ID: 903546141

View in Genome Browser
Species Human (GRCh38)
Location 1:24124463-24124485
Sequence GCCCCACTTGGACTGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903546141_903546146 -3 Left 903546141 1:24124463-24124485 CCTGTCACCAGTCCAAGTGGGGC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 903546146 1:24124483-24124505 GGCTTGTGAAGGACTTATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
903546141_903546149 19 Left 903546141 1:24124463-24124485 CCTGTCACCAGTCCAAGTGGGGC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 903546149 1:24124505-24124527 GAAGAGGTTGTTGGAGTTTTTGG 0: 1
1: 0
2: 2
3: 18
4: 245
903546141_903546148 10 Left 903546141 1:24124463-24124485 CCTGTCACCAGTCCAAGTGGGGC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 903546148 1:24124496-24124518 CTTATGGAGGAAGAGGTTGTTGG 0: 1
1: 0
2: 0
3: 30
4: 452
903546141_903546145 -6 Left 903546141 1:24124463-24124485 CCTGTCACCAGTCCAAGTGGGGC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 903546145 1:24124480-24124502 TGGGGCTTGTGAAGGACTTATGG 0: 1
1: 0
2: 0
3: 24
4: 163
903546141_903546147 3 Left 903546141 1:24124463-24124485 CCTGTCACCAGTCCAAGTGGGGC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 903546147 1:24124489-24124511 TGAAGGACTTATGGAGGAAGAGG 0: 1
1: 0
2: 2
3: 32
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903546141 Original CRISPR GCCCCACTTGGACTGGTGAC AGG (reversed) Intronic
900626753 1:3611858-3611880 GCCCCTCCTGGATTGGTCACTGG - Intergenic
903546141 1:24124463-24124485 GCCCCACTTGGACTGGTGACAGG - Intronic
904064945 1:27742274-27742296 GACACACTAGGACAGGTGACAGG - Intronic
904285636 1:29451710-29451732 GCCCCACCTGGGCTGTTGAGAGG - Intergenic
905012291 1:34755602-34755624 GCGCCACTTGGACGGGGGATGGG - Intronic
907339660 1:53725903-53725925 GCCCCACCTTGACTGGAGAGGGG + Intronic
907402901 1:54235995-54236017 GCCACACTTGGATTGGAGAGGGG - Intronic
918380092 1:183945220-183945242 GTGCCACTTGGGGTGGTGACGGG - Intronic
1063655132 10:7980775-7980797 GTCCCACTTGGACTTGGGGCTGG + Intronic
1066620599 10:37345218-37345240 CCACAACTTTGACTGGTGACTGG + Intronic
1067448224 10:46366056-46366078 GCCCCTCTTCCTCTGGTGACTGG + Intergenic
1067589153 10:47494710-47494732 GCCCCTCTTCCTCTGGTGACTGG - Intergenic
1067636278 10:48002801-48002823 GCCCCTCTTCCTCTGGTGACTGG - Intergenic
1067784006 10:49229479-49229501 GGCCCACCTGGGCTGGGGACAGG + Intergenic
1067877209 10:50017526-50017548 GCCCCTCTTCCTCTGGTGACTGG + Intergenic
1070132839 10:73666806-73666828 GCCCCTCTTCCTCTGGTGACTGG - Intergenic
1070806970 10:79276410-79276432 GCCCCACATGAACTGGGGACTGG - Intronic
1071095534 10:81969625-81969647 GCACCAGGTGAACTGGTGACGGG - Intronic
1071608840 10:87017268-87017290 GCCCCTCTTCCTCTGGTGACTGG + Intergenic
1076491283 10:130863216-130863238 GCCCCACGTGGACATGTGGCAGG + Intergenic
1076516495 10:131048008-131048030 GCCTCACTTGAACTGGGGGCAGG + Intergenic
1080399141 11:31917928-31917950 GGTCCACTGGGACTGGCGACTGG + Intronic
1084729015 11:71061419-71061441 GCCCCACTTAGGCTGATGACAGG + Intronic
1085703352 11:78764410-78764432 GCCCCACGTGGAGAGGCGACAGG - Intronic
1085988462 11:81811661-81811683 GCCCAAGTTGGTCTGGTGTCTGG - Intergenic
1089392299 11:118110488-118110510 GTCCCAGCTGGGCTGGTGACGGG - Intronic
1095749590 12:45696291-45696313 GCCCCACTTGTGCTGGTGCCTGG - Intergenic
1097395330 12:59066393-59066415 GCCCCAAATGGACTGGGGCCAGG + Intergenic
1102296971 12:111744793-111744815 GCACCACTGGGACTGGGGCCTGG - Exonic
1107286759 13:38802229-38802251 GCCCCACTTGCCCTGGTGGCAGG - Intronic
1118601106 14:67472020-67472042 GCCCCACTTTGTCCTGTGACAGG - Exonic
1120279491 14:82420986-82421008 GACCCTCTTGGACTGGTCTCTGG + Intergenic
1121057098 14:90865648-90865670 GCTCCATTTGGACTGGTCTCTGG + Exonic
1124810883 15:32936971-32936993 GCCCGACTTGGAGTGCTGATGGG - Intronic
1129231117 15:74197664-74197686 TCCCCACTGGGGCTGGTGAAGGG - Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1138287200 16:55819722-55819744 GCCCAACTTGTACTAGTGGCAGG + Intronic
1143162337 17:4879749-4879771 TTCCCACTAGGGCTGGTGACAGG + Intronic
1146938234 17:36825840-36825862 GACCCTCTCAGACTGGTGACAGG + Intergenic
1148214591 17:45827529-45827551 TCCCCACTTGCACGGGTGATAGG + Intronic
1151480218 17:74366114-74366136 GGGCCACTTGGACTGGGGACAGG + Intergenic
1153777867 18:8469566-8469588 GCCCCCTTTGCTCTGGTGACAGG - Intergenic
1155166609 18:23237290-23237312 GCCCCACCTGGGTTGGTGGCCGG + Intronic
1157309003 18:46537942-46537964 GCTCCTCCTGGACTGGTGTCAGG - Intronic
1158721959 18:59933015-59933037 GCCCCACTGGGGATGGGGACTGG - Intergenic
1161800070 19:6412528-6412550 GCCCCACTGGGCCAGGTGCCTGG + Intergenic
1162976161 19:14207908-14207930 GCCTCACTTGGTCTGATGCCTGG - Intergenic
1164411607 19:28010816-28010838 GTCCCACGTGGACCGGTGGCTGG + Intergenic
1164516588 19:28941983-28942005 ATCCCACGTGGACTGGTGGCTGG + Intergenic
1164806338 19:31120080-31120102 GCCCCAGCTGGTCTGGAGACAGG - Intergenic
927064001 2:19451375-19451397 GCCCCATGTTGAATGGTGACTGG - Intergenic
928059930 2:28101584-28101606 TCCCCACATGGACTGGGGATAGG - Intronic
928652192 2:33414851-33414873 GACCCACTTGCAATGGTGGCAGG - Intergenic
941269723 2:163409901-163409923 GTTCCACTGGGACTGGTGGCAGG - Intergenic
942099699 2:172567875-172567897 GCCCCACTGGGGGTGGTGATAGG - Intronic
942972805 2:181977894-181977916 GCTCCACTGGGGCTGTTGACAGG + Intronic
948249344 2:236513155-236513177 TCCCCACTTTGACTGGTTAGTGG - Intergenic
1172620461 20:36315452-36315474 GGACCACGTGGACTGGTGACAGG + Intronic
1173353381 20:42264907-42264929 GCCAGACTGTGACTGGTGACTGG - Intronic
1175915763 20:62424986-62425008 GCCCCACCAGGGCTGCTGACTGG - Intronic
1179182028 21:39053679-39053701 CCCCCACTTGGGCAGGTGAGGGG + Intergenic
1179649971 21:42801903-42801925 GTCCAACTTGGTCTGGTGTCTGG + Intergenic
1180083519 21:45497406-45497428 CCCCCACATGGCCTGCTGACGGG + Intronic
1183415262 22:37678146-37678168 GCCCCACTTGTGCTGGGCACCGG + Intronic
1185310228 22:50150260-50150282 GCCCCACAGTGCCTGGTGACTGG - Intronic
953773235 3:45794705-45794727 GGCTCACCTGGACTGATGACTGG + Intronic
956292919 3:67680218-67680240 GCCCAACTTGAACTGGTCTCAGG - Intergenic
956492237 3:69785455-69785477 GCCCCACTTGGATTGCTTACTGG - Intronic
962811016 3:138959660-138959682 GCCCCACTGGGCATGGTGAAGGG + Intergenic
964466413 3:156998004-156998026 GACACACTGGGACTGGTGAAAGG + Intronic
966056160 3:175693157-175693179 ACCGCACTTGGAGTGTTGACAGG + Intronic
968601565 4:1512289-1512311 GCCCCACTTTGGCAGGTGGCTGG - Intergenic
978175676 4:105729443-105729465 GCCCTACTTGGACTCTTGATTGG + Exonic
981547576 4:145910057-145910079 TCCCTAGCTGGACTGGTGACAGG - Intronic
985718410 5:1475790-1475812 GCCCCACTCGGAGTGGAGATGGG - Intronic
985718431 5:1475858-1475880 GCCCCACTCGGAGTGGAGATGGG - Intronic
1002797404 6:485634-485656 GCCCCACATTCACTGCTGACTGG - Exonic
1005972111 6:30769553-30769575 GCCCCACAGGGACTGCTGAGGGG + Intergenic
1006935093 6:37711702-37711724 GCCCCACAGGGAGTGATGACAGG - Intergenic
1009401700 6:63263862-63263884 GCAACACTCTGACTGGTGACGGG + Intergenic
1010840914 6:80648530-80648552 GCCCAAGTTGGTCTGGTGTCTGG + Intergenic
1017648808 6:156562817-156562839 GCCCCACTGGGCCTGGGGCCTGG + Intergenic
1022595284 7:31707671-31707693 ACCCCACTTGGACTGGTGCTTGG - Exonic
1022702077 7:32770999-32771021 GCCCTACTTACACTGGGGACAGG + Intergenic
1027700802 7:81468209-81468231 GCCCCACTGGGACTGAAGGCGGG + Intergenic
1030488687 7:110204345-110204367 GCCACAGTAGGACTGGTCACTGG - Intergenic
1034196853 7:149254697-149254719 ACCCCACAGGGACTGGTGGCTGG + Exonic
1037846993 8:22292265-22292287 ACCCAACTTGGACTGTTGAAAGG + Intronic
1038087745 8:24218570-24218592 GTCCCTCTTGGGCTGATGACTGG - Intergenic
1040101809 8:43512658-43512680 GCCACACTAGGCCTGGTGTCAGG - Intergenic
1042505035 8:69550644-69550666 GCACCACGTGGACTAGTGCCGGG - Intronic
1044932126 8:97260579-97260601 TCCCCACTTGGACTTGTGGGTGG + Intergenic
1049958300 9:713209-713231 GCTCCACTTGGAATGATGACTGG + Exonic
1052877049 9:33575230-33575252 GCCAGACTGGGCCTGGTGACAGG - Intergenic
1056586538 9:87931125-87931147 GCCAAACTGGGCCTGGTGACAGG + Intergenic
1056610340 9:88121817-88121839 GCCAAACTGGGCCTGGTGACAGG - Intergenic
1057161999 9:92895471-92895493 GCCAGACTGGGCCTGGTGACAGG + Intergenic
1057314683 9:93960701-93960723 GCCCCATCTGGGCTGGTGCCAGG + Intergenic
1057678401 9:97153655-97153677 GCCAGACTGGGCCTGGTGACAGG + Intergenic
1195326414 X:103762134-103762156 GCCCAAGTTGGGCTGGTGTCTGG + Intergenic
1196483906 X:116181907-116181929 GCCCCACCTGGACTGGGGTGTGG + Intergenic
1197956864 X:131960358-131960380 GCTCCACTTGATCTGGTAACAGG + Intergenic
1198812967 X:140554325-140554347 GAAGCACTGGGACTGGTGACAGG + Intergenic
1200683021 Y:6235401-6235423 GCCCCACTTGGACTAGGGCCAGG - Intergenic
1200832481 Y:7700480-7700502 GCCCCAGTTGGACCAGGGACAGG + Intergenic