ID: 903545672

View in Genome Browser
Species Human (GRCh38)
Location 1:24121977-24121999
Sequence TGGGCTCTGGTTTCTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903545667_903545672 3 Left 903545667 1:24121951-24121973 CCTGGGTTATCTCAGGGAGAGAG 0: 1
1: 0
2: 2
3: 24
4: 184
Right 903545672 1:24121977-24121999 TGGGCTCTGGTTTCTCCAGGAGG 0: 1
1: 1
2: 1
3: 40
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903545672 Original CRISPR TGGGCTCTGGTTTCTCCAGG AGG Intronic
900934440 1:5756254-5756276 TGTGCTGTGGGTTCTGCAGGCGG - Intergenic
901063450 1:6484489-6484511 TGGGCTCATGGTTCTCCCGGGGG - Intronic
902551161 1:17220356-17220378 GGGGGTCTGGTTTCTCCAGAGGG + Intronic
903190393 1:21652645-21652667 TGGGCTCTGAGTTCTGCAGCAGG + Intronic
903257684 1:22113872-22113894 TGGGGTCTGGGTTCTCCCAGTGG + Intergenic
903330830 1:22596269-22596291 TGGGCTCTGGTTTTTTCACTGGG - Intronic
903382946 1:22909347-22909369 AGGACTCTGGACTCTCCAGGGGG + Intronic
903545672 1:24121977-24121999 TGGGCTCTGGTTTCTCCAGGAGG + Intronic
904912536 1:33946093-33946115 TGAGCACTGGTTTCTTCAAGAGG - Intronic
905690873 1:39941699-39941721 TGTGCTCTGGTGGCTCGAGGTGG - Intergenic
905777512 1:40678543-40678565 TGGGCTCTGGAATGACCAGGTGG - Intergenic
905865371 1:41373627-41373649 TGGGCTCTGCTTTCTCTGGGGGG + Intronic
906799797 1:48726737-48726759 TGGCCTCTGGTTTCTCTAATGGG - Intronic
908007115 1:59738506-59738528 TGGGCCCTGGTGACTCCAGGTGG - Intronic
909695515 1:78464626-78464648 TTGTCTCTGGTTTCACAAGGGGG + Intronic
909800891 1:79806179-79806201 TGGGCTCTGGTGTCTGGAAGAGG + Intergenic
913183413 1:116344583-116344605 TGGCCTCAGGTTTCACCAGATGG + Intergenic
913333346 1:117685345-117685367 TCCTCCCTGGTTTCTCCAGGTGG - Intergenic
915311920 1:155009301-155009323 GGGGCTCAGGTTTCTGCTGGCGG + Intronic
916482630 1:165228813-165228835 TGGCCTCTGGTTTTTGCATGTGG - Intronic
917580099 1:176368238-176368260 TGGGCTCTGGTCTTCCGAGGTGG + Intergenic
918388532 1:184036090-184036112 TGGGCTCTGTCTTCCTCAGGGGG + Intronic
919262772 1:195218817-195218839 TGGGCACTGGTTTCTTGACGAGG - Intergenic
919516817 1:198535157-198535179 TGGGCTTTCATTTCTTCAGGTGG - Intronic
920403799 1:205694004-205694026 TGGGCTTAGTTTTCTCCAGAAGG - Intergenic
920764347 1:208817576-208817598 TTCTCTCTGGTTTCACCAGGAGG + Intergenic
922798874 1:228354906-228354928 TGGGCTCTCCTCTCTCCAGGGGG + Intronic
923280917 1:232442055-232442077 TGGGATCTGGTTTAACCAGAGGG + Intronic
924043878 1:240009206-240009228 TGGACTCTGGGTGCTCCAGCTGG - Intergenic
924167919 1:241304533-241304555 TGGGCTCTGGGTGCTACAGCTGG + Intronic
1063443140 10:6089357-6089379 CGGGCGCTGGTCTCTCCACGCGG + Exonic
1065358788 10:24869569-24869591 TGGGCTCTGGCTACTTCTGGTGG + Intronic
1067180214 10:43979702-43979724 AGGGTCCTGGATTCTCCAGGTGG + Intergenic
1067349844 10:45465694-45465716 TTGGATCTTGTTTCTTCAGGTGG - Intronic
1069899864 10:71701212-71701234 TGGGCTCTGCTTTCTCCTTGTGG + Intronic
1069908429 10:71745777-71745799 AGGTCTCTGGTTGCTCTAGGAGG - Intronic
1071015998 10:80997721-80997743 TTGGCTGTGGTTTCTCCTGATGG + Intergenic
1073461238 10:103667119-103667141 TGGGCCTTGGTTTCTCCATCTGG - Intronic
1074311505 10:112326917-112326939 GGGGCAATGGTTGCTCCAGGTGG + Intergenic
1074859527 10:117499758-117499780 AGGGCTCTGGGCTCTCCAGTGGG + Intergenic
1075604683 10:123796048-123796070 TGGGCACAGGTATCTTCAGGAGG - Intronic
1076108955 10:127846486-127846508 TGGGTTCTGGGGACTCCAGGTGG - Intergenic
1076413825 10:130270918-130270940 TGGGTGCTGGCCTCTCCAGGCGG + Intergenic
1076534441 10:131167718-131167740 TGGGCCCTGGTTTTTCCAGGGGG + Intronic
1077026743 11:443003-443025 TCGGCTCTGGTTTCCCCAAGGGG + Intergenic
1080900265 11:36483230-36483252 TGGGCTGTGGTTTCTGCCCGGGG - Intergenic
1081391673 11:42536959-42536981 TGGACTGTGGTTTTACCAGGAGG + Intergenic
1081554047 11:44141087-44141109 TGAGTTCTGGTATCTGCAGGAGG - Intronic
1083010617 11:59394722-59394744 TGGACACTGTTTTCTCCAGCAGG - Intergenic
1083257052 11:61503030-61503052 TGGGCTCTGGTTTCTTAGGCAGG + Intergenic
1083400278 11:62418684-62418706 TGGGCCTCAGTTTCTCCAGGTGG + Intronic
1083946810 11:65928151-65928173 AGGGCCCTGGTTCCTCCAGGGGG + Intergenic
1084301256 11:68254128-68254150 TAGGCTCTGCTTTCCCCAAGGGG - Intergenic
1084494376 11:69495611-69495633 TGGGCTTTGAATTATCCAGGTGG - Intergenic
1084589400 11:70081668-70081690 TGGGCTCTGGTTTCTTCCGCTGG - Intronic
1084659516 11:70538688-70538710 GGGGCTCTGCCTGCTCCAGGGGG + Intronic
1085389657 11:76175927-76175949 TGGGCTTCTGTTTCTCCATGTGG - Intergenic
1085787548 11:79468180-79468202 TGGGCTCTGTTTTCTCCACAAGG - Intergenic
1086103900 11:83129065-83129087 TGGTGTCTGGGTTCTCAAGGTGG - Intergenic
1087965500 11:104407978-104408000 AGAGCTCTGGTTTCTCCATAAGG - Intergenic
1089317459 11:117601746-117601768 TGGGACCTGGCTTCTCCAGCAGG + Intronic
1090255244 11:125279255-125279277 TGGGCCGTGGTATCTCCTGGAGG + Intronic
1092210640 12:6644142-6644164 AGGGTTTTGGTTTCTCCAGTAGG + Exonic
1093638045 12:21494703-21494725 TGTCCTCTGGATTCTCCTGGGGG - Intronic
1094736092 12:33235555-33235577 TGAGCTGTGTTTACTCCAGGGGG + Intergenic
1096747586 12:53738736-53738758 TGGGCGGGGCTTTCTCCAGGTGG + Intergenic
1101721028 12:107350930-107350952 TGGGAGTTGGTTTCTCGAGGTGG - Intronic
1102931164 12:116863384-116863406 TGGGACCTGGAGTCTCCAGGAGG - Intronic
1103233367 12:119351004-119351026 TGTTCTCTGGATTTTCCAGGAGG + Intronic
1103451701 12:121033740-121033762 GGGGCTCTGTGTTCTGCAGGTGG - Exonic
1103894182 12:124262219-124262241 TTGGCTCAGGTGTCTCCAGAGGG + Intronic
1104905974 12:132213743-132213765 TGGCCTCTGCATTCTCCAGGTGG + Intronic
1106092577 13:26610441-26610463 TGGGCTTTGGTTTTACCAGGGGG + Intronic
1106478681 13:30119901-30119923 TGTGCTCTGCTTTCTCCCTGGGG - Intergenic
1109609858 13:64750435-64750457 TTGGCTCTAGTTCCTCCTGGCGG + Intergenic
1112364949 13:98748681-98748703 TGGGCCCTGGCTTGTCCATGTGG - Intronic
1112390744 13:98981776-98981798 TGGGATGTGGTTTCTCCAAAGGG + Intronic
1114563140 14:23607775-23607797 GGGGCGCTGGTATCTCCAGGAGG + Intergenic
1117071715 14:52063405-52063427 CAGGCTCTGGTTTCTGCAGAGGG - Intronic
1117625763 14:57636204-57636226 TGGGCGCTGACTCCTCCAGGTGG + Intronic
1119566654 14:75634891-75634913 GGGGTTATGGTTTCCCCAGGGGG + Exonic
1120222264 14:81747567-81747589 TGTTCTCTTGTTTCCCCAGGAGG - Intergenic
1121053713 14:90836490-90836512 TGGGCTGTGGTTTCTACACGGGG - Intergenic
1121232972 14:92372001-92372023 TGGGCTCTGGTTCCTCCCCTTGG + Intronic
1121459392 14:94062501-94062523 TCAGTTCTGGTCTCTCCAGGTGG + Exonic
1122033786 14:98933070-98933092 TGGGCTCTAGCCTCTCCAGCTGG - Intergenic
1122131597 14:99606961-99606983 TGGGCTGTGAGTACTCCAGGGGG - Intergenic
1122697302 14:103562397-103562419 TGGTCTCTGGTGTCTCCGGCCGG - Intronic
1123059744 14:105589118-105589140 TGGGCTCAGGGCTCTGCAGGTGG + Intergenic
1123084066 14:105709367-105709389 TGGGCTCAGGGCTCTGCAGGTGG + Intergenic
1123472442 15:20565291-20565313 TGGGCTCTAGTTTCTCCTTGGGG + Intergenic
1123645562 15:22435062-22435084 TGGGCTCTAGTTTCTCCTTGGGG - Intergenic
1123732747 15:23160282-23160304 TGGGCTCTAGTTTCCCCTTGGGG + Intergenic
1123750880 15:23357662-23357684 TGGGCTCTAGTTTCCCCTTGGGG + Intronic
1123940864 15:25216023-25216045 GGAGCAATGGTTTCTCCAGGAGG + Intergenic
1124283251 15:28381578-28381600 TGGGCTCTAGTTTCCCCTTGGGG + Intronic
1124299448 15:28530035-28530057 TGGGCTCTAGTTTCCCCTTGGGG - Intronic
1124976572 15:34532781-34532803 TGGGCTCCGGTTTCCCCTTGGGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126658870 15:51011451-51011473 TGGGCTCTAGTCTCTCCATTTGG - Intergenic
1126847397 15:52773607-52773629 TGAGCCCTGGTTTATCCTGGTGG - Intronic
1127775548 15:62261758-62261780 TGGGCTTGCGTTTCTCAAGGAGG - Intergenic
1129838918 15:78731432-78731454 TGGGCTCATGTTTCTGGAGGAGG + Intergenic
1131214909 15:90529222-90529244 TGAGCGCTGGTTTCCCAAGGTGG + Intergenic
1131683528 15:94748251-94748273 TGGGCTCTTGTTTCTGAATGAGG - Intergenic
1132153869 15:99481536-99481558 TTGGCTCTGGCTTCTCCTGGTGG - Intergenic
1132320151 15:100919503-100919525 CGGGCTCTGGGTTCCCCGGGCGG - Intronic
1132344898 15:101102267-101102289 TGGGCACTGAGCTCTCCAGGAGG - Intergenic
1132882410 16:2168221-2168243 TGGGACCTGGTTCCCCCAGGAGG - Intronic
1132975146 16:2707214-2707236 TGGGCTCTGTTTTCTGGAGCAGG + Intronic
1133165949 16:3947277-3947299 TGGGTTCTTGTTTCTCCCGGAGG + Intergenic
1133796841 16:9053134-9053156 GGGGCTCTGCTTTCTCCATCAGG + Intergenic
1133821383 16:9239768-9239790 TGATCCCTGGTTTCTCTAGGTGG + Intergenic
1134197917 16:12173223-12173245 TGGGTTCTGGTTCCAACAGGCGG + Intronic
1134604450 16:15559318-15559340 AGAGCTCTGATTTGTCCAGGAGG - Intronic
1137713944 16:50586263-50586285 TGGGATCTGGTTAGTCAAGGTGG + Intronic
1138546078 16:57720633-57720655 CGGGGTCTGGTTTTTCCTGGGGG - Intronic
1138727368 16:59154543-59154565 TTGCCTTTGGATTCTCCAGGGGG + Intergenic
1140029764 16:71326327-71326349 TGGGCTCTGGTTGCTGTAGCAGG - Intergenic
1140487567 16:75305829-75305851 TGGGCCCTGTTTTTTCCAGGAGG + Intronic
1141492942 16:84387168-84387190 TGGGCACTCGTATCTCCTGGAGG + Intronic
1141499825 16:84436350-84436372 TGGGCTCTGGGATCGCCACGTGG + Intronic
1141620951 16:85236154-85236176 CGGGCTCGGGTTTCTCCTGGTGG + Intergenic
1141685096 16:85565656-85565678 TGGGCACTGGCATCCCCAGGAGG - Intergenic
1142064812 16:88055683-88055705 TGGCCTCTTGTATTTCCAGGAGG + Intronic
1142597412 17:1036300-1036322 TGGGCTCTGGACTCTCTGGGCGG - Intronic
1143501483 17:7342037-7342059 TGGGCTCTGGTGGACCCAGGCGG - Exonic
1143996230 17:11008712-11008734 AGGGCTAGGGGTTCTCCAGGGGG + Intergenic
1144734151 17:17545503-17545525 TGGGCTGTGGCTTCTCCAGTGGG - Intronic
1144946302 17:18971265-18971287 TGGGCTCTGGTAGGCCCAGGCGG + Exonic
1145303049 17:21654061-21654083 TGGGGTCTGGTGTCTGCATGGGG - Intergenic
1145398310 17:22512707-22512729 AGGGCTCTGCTTCCTCCAGCAGG + Intergenic
1146342823 17:32036594-32036616 TGGACTTTGGTATCTGCAGGGGG + Intronic
1146398076 17:32484498-32484520 TGGGCCCAGGTTTTTCTAGGGGG + Intergenic
1148300276 17:46541845-46541867 TGGACTTTGGTATCTGCAGGGGG + Intronic
1149474346 17:56946976-56946998 TGCCTTCTGGTTTCTCCTGGGGG - Intronic
1149646911 17:58247684-58247706 TGGCCTCTGCTTTCTCCTGTGGG - Intronic
1151658473 17:75506710-75506732 TGGGCACTGGGTGCTGCAGGTGG - Exonic
1152046158 17:77937191-77937213 TGGGTACTGGGGTCTCCAGGGGG - Intergenic
1152946016 17:83197625-83197647 AGGGCTCTGAGTTCTCCATGAGG + Intergenic
1153861606 18:9215713-9215735 TGGACACAGTTTTCTCCAGGAGG - Intronic
1154030561 18:10749966-10749988 TGGGGTCAGTTTTCTCCAGATGG - Intronic
1155691755 18:28633352-28633374 TGGGTTCTGGTTTCTCCCCATGG - Intergenic
1155873292 18:31053690-31053712 TGGGCTGTGTTTTCATCAGGAGG + Intergenic
1157295846 18:46442280-46442302 TGGGCTCTAGCTTCTTAAGGCGG + Intronic
1158951627 18:62500333-62500355 TGGGCTCTGGACTCCCCAGCTGG - Intergenic
1160805335 19:990051-990073 TGGGGTCTGGTTTGTTCTGGGGG + Intronic
1161108426 19:2455814-2455836 TGGCCTCGGGGATCTCCAGGGGG - Intronic
1162470660 19:10870842-10870864 CGGGCTCAGGTTGCTCCTGGAGG + Intergenic
1162812227 19:13171206-13171228 CGGCCTGTGGTTTCTCCATGTGG + Intergenic
1163645173 19:18485225-18485247 TGGGCTCTCCTCTCCCCAGGAGG + Intronic
1164463175 19:28465560-28465582 GGGGCTCTGGCCTCTCCTGGGGG - Intergenic
1165677563 19:37740763-37740785 TGGGTTTTGGTATCTGCAGGAGG - Intronic
1165761002 19:38321094-38321116 TGAGATGGGGTTTCTCCAGGGGG - Intronic
1166204658 19:41261711-41261733 TGGACTCTGGTGCCTCCAGAGGG + Exonic
1167705619 19:51079387-51079409 TGGGCTCCTGGGTCTCCAGGAGG - Intronic
1168011568 19:53537674-53537696 GGGGCTCTGGTTTCCCCCGACGG + Intronic
1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG + Intergenic
1168242839 19:55095913-55095935 AGGGTTCTGGGTTCTGCAGGGGG + Exonic
1168294723 19:55373101-55373123 TGGGCTCTGGTCCCTGTAGGTGG - Intergenic
925114320 2:1365705-1365727 TGGGCTCTGGCTGGTCCAGCTGG + Intronic
925443018 2:3904667-3904689 TGGCTTCTGGCTTCTCAAGGTGG + Intergenic
925947665 2:8880614-8880636 TGGACTTCGTTTTCTCCAGGTGG - Intronic
926203058 2:10814947-10814969 TGGCCTCTGTTTTCTCCACGAGG - Intronic
927277687 2:21275489-21275511 TGGGCCCTGTTGTCTCCAGGTGG - Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
929226192 2:39513907-39513929 AGGGCACTGGTTTCTCCCTGAGG + Intergenic
930245667 2:48980805-48980827 TGGGTTCTGATTTCTTCAGTTGG + Intronic
930879045 2:56251217-56251239 AGGGCTCTGTTTTCTCCTGTAGG + Intronic
933248146 2:79998822-79998844 TGCACTGTGGTTTCTCCTGGGGG - Intronic
933893117 2:86789251-86789273 TTGGCTCTGCTAGCTCCAGGCGG - Intronic
935054157 2:99551429-99551451 TGGGCTCTGGTCTCCACAGATGG - Exonic
935595012 2:104871709-104871731 TGGGCTTTAATTTCTCCAGATGG + Intergenic
935695126 2:105764536-105764558 TTGGCTCTGGTCTTCCCAGGTGG + Intronic
937160111 2:119752453-119752475 TGGGCCCTGGTGGCTCCATGGGG + Intergenic
937295375 2:120806910-120806932 GGGTGTCTGGTTTCTCCATGGGG - Intronic
938033717 2:128018059-128018081 TGGGCACTGGATTCTCCTGATGG + Intronic
938284760 2:130102605-130102627 TGGGCTCTGGCTTCTCAGGCAGG - Intronic
938335401 2:130491165-130491187 TGGGCTCTGGCTTCTCAGGCAGG - Intronic
938764811 2:134453709-134453731 TGGGGTTGGTTTTCTCCAGGAGG - Exonic
939008634 2:136819382-136819404 TGGGATTGGGTTTGTCCAGGTGG + Intronic
943211882 2:184977451-184977473 TGGGCCCTTGTTTCTCCTTGAGG + Intergenic
947462543 2:230315808-230315830 TGCCCTCTGGTATCTCCTGGTGG + Intergenic
947471652 2:230406321-230406343 TGCCCTCTGGTATCTCCTGGTGG + Intergenic
948560279 2:238847481-238847503 TGGGCACGGGCGTCTCCAGGGGG + Intergenic
1171339848 20:24419365-24419387 GGGGCTCTGGTTTCTCCAGGTGG - Intergenic
1171823622 20:29876237-29876259 AGGGCTCTGGACTCTCCAGGCGG - Intergenic
1172901831 20:38340791-38340813 TGGGCTCTGGAGTCACCTGGCGG + Intergenic
1173055978 20:39613276-39613298 GGGGCTGTGGCTTCTCCAGCCGG - Intergenic
1173163325 20:40668760-40668782 TGGACTCTGCTCTCTCCAGGCGG - Intergenic
1173521022 20:43700464-43700486 TGGGTTCTGGTTACTCAGGGTGG + Intronic
1175054356 20:56184856-56184878 TGGGCTCTGTTTTCTGCCGTTGG - Intergenic
1176035348 20:63033694-63033716 TGTTCTCTGGTGTCTCCAGGGGG + Intergenic
1176275013 20:64260460-64260482 TGGGCCCCGGATTCTCCAGAGGG + Intronic
1176519266 21:7812591-7812613 TGGCCCCTGGTTTCTTCATGAGG - Intergenic
1178653294 21:34442604-34442626 TGGCCCCTGGTTTCTTCATGAGG - Intergenic
1178784588 21:35641694-35641716 TGGGGTCTGGAATATCCAGGTGG - Intronic
1178980266 21:37257856-37257878 TGGGCTCTGCTGCCTCCGGGTGG + Intronic
1181125514 22:20699722-20699744 TGGTTTCTGGTTTCCCCAGATGG + Intergenic
1181280483 22:21716396-21716418 TGGTTTCTGGTTTCCCCAGATGG - Intronic
1181311768 22:21948804-21948826 TGGGCAGGGGTTTCTCCAGGGGG - Intronic
1183030065 22:35097120-35097142 TGGGCTCTGATTTGTGTAGGTGG - Intergenic
1183966424 22:41445552-41445574 GGGGTTCTGGTTTCTCCTGGGGG + Intronic
1184220724 22:43098095-43098117 TGGGCCTTGGTTTCTCCATCAGG + Intergenic
1184401977 22:44279709-44279731 TGGGCTCCTGTCTCTTCAGGTGG + Intronic
949120683 3:380358-380380 TGGGCTCTTTCTTCTCCAAGTGG - Intronic
950526428 3:13526785-13526807 GGTGGTCTGGTGTCTCCAGGTGG + Intergenic
951539272 3:23766819-23766841 TAGTCTCTCGTCTCTCCAGGAGG + Intergenic
953919136 3:46939943-46939965 TAGGCTCTGCTTTGCCCAGGGGG - Intronic
954716683 3:52530319-52530341 TGGGCTCTGGGGTCCCAAGGAGG + Intronic
955769065 3:62371760-62371782 AAGGCTCTGGTTTCTGAAGGGGG - Intronic
956219109 3:66883472-66883494 TAGGTTCAGCTTTCTCCAGGAGG - Intergenic
956519404 3:70087083-70087105 TGGCCTTTGCTTTCTCCAGGAGG + Intergenic
958153646 3:89725165-89725187 TGGGCCCTGGTGTCTCTAGCTGG - Intergenic
961106796 3:124249517-124249539 TGGGCTCAGGGTCCTCCAGCTGG + Intronic
961538111 3:127582215-127582237 GGGGCTCAGGTTGCTCCAGTGGG + Intronic
962166306 3:133052721-133052743 GGGGCTCAGTTTTCTCAAGGGGG + Intronic
965165301 3:165188954-165188976 TGGGCTGGGGATTCTCCAGCTGG + Exonic
966246391 3:177812779-177812801 TGGGCTCTGCTTTCTCCCTTGGG + Intergenic
966953506 3:184847805-184847827 TCACCTCTGATTTCTCCAGGAGG - Intronic
967894778 3:194387026-194387048 GGGGGTCTGGTATATCCAGGAGG + Intergenic
969314619 4:6374254-6374276 TGCTTTCTGTTTTCTCCAGGCGG + Intronic
969336580 4:6513826-6513848 TTGGCTCAGTTTTCTCCAGTGGG + Intronic
971847382 4:31937004-31937026 TGGACTCTGGGGACTCCAGGTGG + Intergenic
972336718 4:38113416-38113438 TGGGCTCTGGTTTCTGTGTGAGG + Intronic
977317480 4:95468539-95468561 TGGGCACAGTTTTCTCCAGCAGG + Intronic
978308643 4:107361161-107361183 TAAGCTCTGGGCTCTCCAGGGGG - Intergenic
980802819 4:137774684-137774706 TGCTCTCTGGTTCTTCCAGGGGG - Intergenic
985445465 4:190019051-190019073 AGGGCTCTGGACTCTCCAGGCGG - Intergenic
985864516 5:2503776-2503798 TGGGCTGTGGTCTCCCCAGGAGG - Intergenic
989998758 5:50867451-50867473 TGGGCTCTGGTCCCTCCACCAGG + Intergenic
992446525 5:76839231-76839253 TGGGCTGTGGTTTTTACCGGAGG - Intergenic
992671296 5:79063636-79063658 TGAGCTCTGATTTCTCCAGCAGG + Exonic
993872776 5:93271655-93271677 TGGGCACTGGGCACTCCAGGAGG + Intergenic
993929594 5:93922188-93922210 TGGACACAGGTTTCTCCAGCAGG - Intronic
996091500 5:119356124-119356146 AGGATTCTGGTTTCTCCTGGGGG + Intronic
996726291 5:126675612-126675634 TTGGCCCTGGCTCCTCCAGGAGG - Intergenic
997373862 5:133383193-133383215 TGGGCTCTGGAATGGCCAGGAGG - Intronic
998402823 5:141856776-141856798 TGGGCCCTGGATGCTACAGGGGG - Intronic
998619056 5:143774418-143774440 TGGGCTGATGTTCCTCCAGGAGG + Intergenic
999149217 5:149415704-149415726 TGGGCTCTTTCTTCTGCAGGAGG - Intergenic
1000035664 5:157445770-157445792 AGGGCCCTGGGTTTTCCAGGTGG - Intronic
1000133946 5:158326204-158326226 TTAACTCTGGTTTCTCCAGCAGG - Intergenic
1001239425 5:170056805-170056827 CATGCTCTGGTTCCTCCAGGTGG - Intronic
1002189310 5:177470490-177470512 TGGGGTATGGTTTCTGCTGGGGG - Intronic
1002197314 5:177508502-177508524 TGGGCTCTGCTGTATGCAGGAGG - Exonic
1005812891 6:29530082-29530104 AGGGGTCTGGCTTCCCCAGGAGG + Intergenic
1006257413 6:32842881-32842903 TGGGCTCTCCTTTCCACAGGAGG - Intronic
1006406728 6:33849862-33849884 GTGGCTCTGGAGTCTCCAGGTGG - Intergenic
1007512138 6:42381761-42381783 TGGGCTCTGCTTCTCCCAGGAGG - Intronic
1010764698 6:79765498-79765520 TGGGCTCTGGCTTCTGGATGAGG - Intergenic
1011179273 6:84601449-84601471 TGCCCTCTGGTTTGTGCAGGAGG - Intergenic
1011629105 6:89307662-89307684 AGGGCTCTGGTTTCTTCAGCAGG - Intronic
1011743887 6:90389961-90389983 TGAGGTATGGTTTCTTCAGGGGG + Intergenic
1011934783 6:92762559-92762581 TAGGCTCTGGTTTGTGCTGGAGG + Intergenic
1013498036 6:110718358-110718380 AGGGCTCTGGACTCTGCAGGAGG - Intronic
1013504509 6:110786438-110786460 TGGGCACTGTTTTCTCCAGCAGG + Intronic
1014989261 6:128053530-128053552 TGGGCTCTGATTTCCCAAGGTGG + Intronic
1015774579 6:136800743-136800765 TGGGGTCTGGGGTCTCCAGAGGG - Intergenic
1016873385 6:148840540-148840562 TGGATTCTGGTATCTGCAGGTGG - Intronic
1017240264 6:152160390-152160412 GGGGCTCTGGGTGCTCTAGGAGG - Intronic
1017814272 6:158005534-158005556 AGGGCTGAGGTTTCACCAGGTGG - Intronic
1018030580 6:159838106-159838128 TTGGCTCTGGATTCTACAGCTGG - Intergenic
1018686971 6:166310581-166310603 TGAGCTCTGGGTTCTCATGGCGG + Intergenic
1018901427 6:168053739-168053761 TGGACTCTGGGTTCCCCAGGCGG - Intergenic
1019413263 7:915839-915861 CGGGTTCTGGGTTCTGCAGGCGG - Intronic
1019413274 7:915893-915915 CGGGTTCTGGGTTCTGCAGGCGG - Intronic
1020087821 7:5320960-5320982 TGGGCTGTGGTTTCCCCCGATGG - Intronic
1020193817 7:6021466-6021488 TGGACACAGGTTTCTCCAGGAGG - Intronic
1024949280 7:54841906-54841928 TTGGCTCTGTGTCCTCCAGGGGG - Intergenic
1031328750 7:120436550-120436572 TGGGCCCTGGTTTCATCAAGTGG + Intronic
1032708347 7:134441471-134441493 GGGGCTCTGGGTTCTCCACCGGG + Intergenic
1033091257 7:138388333-138388355 TAGCCTCTGAGTTCTCCAGGAGG - Intergenic
1033427569 7:141258545-141258567 TGTGCTCTGTTTTCTTCATGTGG + Intronic
1033427627 7:141259559-141259581 TAGGCTCTGATTTTTCCATGGGG + Intronic
1033431747 7:141295653-141295675 TTGCCTTTGGTTTCTGCAGGGGG + Intronic
1034542964 7:151770823-151770845 TGTTCACTGGGTTCTCCAGGAGG - Intronic
1035286525 7:157810521-157810543 TGGGAGCTGGGTTCTCCACGGGG + Intronic
1037002715 8:13739710-13739732 TGAGCTCTGGCTTCTTGAGGTGG + Intergenic
1037574456 8:20188092-20188114 TGGATTTTGGTTTCTGCAGGAGG + Intergenic
1037882935 8:22581677-22581699 TGGGCTCTGCTTCCTGCAGCAGG + Intronic
1041543898 8:59018656-59018678 TTGGTTCTGGGTTCTGCAGGAGG - Intronic
1044538448 8:93383699-93383721 TGGGGTTTGGTTTCTCCAGCTGG - Intergenic
1049264942 8:141662769-141662791 TGGGCTGCAGTTTCTCCAGCCGG + Intergenic
1052519039 9:29520031-29520053 TGGCCTATGGTTTTTCCTGGGGG + Intergenic
1053141854 9:35687608-35687630 TGGGCTCTTGTCACTCTAGGTGG - Intronic
1054254538 9:62800274-62800296 AGGGCTCTGGACTCTCCAGGCGG + Intergenic
1054336763 9:63815328-63815350 AGGGCTCTGGACTCTCCAGGCGG - Intergenic
1054738562 9:68780712-68780734 GGGGCTCTGGCTTCTCCGGGTGG - Exonic
1055685839 9:78773791-78773813 TGGGCTCTGTTTTCTCATGCTGG - Intergenic
1055961794 9:81827615-81827637 TGGGCCTTGGTTTCTCCACTTGG - Intergenic
1056440432 9:86615610-86615632 TGGGCTCTTATTTCAGCAGGGGG + Intergenic
1061479091 9:130887751-130887773 TGGGTTCTGGTTTCCCGACGGGG + Intergenic
1186557901 X:10580040-10580062 TGAACTGTAGTTTCTCCAGGTGG + Intronic
1187129811 X:16491617-16491639 TGGTCTCTGGTTTCTATAGAGGG - Intergenic
1191841541 X:65516765-65516787 TGGGCTATGGTTTGACCAGCAGG + Intronic
1192545596 X:72010164-72010186 GGGGCACTGGTTCTTCCAGGTGG + Intergenic
1197512206 X:127383645-127383667 TTTGCTCTTGTTTCTCTAGGTGG + Intergenic
1199612737 X:149631777-149631799 GTGGCTCAGGTTTCTCCGGGCGG - Exonic
1200116195 X:153770739-153770761 AGGGCTCTTGTTTTCCCAGGTGG + Exonic
1201065036 Y:10089182-10089204 AGGGCTCTGGACTCCCCAGGCGG + Intergenic
1201856916 Y:18554821-18554843 TCTCCTCTGCTTTCTCCAGGAGG + Intronic
1201876405 Y:18765559-18765581 TCTCCTCTGCTTTCTCCAGGAGG - Intronic