-64125033 CTTTTGTCTTTGTTCAATGGGGG - Intronic
1014096928 6:117471128-117471150 CATCTGCAATTGTTCAATGGTGG + Intronic
1014717990 6:124887924-124887946 CTTCTGTCCTTGTGATAAGGAGG + Intergenic
1015905204 6:138109416-138109438 CCTCTTTCAATGTTCAAAAGTGG - Intergenic
1016300754 6:142628722-142628744 TTTCTGTCATTCTCCAGAGGTGG - Intergenic
1018060402 6:160085604-160085626 TTTCTTTCATTATTTAAAGGAGG + Intronic
1019056375 6:169226296-169226318 CATCTGTAAGTGTTTAAAGGGGG + Exonic
1021534644 7:21689551-21689573 CTTCTCCCATTGTACACAGGAGG - Intronic
1024256374 7:47543044-47543066 CCTCTCTCCTTGTCCAAAGGTGG + Intronic
1024364808 7:48508636-48508658 CTACTGTCATTGTTCTCTGGTGG + Intronic
1025282657 7:57639395-57639417 TTTCTGTCTCTGTTCAAAGCTGG + Intergenic
1027433574 7:78140112-78140134 CTTCAGTCACTGGTCAAAGTGGG + Intronic
1027445691 7:78271034-78271056 CTTGTGCCAGTTTTCAAAGGGGG + Intronic
1028876185 7:95825825-95825847 GCTCTGTCATTCTCCAAAGGTGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030835726 7:114282441-114282463 ATTCAATGATTGTTCAAAGGAGG - Intronic
1030898034 7:115085791-115085813 ATTCTCTCTCTGTTCAAAGGTGG - Intergenic
1031324182 7:120371348-120371370 CTGCTGACATTTTCCAAAGGTGG + Intronic
1034326939 7:150245076-150245098 CTTCACTCATTGTTGAAAGAGGG - Intronic
1034766268 7:153724375-153724397 CTTCACTCATTGTTGAAAGAGGG + Intergenic
1034880501 7:154759051-154759073 CTTCTGTCCTTTTTCTAAAGAGG - Intronic
1035340414 7:158157205-158157227 CTTCTGCCATGGCTCCAAGGGGG - Intronic
1035655971 8:1305200-1305222 CTACTTTCATTTTTTAAAGGAGG - Intergenic
1039102346 8:33954138-33954160 CTTGTGTCAGTTTTCAAGGGGGG + Intergenic
1040593061 8:48814007-48814029 TTTCTGTGAATGTTCACAGGTGG + Intergenic
1046321585 8:112584004-112584026 TTTGTGTCATTTGTCAAAGGTGG - Intronic
1047223909 8:122940683-122940705 CCTCTGGGAGTGTTCAAAGGAGG - Intronic
1049482728 8:142834673-142834695 CATCTGCCAGTGTTCAAAGGTGG - Intronic
1049624486 8:143613896-143613918 CTGCTGTCCTTGTTCAGTGGGGG + Intronic
1050875279 9:10626961-10626983 CTTCTTTAAGTGTTCAAAGTAGG + Intergenic
1052323788 9:27195660-27195682 CTTATGTCACTGGACAAAGGAGG - Intronic
1055835666 9:80438084-80438106 CTGAAGTCAATGTTCAAAGGTGG - Intergenic
1057367876 9:94440782-94440804 ATTTCATCATTGTTCAAAGGGGG - Intronic
1190577654 X:51857033-51857055 CCTTTGTCAGTGTTCAAGGGAGG + Intronic
1193016441 X:76738981-76739003 CTTCTGTCTTTGGAGAAAGGAGG + Intergenic
1194487267 X:94500194-94500216 CATCTGTTGTTGTCCAAAGGTGG - Intergenic
1197346921 X:125335471-125335493 ATTCTGTGACTGTTCTAAGGTGG + Intergenic
1201866352 Y:18659632-18659654 CTGCTTTCATTCTTCAATGGCGG + Intergenic
1202028363 Y:20548521-20548543 TTTCTGTCATGGTACAAGGGTGG - Intergenic