ID: 903548250

View in Genome Browser
Species Human (GRCh38)
Location 1:24140688-24140710
Sequence TTCCCTCAGGCCCCCAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 608}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903548244_903548250 28 Left 903548244 1:24140637-24140659 CCTCTAAAGCAATCTGCACTGTA 0: 1
1: 0
2: 2
3: 11
4: 111
Right 903548250 1:24140688-24140710 TTCCCTCAGGCCCCCAGGCTTGG 0: 1
1: 0
2: 5
3: 54
4: 608
903548245_903548250 -5 Left 903548245 1:24140670-24140692 CCTTAACTTATAAAACCCTTCCC 0: 1
1: 0
2: 0
3: 13
4: 192
Right 903548250 1:24140688-24140710 TTCCCTCAGGCCCCCAGGCTTGG 0: 1
1: 0
2: 5
3: 54
4: 608

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903548250 Original CRISPR TTCCCTCAGGCCCCCAGGCT TGG Intronic
900094111 1:933449-933471 TTCCTTCTGGGCGCCAGGCTCGG + Intronic
900198502 1:1390229-1390251 TTCTCTCCTGCCCCCAAGCTGGG - Exonic
900296576 1:1954853-1954875 TTCCCACAGGGCACCTGGCTGGG - Intronic
900323006 1:2094243-2094265 TACCCTCGGGTCACCAGGCTTGG - Intronic
900936879 1:5771622-5771644 TTCCCACTGGCCCCCATGCCGGG - Intergenic
901119930 1:6883007-6883029 TTGCCTCAGCCTCCCAAGCTGGG + Intronic
901484783 1:9551341-9551363 TTCACTCTGTCACCCAGGCTGGG - Intronic
901510808 1:9717257-9717279 GTCCCACAGGCCCCCAGCCCAGG - Intronic
901563081 1:10088708-10088730 CTCCCTCTGTCACCCAGGCTGGG + Intronic
901588211 1:10316200-10316222 CTCCCTCTGTCACCCAGGCTGGG - Intronic
901972986 1:12922503-12922525 CTCACTCTGTCCCCCAGGCTGGG - Intronic
902012194 1:13279260-13279282 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
902541993 1:17162460-17162482 TTGCCTCAGGTCCCAGGGCTGGG + Intergenic
902768050 1:18630094-18630116 CCTCCTCAGGCCCCCAGGCCGGG - Intergenic
902844879 1:19102332-19102354 TTCACTCTGTCACCCAGGCTGGG - Intronic
902874737 1:19334029-19334051 CTCCTCCAGGCCCCCAGCCTGGG + Intergenic
902985208 1:20150497-20150519 CTCCCTCCTGCCCCCAGCCTGGG + Intergenic
903548250 1:24140688-24140710 TTCCCTCAGGCCCCCAGGCTTGG + Intronic
903580313 1:24365817-24365839 TTCCCCCAGGCCCACAGGGCTGG + Intronic
903938083 1:26910477-26910499 TTCTCTAAGCCCCCCAGGTTAGG - Intronic
904483271 1:30807314-30807336 CTCCGTGAGGCCCCCAGGCTCGG - Intergenic
904492929 1:30871499-30871521 ATCCCTCAGGCCCCGAGGTCAGG - Intronic
904760316 1:32798790-32798812 TTCACTCTGTCTCCCAGGCTCGG - Intronic
905447180 1:38034942-38034964 AGGCCTCAGGTCCCCAGGCTGGG - Intergenic
905926348 1:41752504-41752526 TTCCCTCAGCCCCCTAGGCTGGG - Intronic
906175605 1:43769392-43769414 TTGCCTCAGTGCACCAGGCTAGG - Intronic
906271060 1:44479144-44479166 CTCACTCAGTCGCCCAGGCTGGG + Intronic
906314304 1:44776319-44776341 CTCCCTCAGGCCCCCAAACCTGG + Intronic
906606160 1:47173814-47173836 TCCACTCAGACCCCCAGCCTGGG + Intergenic
906800025 1:48729032-48729054 TTGCACCAGGTCCCCAGGCTAGG - Intronic
907283037 1:53363184-53363206 ATCCCTCAGGCACCCAAGCCAGG + Intergenic
907525330 1:55050605-55050627 TGCCCTAAGGCCTCCAGTCTCGG - Intronic
907987096 1:59542900-59542922 TTCCCTAAGGCACCTAGGATGGG + Intronic
908570586 1:65406086-65406108 TTCGTTCTGGCCCCCAGGCATGG - Exonic
909217836 1:72914194-72914216 ATGCCTCAGGATCCCAGGCTGGG + Intergenic
909233637 1:73123567-73123589 TTCACTCTGTCACCCAGGCTGGG + Intergenic
909658964 1:78061529-78061551 TTCCTTCTGTCGCCCAGGCTGGG + Intronic
911008124 1:93248940-93248962 TTCACTCTGTCGCCCAGGCTGGG - Intronic
912500111 1:110116118-110116140 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
913533384 1:119748983-119749005 ATCCCTCAGGTGTCCAGGCTTGG - Intronic
914005271 1:143727731-143727753 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
914097750 1:144558982-144559004 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
914301240 1:146378626-146378648 CTCCCTCTGTCGCCCAGGCTGGG - Intergenic
914809873 1:151019524-151019546 CTCCCTCTGTCTCCCAGGCTTGG - Intronic
915188901 1:154131833-154131855 TTCACTCCGTCGCCCAGGCTGGG + Intronic
915327741 1:155089603-155089625 CTCACTCAGTCGCCCAGGCTGGG + Intergenic
915339173 1:155166998-155167020 TTCCCTCTGTCCCCCAGGGGCGG + Intergenic
915699796 1:157781050-157781072 TCCCCTCAGACACCAAGGCTGGG - Intergenic
917153817 1:171973700-171973722 CTCCCTCTGTCACCCAGGCTGGG + Intronic
917348556 1:174054540-174054562 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
917969699 1:180198765-180198787 GTCTCTCAGGCCCCCAGCCAGGG - Exonic
918043678 1:180928257-180928279 AGGCCCCAGGCCCCCAGGCTGGG + Intronic
918047244 1:180948969-180948991 TTCTGTCAGGGCCACAGGCTGGG + Exonic
918315089 1:183316604-183316626 GTCCCTCAGGCCCCCGTGCCTGG - Intronic
919768412 1:201141861-201141883 CTCCCTCTGGCTCCCTGGCTAGG + Intronic
919802377 1:201361519-201361541 TGCCGTCTGGTCCCCAGGCTGGG - Intronic
920011078 1:202868223-202868245 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
920223618 1:204422573-204422595 CTCTCTCAGTCGCCCAGGCTTGG - Intergenic
920293385 1:204940015-204940037 GGCCCTCAGCTCCCCAGGCTGGG - Intronic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
922370518 1:224906438-224906460 TTCCCTCAGACCCCAAGGCAAGG + Intronic
922564542 1:226593153-226593175 CTCACTCTGTCCCCCAGGCTGGG - Intronic
922590980 1:226776534-226776556 CTTCCTCTGTCCCCCAGGCTGGG + Intergenic
922820502 1:228481908-228481930 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
922843377 1:228663661-228663683 TTCACTCTGTCCCCCAGGCTGGG + Intergenic
923050410 1:230387785-230387807 TTCCCACACGCTCCTAGGCTCGG + Intronic
923553974 1:234986183-234986205 TTCACTCTGGTGCCCAGGCTGGG - Intergenic
923642649 1:235780371-235780393 TTCACTCTGTCACCCAGGCTTGG - Intronic
924230161 1:241956181-241956203 TTCTCTCTGTCACCCAGGCTGGG - Intergenic
924586313 1:245364123-245364145 CACCCTCAGACCCCCAGCCTGGG + Intronic
924783919 1:247176903-247176925 TTCCCCCACCCCCACAGGCTTGG + Intergenic
1063297925 10:4825668-4825690 TGCCCCGAGGCCCCCAGTCTGGG - Intronic
1064356961 10:14627740-14627762 TTCACTCTGTCCCCCAGGCGAGG - Intronic
1065164237 10:22958029-22958051 TTCGCTCTGTCACCCAGGCTGGG - Intronic
1066563567 10:36695918-36695940 TTCACTCTGTCTCCCAGGCTGGG - Intergenic
1066584604 10:36918808-36918830 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
1067095640 10:43297764-43297786 TGCCCTGAGGCCACCATGCTGGG + Intergenic
1070194222 10:74141393-74141415 CTCCCTCTGTCACCCAGGCTAGG - Intronic
1070398885 10:76035674-76035696 TGCCTTCAGGCACCCAGCCTCGG - Intronic
1070462262 10:76681868-76681890 CCCCCTCAGGCCTGCAGGCTGGG + Intergenic
1070926899 10:80229676-80229698 CTCCCTCCGTCACCCAGGCTGGG - Intergenic
1071121627 10:82285647-82285669 TTCCCTCTGGCCACCAGCCTTGG - Intronic
1071704245 10:87980276-87980298 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
1072173485 10:92891510-92891532 TTCACTCTGTCACCCAGGCTGGG + Intronic
1072616230 10:97050400-97050422 TGCCCTCTGGCCCCCCGGTTGGG + Intronic
1072708744 10:97701720-97701742 TTCACTCTGTCACCCAGGCTAGG + Intergenic
1072731689 10:97850560-97850582 TTGCTTCAGGGCCCCAGGCTGGG + Intronic
1073068896 10:100781155-100781177 TTCTCTCTGCCCCCCAGCCTTGG + Intronic
1073319213 10:102604110-102604132 TTCCCTCACACTCCCACGCTGGG + Intronic
1073606416 10:104900247-104900269 TTCTCTCAGGCACTCAGGTTTGG + Intronic
1075549877 10:123384246-123384268 TTCCCTCATGTCCCCAGGGATGG + Intergenic
1075583022 10:123636484-123636506 CTCCCTCAGCCCCTCAGACTTGG - Intergenic
1075782398 10:125026038-125026060 TCCCCCCAGGTCCCCAGGCAGGG + Intronic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1077462405 11:2717208-2717230 GTCCCTCAGACCCCACGGCTTGG + Intronic
1077900156 11:6481249-6481271 TCCCCTCAGGGCGCCAGGCCCGG + Exonic
1078222861 11:9365707-9365729 TTCCCTCTTTCGCCCAGGCTGGG - Intergenic
1078314292 11:10279678-10279700 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1078455250 11:11469897-11469919 TTCCATCAGGCCCCCAGAACAGG + Intronic
1078916510 11:15783678-15783700 TTCCCTCAGGCCCTCAGGTGCGG - Intergenic
1079121232 11:17686511-17686533 TTCCCAGAGGCCCTCAAGCTGGG + Intergenic
1079882551 11:25944826-25944848 TTCCCACATGCCCCCAGGATAGG + Intergenic
1079987092 11:27210923-27210945 GGCCTTCAGGCCCCCAGACTTGG + Intergenic
1080813382 11:35728294-35728316 TTCACTCTGTCTCCCAGGCTGGG - Intronic
1081656897 11:44863335-44863357 TTCCCGCAGGCCTCCAGGCTTGG + Intronic
1081785867 11:45746742-45746764 TTCACTCTGTCACCCAGGCTGGG - Intergenic
1081959924 11:47128410-47128432 CTCACTCAGTCACCCAGGCTGGG + Intronic
1082880952 11:58037747-58037769 CTCACTCAGTCGCCCAGGCTGGG + Intronic
1084211776 11:67627696-67627718 TTGCCTAAGGGCCCCACGCTGGG - Intergenic
1084384493 11:68834403-68834425 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1084750133 11:71199062-71199084 GTCCCTCATGCCCCCTGGCCTGG - Intronic
1085030779 11:73269754-73269776 CCCAGTCAGGCCCCCAGGCTGGG - Intronic
1085644832 11:78216275-78216297 TTCACACAGGCCCCCTGCCTGGG - Exonic
1085788450 11:79475307-79475329 CTCACTCAGTCGCCCAGGCTGGG + Intergenic
1087880990 11:103416148-103416170 CTCCCTCAGCCCCCCAGCCTGGG - Intronic
1089242239 11:117091811-117091833 TTCACTCTGTCACCCAGGCTGGG + Intronic
1089750832 11:120649996-120650018 TTATCTGAGGCCACCAGGCTGGG - Intronic
1089784476 11:120898353-120898375 TTCCCTCAGCCCCCCAACCCTGG + Intronic
1090361561 11:126176165-126176187 TTCCCTCAGGCTCCAGGGCGAGG + Intergenic
1090760523 11:129833207-129833229 CTCCCTCTGTCGCCCAGGCTGGG - Intronic
1091169422 11:133507135-133507157 GGTCCTCAGGCCCTCAGGCTGGG - Intronic
1091331731 11:134736184-134736206 TTCCCACGGGCCCCCAGGAATGG - Intergenic
1091754664 12:3043646-3043668 TTCCCCCAGACCCCCAGGGCTGG - Intergenic
1092124898 12:6068102-6068124 TTCACTCAGTCGCCCAGGCTGGG - Intronic
1092129879 12:6102701-6102723 CTCGCTCAGTCACCCAGGCTGGG - Intronic
1092241499 12:6838983-6839005 TGCCCTCATCCCTCCAGGCTCGG + Exonic
1095084110 12:38041818-38041840 TTCACTCTGTCACCCAGGCTGGG - Intergenic
1095744138 12:45639012-45639034 TTCACTCTGGTGCCCAGGCTGGG + Intergenic
1095924426 12:47564179-47564201 TTCACTCTGTCCCCCAGACTGGG + Intergenic
1096142983 12:49257746-49257768 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1096389510 12:51217829-51217851 CGCCCCCAGGCCCCCAGCCTGGG + Intergenic
1096790163 12:54039476-54039498 ATCCCTCAGGGCCTCAGTCTCGG + Intronic
1096888991 12:54747213-54747235 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
1097393860 12:59049558-59049580 TTCACTCTGTCACCCAGGCTGGG - Intergenic
1097762379 12:63482565-63482587 CTCACTCAGTCGCCCAGGCTGGG + Intergenic
1098042001 12:66361903-66361925 GTCCCACAGGCCCCGAGGGTGGG - Intronic
1098271220 12:68772066-68772088 TTTCCTCTGTCTCCCAGGCTTGG + Exonic
1099072338 12:78060950-78060972 CTCCATCAGGGCCCCAGACTGGG + Intronic
1099662320 12:85579597-85579619 TTCGCTCTGTCGCCCAGGCTAGG + Intergenic
1100433023 12:94547246-94547268 TTCTCACAGGCCCCCAGGTGGGG + Intergenic
1101147167 12:101852202-101852224 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1101160506 12:101969339-101969361 TTCACTCTGTCACCCAGGCTGGG - Intronic
1102465401 12:113128003-113128025 TCCCCTCAGGTGCCCAGGCTTGG + Intronic
1102576894 12:113861318-113861340 TTCCCTAAGACCACCAGGCAAGG + Intronic
1102775565 12:115515729-115515751 TTCCTTCTGTCCCCCAGTCTTGG - Intergenic
1102993368 12:117330514-117330536 GGCCCCCAGGCCCCCAGGCCAGG - Exonic
1103171683 12:118825761-118825783 CTACCTCAGCCCCCCAAGCTGGG - Intergenic
1103630559 12:122256541-122256563 CTCACTCAGTCACCCAGGCTGGG - Intronic
1103724058 12:122989234-122989256 TTCCCCCAGGCCTCAAGGCTGGG + Intronic
1104677172 12:130719164-130719186 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
1104958418 12:132476969-132476991 TCCCCACCAGCCCCCAGGCTGGG + Intergenic
1105455667 13:20538981-20539003 TTCCCTCATTCCCCCAGTCCTGG + Intergenic
1105517763 13:21105384-21105406 CTCGCTCTGTCCCCCAGGCTAGG - Intergenic
1105685961 13:22782449-22782471 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
1106160722 13:27199110-27199132 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1106619203 13:31357276-31357298 TCCTCTCAGGCCGTCAGGCTGGG - Intergenic
1106721629 13:32440878-32440900 CTCGCTCAGTCACCCAGGCTGGG + Intronic
1106790097 13:33146291-33146313 TTCACTCTGTCACCCAGGCTGGG - Intronic
1107553421 13:41497348-41497370 CTCCCTCAGTTTCCCAGGCTGGG + Intergenic
1107660172 13:42631019-42631041 TTCCCCCAGAGCTCCAGGCTTGG - Intergenic
1107993436 13:45838548-45838570 TGCCCCCAGGCCACCACGCTGGG + Intronic
1108269967 13:48749896-48749918 TTCTCTGAGGGCCCCCGGCTCGG - Intergenic
1109594604 13:64533660-64533682 TTACCTCAGGCCCCCATCCCAGG - Intergenic
1109935966 13:69284773-69284795 CTCCCTCAGCCTCCCAAGCTGGG - Intergenic
1110952548 13:81514697-81514719 TTCCCTCAGGCCCCCAAACTTGG + Intergenic
1111821716 13:93223928-93223950 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1112005182 13:95247472-95247494 TTCCCCCAGGCCACCATGGTAGG + Intronic
1112301540 13:98235277-98235299 TTCCCTGGGGCCCACAGCCTTGG - Intronic
1112502696 13:99955204-99955226 TCTCCTGAGGCCCCCAGTCTGGG - Intergenic
1112519782 13:100085205-100085227 CTCCCTCAGTCACCCAGGCTGGG + Intergenic
1113487553 13:110665414-110665436 TTCGCTCCGTCCCCCAGCCTGGG - Intronic
1113490632 13:110689005-110689027 TTCCCTCGGGTCCCATGGCTGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113768847 13:112895975-112895997 TTCTGTCAGGCCCCCAGGGGAGG - Intronic
1113788580 13:113015646-113015668 CTCCCTCAGACCCCAAGGCCCGG - Intronic
1113930293 13:113964749-113964771 TGCCCTCAGTCCCTCAGGCTCGG + Intergenic
1115519783 14:34221763-34221785 CTCACTCTGTCCCCCAGGCTGGG + Intronic
1115606544 14:35008915-35008937 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1116551824 14:46249583-46249605 CTCGCTCAGTCACCCAGGCTGGG - Intergenic
1117379816 14:55150020-55150042 TTCACTCTTGCACCCAGGCTGGG - Intronic
1117574500 14:57084460-57084482 TTTGCTCTGTCCCCCAGGCTTGG - Intergenic
1117877039 14:60263184-60263206 CTCCCTCTGTCACCCAGGCTAGG - Intronic
1118356324 14:65016951-65016973 TTCACTCTGTCACCCAGGCTGGG + Intronic
1118976716 14:70684219-70684241 TTCCCTCACTCCCCCAACCTCGG + Intergenic
1119703969 14:76772795-76772817 TTCTCTCCAGCCACCAGGCTGGG - Intronic
1119847618 14:77842058-77842080 CTCACTCAGTCGCCCAGGCTGGG - Intronic
1119867561 14:77986445-77986467 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
1119884560 14:78129566-78129588 GGGCCTCAGGCCTCCAGGCTGGG + Intergenic
1120085064 14:80262861-80262883 TTCGCTCTTGTCCCCAGGCTGGG - Intronic
1120194641 14:81468486-81468508 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1122118688 14:99540571-99540593 TGCCCTCAGGCAGCCAAGCTGGG - Intronic
1122266687 14:100549965-100549987 GCCCCCCAGGCCCCCAGGCCTGG - Intronic
1122554009 14:102566931-102566953 TTCCCTCTGTCACCCAGGCTAGG + Intergenic
1122678899 14:103441313-103441335 TTCGCTCTGTCACCCAGGCTGGG + Intronic
1122888178 14:104719796-104719818 GTCCCCCAGTCCCCCAGGCCAGG + Intronic
1122972089 14:105156499-105156521 TCCCCTCAGGCCCCCAAGACAGG + Intronic
1124057929 15:26260052-26260074 TTCCCTCAGGCCCAGTGGCGTGG + Intergenic
1124773402 15:32562799-32562821 TTCGCTCTGTCGCCCAGGCTGGG + Intergenic
1125257301 15:37779796-37779818 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1125667897 15:41446831-41446853 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1126343252 15:47666903-47666925 TACCCTGAGGCCACCATGCTGGG + Intronic
1127394723 15:58535288-58535310 ATGCCCCAGGCCCCCTGGCTAGG - Intronic
1127901198 15:63342198-63342220 CCCCCTCAGCCCCCCAGACTAGG + Intronic
1128081804 15:64861423-64861445 TTCCCACACTCCCCAAGGCTTGG + Intronic
1128458948 15:67851638-67851660 TTCCCTCTGTCGCCCAAGCTGGG + Intergenic
1128665692 15:69536790-69536812 TTCCCTCTCTTCCCCAGGCTGGG - Intergenic
1129167452 15:73786841-73786863 TGTCCCCAGGGCCCCAGGCTTGG - Intergenic
1129321174 15:74775822-74775844 CTGCCTCAGGCCCCGAGGGTGGG + Intergenic
1129329882 15:74821625-74821647 AGCTCTCAGGCCCCCAGGCTGGG - Intronic
1129376285 15:75134733-75134755 TTCACTCTGTCACCCAGGCTAGG + Intergenic
1129394033 15:75234631-75234653 ACTCCTCAGTCCCCCAGGCTTGG - Intergenic
1129787597 15:78319990-78320012 ATCCCTGAGGCCCCCATGCCAGG + Intergenic
1129833828 15:78689300-78689322 TTCACTCTGTCGCCCAGGCTGGG + Intronic
1130182099 15:81640335-81640357 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
1130394796 15:83492716-83492738 TTCCCTCTATCCCCCAGGGTTGG + Intronic
1131164014 15:90129265-90129287 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
1131350753 15:91697682-91697704 CTCGCTCTGTCCCCCAGGCTGGG - Intergenic
1131475796 15:92738217-92738239 TTCCCTCTGTCGCCCAGGCTGGG + Intronic
1132114235 15:99124122-99124144 TTCTCACAGTCCCCGAGGCTTGG + Intronic
1132287051 15:100670967-100670989 TTTCCCCAGAGCCCCAGGCTGGG + Intergenic
1132518055 16:375066-375088 TTCACTCAGGACCACAGGCCGGG - Intronic
1132671403 16:1103547-1103569 GCCCCTCAGGCCCCCAGGCTGGG + Intergenic
1132814700 16:1820209-1820231 TAACCCCAGGCCCCCACGCTCGG - Intronic
1133026129 16:2989704-2989726 GTCCCCCAGGCACCCTGGCTGGG + Intergenic
1133247789 16:4460843-4460865 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1133999526 16:10771847-10771869 TTCGCTCTGTCGCCCAGGCTGGG + Intronic
1134117707 16:11561665-11561687 CTCCCTCAGGCCCCAAGGCCAGG + Intronic
1134269696 16:12722818-12722840 TTCCCACGGACCCCAAGGCTGGG + Intronic
1135017658 16:18937269-18937291 CTCCCTCTGTCACCCAGGCTAGG + Intergenic
1136080142 16:27846924-27846946 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1136147782 16:28325711-28325733 TTCCCTCCAGCCCCCACGCCTGG + Intergenic
1136253870 16:29025257-29025279 CTTCCTCAGGCCCCCTGGGTAGG - Intergenic
1136449860 16:30347741-30347763 TTCACCCAGGCTCCCAGGCAGGG - Intergenic
1136849390 16:33601612-33601634 TTCGCTCTGTCGCCCAGGCTTGG - Intergenic
1137042714 16:35628084-35628106 CTCCCTCTGTCCCCTAGGCTGGG + Intergenic
1137642936 16:50048860-50048882 CTCCCTCTGTCACCCAGGCTAGG - Intergenic
1137709164 16:50554663-50554685 TTCACTCTGCCACCCAGGCTGGG + Intronic
1138126265 16:54441284-54441306 CTCGCTCTGTCCCCCAGGCTGGG + Intergenic
1138264739 16:55652377-55652399 TGCCCTCAGGCCACCTGGCTGGG + Intergenic
1138436918 16:57006447-57006469 TTCACTCTGTCGCCCAGGCTGGG + Intronic
1138516774 16:57540472-57540494 TCCTCTCAGGCCCCCAGGCAGGG - Intergenic
1138674277 16:58639775-58639797 CTCGCTCTGGCCCCCAGTCTGGG + Intergenic
1138943235 16:61815619-61815641 TTCCCTAAGGACCCTTGGCTTGG + Intronic
1139096085 16:63705840-63705862 CTCCCTCAGTCGCCCAGGCTGGG - Intergenic
1139103401 16:63797618-63797640 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
1139914494 16:70419671-70419693 TGACCTCTGGCCGCCAGGCTGGG - Intronic
1140819053 16:78646456-78646478 TTCACTCTGTCACCCAGGCTGGG + Intronic
1140996234 16:80262336-80262358 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
1141127525 16:81411393-81411415 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
1141659434 16:85434024-85434046 TGCCCACAGGCCCTCAGGTTTGG - Intergenic
1142005917 16:87689556-87689578 TTCCCTCTGGCGCCCTGGCCCGG + Intronic
1142024658 16:87806044-87806066 TGCCCCCACTCCCCCAGGCTGGG - Intergenic
1142287059 16:89175779-89175801 GTTCCTCAGGCTCCCAGGCAGGG - Intronic
1203111098 16_KI270728v1_random:1450262-1450284 TTCGCTCTGTCGCCCAGGCTTGG - Intergenic
1142644826 17:1304912-1304934 TACCCTCAGCACACCAGGCTGGG - Intergenic
1143066260 17:4250696-4250718 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1143373191 17:6453179-6453201 TTCCCTGAGAACCCCAGGCTAGG - Exonic
1143529759 17:7496002-7496024 GTCCATCAGCCCCCCAAGCTTGG - Exonic
1145266492 17:21382122-21382144 TTCCTTCAGGCCCCTACTCTGGG + Intronic
1145866848 17:28247304-28247326 TGCCCTCTCGTCCCCAGGCTTGG + Intergenic
1146025488 17:29317046-29317068 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1146066229 17:29637748-29637770 ATCACTCAGTCACCCAGGCTGGG - Intronic
1146288995 17:31594771-31594793 TTCCCTGTGGCCCCAAGGTTTGG + Intergenic
1146310097 17:31761677-31761699 CTCACTCTGGCACCCAGGCTGGG - Intergenic
1146398736 17:32487557-32487579 ATCCCTCCGGCCGGCAGGCTGGG + Exonic
1146633972 17:34490727-34490749 GTCCCTCAGGCCCTCATGCCTGG + Intergenic
1146913085 17:36660492-36660514 TGCCCTGAGGCCCCCAGGTAAGG - Intergenic
1147337727 17:39737599-39737621 TGCAGACAGGCCCCCAGGCTTGG + Intergenic
1147715132 17:42501443-42501465 CTCGCTCTGTCCCCCAGGCTGGG + Intronic
1147912010 17:43861560-43861582 TGCCCTCAAGGCCCCAGGCTGGG - Intronic
1148009374 17:44463496-44463518 CTGCCTCAGGCTCCCAAGCTGGG + Intronic
1148198989 17:45735581-45735603 ATCCATCAGGCCTGCAGGCTGGG - Intergenic
1148328002 17:46795141-46795163 TTCCCTCAGCACCCGAGGGTGGG - Intronic
1148864131 17:50619788-50619810 TTCCCTTCTGCCCCCAGCCTGGG + Exonic
1148906705 17:50916994-50917016 AGCCCTCAGGCACCCAGGGTGGG + Intergenic
1149030722 17:52079426-52079448 CTCGCTCTGTCCCCCAGGCTGGG - Intronic
1149608536 17:57942057-57942079 TTCCCTGGGGACCCCAGGCTCGG + Intronic
1149793092 17:59496137-59496159 TTCCCTTTGGCCCCCAGTCTTGG - Intergenic
1150003875 17:61457713-61457735 CTCCCACAGGCCACCAGGCCGGG - Intronic
1150048884 17:61939441-61939463 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1151435529 17:74093856-74093878 TTCCATAAGGCCCTCAGGCATGG + Intergenic
1151724349 17:75875831-75875853 CTCGCACAGGCCCCCAGGCCTGG - Intronic
1151843449 17:76634256-76634278 TTATCTCAGGCCCCCTGGCTGGG + Intronic
1152036723 17:77877974-77877996 TGCCCTCAGAGCCCCAGGCAGGG - Intergenic
1152076212 17:78161443-78161465 TGCCCTCAGGGCCCCAGCCAGGG - Intronic
1152259785 17:79260689-79260711 TCCCATCAGGCCCCAAGGCCGGG - Intronic
1152706683 17:81847213-81847235 TGCCCTGCAGCCCCCAGGCTGGG - Intronic
1153629449 18:7055421-7055443 TTCACTCTGTCACCCAGGCTGGG - Intronic
1153793463 18:8600967-8600989 TGGCCTCAAGCTCCCAGGCTCGG + Intergenic
1154152122 18:11914676-11914698 CTCCCTCCGTCACCCAGGCTGGG + Intergenic
1156870764 18:41942370-41942392 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1157587278 18:48811991-48812013 CTCACTCTGTCCCCCAGGCTGGG + Intronic
1159293025 18:66446336-66446358 CTCCCTCTGTCTCCCAGGCTGGG + Intergenic
1160014142 18:75127758-75127780 TTCCCTCGGGCCTCCCTGCTGGG + Intergenic
1160464154 18:79062203-79062225 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1160666912 19:335229-335251 GGCCCTCAGGCCCCCAGCCTTGG - Intronic
1160849046 19:1181118-1181140 CTCGCTCTGTCCCCCAGGCTGGG + Intronic
1161231448 19:3176927-3176949 TCCCCTCAGACCCCAAGGCAGGG + Intronic
1161554659 19:4934052-4934074 CTCCCTCTGTCGCCCAGGCTGGG + Intronic
1161722375 19:5910237-5910259 CTCCCTCTTGCCCCCAGGCCAGG - Exonic
1162019321 19:7861509-7861531 TGCCCTCTGGCCCCCAGGCCAGG - Intronic
1162306026 19:9874509-9874531 CTCCCTCTGTCGCCCAGGCTGGG + Intronic
1162342159 19:10097820-10097842 CTCGCTCAGTCACCCAGGCTGGG - Intronic
1162414887 19:10529781-10529803 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1162541865 19:11301607-11301629 CTCCCTCTGTCGCCCAGGCTGGG - Intronic
1162570384 19:11468443-11468465 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1162572264 19:11480447-11480469 CACTCTCAGGCCCCGAGGCTTGG + Intronic
1162899429 19:13785764-13785786 CTCACTCAGTCGCCCAGGCTGGG - Intergenic
1162899605 19:13786761-13786783 CTCACTCAGTCGCCCAGGCTGGG - Intergenic
1163048207 19:14660970-14660992 TTCACTCTGTCACCCAGGCTGGG + Intronic
1163144506 19:15371517-15371539 CTCCCTCTGTCGCCCAGGCTGGG + Intronic
1163814083 19:19453142-19453164 TTCTCCTGGGCCCCCAGGCTGGG + Intronic
1164974283 19:32560263-32560285 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
1165031375 19:33000249-33000271 TTCGCTCTGTCACCCAGGCTTGG + Intronic
1165315836 19:35054874-35054896 TTCCCACAGCCCCGCAGGTTGGG - Intronic
1165380532 19:35476380-35476402 TTACCTCAGGTCACCAGCCTGGG + Intergenic
1165413488 19:35676866-35676888 TTCACTCTGTCGCCCAGGCTGGG - Intronic
1166480695 19:43170593-43170615 TTCCCACAGGCTCCCAGGAAGGG + Intronic
1166735598 19:45082382-45082404 TACCCTCTATCCCCCAGGCTGGG + Intronic
1166835239 19:45663656-45663678 TTCACTCTGTCGCCCAGGCTAGG - Intergenic
1166888493 19:45975400-45975422 TGCTCTCAGGTCCCCAGGATGGG + Intergenic
1167063583 19:47167295-47167317 CTCGCTCTGTCCCCCAGGCTGGG + Intronic
1167257331 19:48438809-48438831 ATCCCTCTGTCACCCAGGCTGGG + Intronic
1167260208 19:48453994-48454016 TGCCCCCAGGCCGCTAGGCTGGG + Exonic
1167416379 19:49375221-49375243 TTGCCTAAGTCTCCCAGGCTTGG + Intergenic
1167431648 19:49458664-49458686 TGCCCTCAGGGCCCTAGGCAAGG - Intronic
1167663625 19:50810951-50810973 TTCCCTCAGGAACCAAGGCGAGG - Intergenic
1168018793 19:53594347-53594369 TTCCCTCAGGGCCTGAGGTTGGG - Intergenic
1168525354 19:57084375-57084397 TTCTCTCTGTCACCCAGGCTGGG + Intergenic
1168692085 19:58383359-58383381 ATCCCACAGGTCCCCAGTCTGGG + Intergenic
925013248 2:501938-501960 TGCCTGCAGGCTCCCAGGCTTGG + Intergenic
925340058 2:3130006-3130028 TTCACTCTGTCACCCAGGCTGGG - Intergenic
926227014 2:10973920-10973942 ATCTCCCACGCCCCCAGGCTGGG + Intergenic
926249461 2:11145789-11145811 CTCACTCAGGGCTCCAGGCTTGG - Exonic
926898298 2:17719938-17719960 TTCTTTCTGGCCCCCAAGCTTGG - Intronic
926935637 2:18084614-18084636 TTCCCTAAGTCCCTAAGGCTTGG + Intronic
927201889 2:20583179-20583201 GTTTCTCAGGCCCCCAGCCTGGG + Intronic
927700291 2:25263865-25263887 TTCCCTGAGGCCCTTAGGCAGGG + Intronic
927701067 2:25269296-25269318 TTCACTCTGTCTCCCAGGCTGGG - Intronic
927809981 2:26175379-26175401 TTCCCCCAGGCCCCAGGGCTGGG + Intronic
927917174 2:26944774-26944796 GTCCCTCATGCCCCCATGCCGGG - Exonic
928231606 2:29503649-29503671 TTCACTCATGCCCCTGGGCTGGG - Intronic
928946027 2:36772674-36772696 CTCACTCTGTCCCCCAGGCTGGG - Intronic
928973837 2:37062816-37062838 TTCACTCTGTCACCCAGGCTGGG + Intronic
929065414 2:37968325-37968347 CTGCCTCAGCCCCCCAAGCTGGG - Intronic
929516923 2:42611782-42611804 CTCACTCTGTCCCCCAGGCTAGG - Intronic
929690938 2:44072584-44072606 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
930020855 2:47001373-47001395 TTCCCTCAGTCGGCCAGTCTGGG - Intronic
931173936 2:59834027-59834049 CTCCCTCAGCACCCCAGGCTGGG + Intergenic
931245782 2:60491715-60491737 TCCCCTCAGTTCTCCAGGCTGGG + Intronic
932152032 2:69381892-69381914 GTCACTCAGTCACCCAGGCTGGG + Intronic
932506014 2:72233039-72233061 TTCACTCTGTCACCCAGGCTGGG - Intronic
932655919 2:73611104-73611126 TTCCCCCAGGCCACCAGCCATGG + Intergenic
933058079 2:77698928-77698950 CTCGCTCTGTCCCCCAGGCTGGG - Intergenic
934961524 2:98679599-98679621 TTCACTCTGTCGCCCAGGCTGGG - Intronic
934979227 2:98826522-98826544 GACTCTCAGGCCCCAAGGCTGGG + Intronic
935437227 2:103047707-103047729 TTCGATCAGGCCCCCAGGCATGG + Intergenic
935914933 2:107938723-107938745 CTCACTCAGCCACCCAGGCTCGG - Intergenic
935990473 2:108714720-108714742 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
938255747 2:129858612-129858634 GTCCCACAAGCCTCCAGGCTGGG - Intergenic
938273255 2:129993562-129993584 TTCCCTCGGCCCCCCATGCCCGG + Intergenic
938814247 2:134883530-134883552 TTCACTCTGTCGCCCAGGCTGGG + Intronic
942127378 2:172840870-172840892 TTCCCTAAGGCCACCATGCTGGG + Intronic
942317789 2:174710687-174710709 TTCTTCCATGCCCCCAGGCTTGG + Intergenic
942459716 2:176160515-176160537 TTCCTTCCAGCCCCCAGGCTTGG + Intronic
942612645 2:177757770-177757792 TCACCTCATCCCCCCAGGCTGGG - Intronic
943038820 2:182779408-182779430 TTCTATCAGGCAGCCAGGCTTGG + Exonic
943181975 2:184555972-184555994 CTCGCTCAGTCGCCCAGGCTAGG - Intergenic
944175744 2:196827206-196827228 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
944773277 2:202935044-202935066 CTCACTCTGGCCCTCAGGCTGGG - Intronic
945137155 2:206641535-206641557 TTGCCTCAGGCCCCTTGGCTGGG + Intergenic
945921317 2:215757501-215757523 TTCACTCTGTCGCCCAGGCTGGG - Intergenic
946950346 2:224867494-224867516 TAACCTCTTGCCCCCAGGCTAGG + Intronic
947177242 2:227380297-227380319 CTCCCTCTGTCGCCCAGGCTGGG - Intronic
947362858 2:229364026-229364048 CTCCCTCTGTCGCCCAGGCTGGG + Intronic
947521471 2:230849363-230849385 CTCCCTCCGTCGCCCAGGCTGGG - Intergenic
947830475 2:233137485-233137507 CTCCCTCTGTTCCCCAGGCTGGG + Intronic
947914508 2:233822758-233822780 TTCCCTCAGTCCCTTGGGCTGGG + Intronic
948426084 2:237887217-237887239 TTCACTCCAGCCCCCAGGCTGGG + Intronic
948922208 2:241071098-241071120 GTCCTTCAGCCTCCCAGGCTGGG - Intronic
1169021431 20:2334045-2334067 TTCCCTCAGGCTGTCATGCTGGG - Intronic
1169170634 20:3462043-3462065 TTCCCTCTGTCGCTCAGGCTAGG + Intergenic
1169204392 20:3732115-3732137 GGCCCTCGGGTCCCCAGGCTAGG - Intergenic
1170031674 20:11950400-11950422 TACCCTGAGGCCGCCATGCTTGG + Intergenic
1170830111 20:19832613-19832635 GTCCCTCAGTGCCCCAGACTGGG + Intergenic
1171227511 20:23453513-23453535 TCCCATCAGGTCCCCAGGATGGG - Intergenic
1171967584 20:31542185-31542207 TTCCTCCAATCCCCCAGGCTGGG - Intronic
1172277098 20:33685876-33685898 TTGACTGAGGCGCCCAGGCTGGG - Intronic
1172295916 20:33811282-33811304 CTCCCACAGGCCCCCACGCCCGG - Exonic
1172411827 20:34730096-34730118 GTCACTCTGTCCCCCAGGCTGGG + Intronic
1172411950 20:34731048-34731070 TTCACTCTGTCGCCCAGGCTGGG + Intronic
1172412266 20:34734102-34734124 CTCACTCTGTCCCCCAGGCTGGG + Intronic
1172912404 20:38419764-38419786 CTCACTCTGGCACCCAGGCTGGG + Intergenic
1173518796 20:43683957-43683979 TTCGCTCTGTCACCCAGGCTGGG + Intronic
1173965016 20:47106205-47106227 TTGCCTCAGGCCCTGTGGCTTGG + Intronic
1174395389 20:50243906-50243928 TTCACACAGGGCCCCATGCTTGG - Intergenic
1174563443 20:51447429-51447451 TTAATTCAGGCCCCCAGGCTTGG - Intronic
1175129803 20:56780659-56780681 CTCACTCTGGCACCCAGGCTGGG + Intergenic
1176061721 20:63175551-63175573 TTCCCCCAGCCCGCCTGGCTGGG + Intergenic
1176067500 20:63206012-63206034 TTCGCTCACCCCCCCAGTCTGGG - Intronic
1176137503 20:63530614-63530636 TGCCCTCGGGAGCCCAGGCTGGG - Intronic
1176254901 20:64146748-64146770 TCCCCTCAAGACCCCAGGCCTGG + Intergenic
1176255899 20:64152895-64152917 GTGCCTCGGGCTCCCAGGCTCGG + Intronic
1177476282 21:21628143-21628165 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1178234497 21:30825319-30825341 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
1178547248 21:33502569-33502591 CTCACTCAGTCACCCAGGCTGGG - Intergenic
1178592704 21:33924858-33924880 GTCCCCCAGGCCCCAAGGCTTGG - Intergenic
1178999622 21:37444659-37444681 CTCTCTCATGCACCCAGGCTTGG - Intronic
1179173451 21:38990744-38990766 GACCCTCAGGCCCCCAAACTGGG + Intergenic
1179266151 21:39805462-39805484 GTTCCTCAGGCCCACAGGCATGG - Intergenic
1179573181 21:42290266-42290288 TGACTTCAGGCCCCCATGCTTGG - Intronic
1179720620 21:43314204-43314226 TGCCCTGAGGCCACCAGGCCAGG - Intergenic
1180157367 21:45984042-45984064 ATCCCTCAGGCCCTCAGACCAGG - Intronic
1180847980 22:18994850-18994872 CTCCCTCAGGGCCACAAGCTGGG + Intergenic
1181184273 22:21091216-21091238 TTCGCTCTGTCGCCCAGGCTGGG + Intergenic
1181306776 22:21921516-21921538 CTCCCTGAGGCACCCAGGATCGG + Exonic
1181647176 22:24238196-24238218 CTCACTCTGTCCCCCAGGCTGGG - Intronic
1181886281 22:26024698-26024720 CTCACACAGGCCCCCAGCCTGGG + Intronic
1182225155 22:28792015-28792037 TTCGCTCTGTCGCCCAGGCTGGG - Intergenic
1182767281 22:32766698-32766720 TTCCCCCAGGTACCCAGTCTAGG + Intronic
1182983726 22:34697447-34697469 TACCTTTAGGACCCCAGGCTGGG + Intergenic
1183191083 22:36322466-36322488 TTCCCGAAGGCCTCCAGGATGGG + Exonic
1183299381 22:37051573-37051595 TCCCCGCAGGCCCGCAGTCTGGG - Intergenic
1183357295 22:37366620-37366642 TCCCCTCAGGCCCCTCAGCTGGG - Intergenic
1183393066 22:37556788-37556810 TTCCCTTAGGCCCCTTGCCTTGG + Intergenic
1183476834 22:38040252-38040274 GTCTCACTGGCCCCCAGGCTGGG - Intronic
1183940470 22:41291950-41291972 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1184240076 22:43207323-43207345 TTCCCTCAGGCCTCCTGGTCTGG + Intronic
1185086666 22:48744534-48744556 TTCCCTCAGCCCTGCAGCCTTGG + Intronic
949244713 3:1913650-1913672 TTCCCCCAGGCCCCCACCATGGG + Intergenic
950312078 3:11967480-11967502 CACTCTCAGGCCCTCAGGCTTGG + Intergenic
950728061 3:14932111-14932133 CTCACTCTGCCCCCCAGGCTGGG + Intronic
952926367 3:38322883-38322905 TTCACTCTGTCACCCAGGCTGGG - Intergenic
953025197 3:39141244-39141266 CTTTCTCAGGCCCCCAGACTGGG + Intergenic
953130406 3:40132651-40132673 TACTCTCATGCCCCCAGGGTGGG - Intronic
953133894 3:40166550-40166572 TTCCCACGGACCCCAAGGCTTGG - Intronic
953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG + Intronic
954327226 3:49870098-49870120 CTCCCTTAGGCCCTCAGCCTGGG + Exonic
954387262 3:50250674-50250696 CTCCCTCTGGCCCCCAGCCAGGG + Intronic
954409290 3:50363385-50363407 TCCCCACTGGCCCCCAGGCTGGG + Intronic
954426902 3:50448073-50448095 TTCCCTAAGGGCCCTAGGGTAGG - Intronic
954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG + Intronic
954880582 3:53833423-53833445 CCCTCTCAGGCCCGCAGGCTGGG + Intronic
955213292 3:56962012-56962034 CTCCCTCTGTCACCCAGGCTGGG - Intronic
955315632 3:57936628-57936650 TTCACTCTGTCACCCAGGCTGGG - Intergenic
955820059 3:62887321-62887343 GTCCCTCAGGCCACCAGGGATGG - Intergenic
956233985 3:67046176-67046198 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
956682999 3:71798938-71798960 CTCCCTCAGTTGCCCAGGCTGGG - Intergenic
956810989 3:72863989-72864011 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
957220949 3:77381282-77381304 CTCCCTCTGTCACCCAGGCTGGG - Intronic
958196429 3:90246939-90246961 TTCCCTAAAGCCCTCAGGCATGG + Intergenic
958447577 3:94234117-94234139 CTCGCTCAGTCGCCCAGGCTGGG - Intergenic
958681243 3:97334508-97334530 TTTTCTCTGTCCCCCAGGCTGGG + Intronic
959088252 3:101874332-101874354 TTCACTCTGTCACCCAGGCTGGG - Intergenic
959530416 3:107429913-107429935 CCCCCCCAGGCGCCCAGGCTGGG + Intergenic
960121017 3:113948402-113948424 TTCCCACCAGCGCCCAGGCTTGG + Intronic
960594827 3:119398695-119398717 TTCCTTGAGGCCTGCAGGCTGGG - Intronic
961832805 3:129632932-129632954 TTGCCTGAGGTCACCAGGCTTGG + Intergenic
963129154 3:141841937-141841959 CTCTCTCAGCCGCCCAGGCTGGG - Intergenic
963386879 3:144608305-144608327 TTCATTCTGGCACCCAGGCTGGG + Intergenic
964101609 3:152994527-152994549 TTCACTCTGTCGCCCAGGCTGGG + Intergenic
965359905 3:167726149-167726171 TTCACTCTGTCACCCAGGCTGGG + Intronic
965569031 3:170152689-170152711 CTCCCTCTGTCACCCAGGCTGGG + Intronic
966301105 3:178480486-178480508 TGCCCCCAGGCACCCAGGCTGGG - Intronic
968023545 3:195417908-195417930 CTCCCTCTGTCACCCAGGCTGGG - Intronic
968286706 3:197513166-197513188 GCCCCTGATGCCCCCAGGCTGGG - Intronic
968298766 3:197597451-197597473 TTCCGTCAGGCCACCAGTGTGGG - Intergenic
968425730 4:522069-522091 TTCCCTGAGGCCCCCTGTCCAGG - Intronic
968543976 4:1186332-1186354 CTCCCTCTGTCACCCAGGCTGGG + Intronic
968936390 4:3612604-3612626 TTCCCACAAGGCTCCAGGCTGGG + Intergenic
969153875 4:5193097-5193119 TGCCCTCATTCCCCCAGGCATGG - Intronic
969276824 4:6141403-6141425 TTCACTCTGTCGCCCAGGCTGGG - Intronic
969391368 4:6893318-6893340 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
970062858 4:12054719-12054741 TTCACTCTGGTCACCAGGCTTGG + Intergenic
970464093 4:16306021-16306043 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
972629199 4:40828887-40828909 CTCCCTCAGGCACCATGGCTTGG + Intronic
972670975 4:41214057-41214079 TTCCCTCAGCAGCCCCGGCTTGG - Intronic
973324934 4:48850601-48850623 TTCACTCTGGCTCCCAGGCTAGG + Intronic
973802918 4:54496538-54496560 GTCCATCAGACCCCAAGGCTGGG - Intergenic
974210239 4:58763528-58763550 TTCACTCTGTCGCCCAGGCTGGG - Intergenic
975878344 4:78870268-78870290 TTCCCTCAGGGTCCCTGGTTAGG + Intronic
976076069 4:81300509-81300531 CTCACTCAGCCACCCAGGCTGGG + Intergenic
976194225 4:82517690-82517712 TGCTCTCAGGCCTCCAGACTTGG + Intronic
976208317 4:82642585-82642607 TTTCATCAGTCCCCCAGGCGAGG + Intronic
977734601 4:100398632-100398654 TGCATTCAGGCACCCAGGCTGGG + Intronic
978789551 4:112646258-112646280 GCCCCTCAGGCCCTCAGGCTCGG - Intronic
979692614 4:123575842-123575864 TTCACCTAGGTCCCCAGGCTGGG - Intergenic
980905894 4:138948320-138948342 CTCCCTCTGTCGCCCAGGCTGGG - Intergenic
981906706 4:149929580-149929602 CTCACTCTGGCACCCAGGCTGGG + Intergenic
981976664 4:150738020-150738042 TTCGCTCTGTCGCCCAGGCTGGG + Intronic
984195828 4:176657498-176657520 TTCACTCTGTCACCCAGGCTGGG - Intergenic
984269088 4:177528857-177528879 TGCCCTGAGGCCCTAAGGCTTGG - Intergenic
984784121 4:183552599-183552621 TTCCCTCAGGCCCCGTCGGTGGG + Intergenic
984901440 4:184590176-184590198 GTCCCTCTGTCACCCAGGCTGGG - Intergenic
984952847 4:185019600-185019622 TGCGCTCAGGCCCCCCGCCTGGG - Intronic
985134907 4:186776728-186776750 TTCACTCTGTCACCCAGGCTGGG + Intergenic
986479156 5:8167349-8167371 CTCTCTCAGTCACCCAGGCTGGG + Intergenic
986705509 5:10451356-10451378 TTGCTTCAGGCCACCAGGCAGGG - Intronic
986992960 5:13575297-13575319 TTCGCTCTGTCACCCAGGCTGGG - Intergenic
987132658 5:14872551-14872573 TCCCCGCAGGCTCCCAGGCTGGG + Intergenic
987410449 5:17609907-17609929 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
987850916 5:23353002-23353024 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
988854774 5:35217214-35217236 TTCACTTAGGCCCCCAGTGTTGG - Intronic
988882615 5:35519960-35519982 TTCTCTCCGGACCCCAGGCAGGG - Intergenic
990413831 5:55566976-55566998 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
990468142 5:56088460-56088482 CTCTCTCTGTCCCCCAGGCTGGG - Intergenic
991372874 5:65937875-65937897 CTAGCTCAGTCCCCCAGGCTGGG - Intronic
993329531 5:86580442-86580464 CTCACTCTGTCCCCCAGGCTGGG - Intergenic
994739275 5:103597388-103597410 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
996047714 5:118894008-118894030 CTCCCTCTGTCACCCAGGCTGGG - Intronic
996106427 5:119509659-119509681 TTCCATTATGTCCCCAGGCTTGG + Intronic
997298875 5:132787833-132787855 TTCCATCAGTCGCCCAGGCTGGG + Intronic
997434089 5:133861661-133861683 TTCCCTGAGCCCCCCAAGTTTGG - Intergenic
997469343 5:134108241-134108263 TTTCTTCAGGCTCCCAGGGTGGG - Intergenic
998018644 5:138752657-138752679 CTCCCTCTGTCGCCCAGGCTGGG - Intronic
998163385 5:139826269-139826291 TCCTGTCAGGCCCCCAGGCAAGG - Intronic
999439939 5:151593301-151593323 TTCCCTCGGGGGCCAAGGCTGGG + Intergenic
999693766 5:154170612-154170634 GTCTCTCAGGACTCCAGGCTTGG - Intronic
1000864368 5:166494307-166494329 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1001392222 5:171388247-171388269 TTACCTCAGGCCCCGGGCCTCGG - Intronic
1001690328 5:173628280-173628302 TGCCCTCTGGCCCTCAGCCTGGG + Intergenic
1001725534 5:173894588-173894610 CTCACTCTGTCCCCCAGGCTAGG - Intronic
1002204070 5:177550858-177550880 TTCCCTCTCTCCCCCAGGCTGGG + Intronic
1002421042 5:179149168-179149190 TTCCCGAAGGCCCCCACACTGGG - Intronic
1002704849 5:181153645-181153667 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1002813501 6:657042-657064 CTCCCTCCGGCCCCCCAGCTAGG + Intronic
1003183179 6:3809242-3809264 TTCCCTTAGCTCCCCAGGGTTGG - Intergenic
1003296988 6:4838715-4838737 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1003423771 6:5982763-5982785 TCCCCTCTGTCACCCAGGCTAGG - Intergenic
1003533225 6:6954916-6954938 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1003589996 6:7429127-7429149 CTCACTCTGGCGCCCAGGCTGGG - Intergenic
1003856360 6:10280037-10280059 CTCCCTCTGTCGCCCAGGCTGGG - Intergenic
1003997647 6:11559222-11559244 TTCACTCTGTCACCCAGGCTGGG + Intronic
1004448398 6:15723964-15723986 CTCCCTATGGACCCCAGGCTAGG - Intergenic
1006032933 6:31190745-31190767 TTCACTCTGTCACCCAGGCTGGG - Intergenic
1006441512 6:34056467-34056489 CGGCCTCAGGCCCCCAGGCTCGG + Intronic
1006590909 6:35156977-35156999 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1007060375 6:38934320-38934342 CTCCCTCTGACACCCAGGCTAGG - Intronic
1007291295 6:40788950-40788972 GGCCCTCAGGCACTCAGGCTGGG + Intergenic
1007605087 6:43112297-43112319 CTCCCTCTGTCACCCAGGCTGGG + Intronic
1007690398 6:43697331-43697353 TTCACTCTGTCACCCAGGCTGGG - Intergenic
1008535525 6:52503998-52504020 TGCAGACAGGCCCCCAGGCTGGG + Intronic
1009606938 6:65882826-65882848 TTCACTCTGTCACCCAGGCTAGG + Intergenic
1010211746 6:73367569-73367591 GTCGCTCTGTCCCCCAGGCTGGG - Intergenic
1010227013 6:73499489-73499511 TTCACTCTGTCACCCAGGCTGGG - Intronic
1010588434 6:77683556-77683578 TTCTCTCTGGCCCCCACCCTTGG + Intergenic
1013512717 6:110859075-110859097 CTCCCTCGGGCGCGCAGGCTCGG + Intronic
1013596085 6:111662289-111662311 TTCCCTCTGGCCCCTTGGCAGGG - Intronic
1014809781 6:125871964-125871986 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1015126596 6:129762111-129762133 TTCCTCCAGGCCCCCAGACAGGG - Intergenic
1016971372 6:149767481-149767503 TTCACTCTGTCACCCAGGCTAGG + Intronic
1017616203 6:156249556-156249578 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018586318 6:165363483-165363505 CTCACTCAGTCGCCCAGGCTGGG - Intronic
1018635787 6:165858276-165858298 TTTCCTCAGGCCCTCAGCCCAGG + Intronic
1018907749 6:168085215-168085237 TCCCCACAGGCCCTCAGGTTGGG - Intergenic
1019267582 7:127074-127096 CTCCCACAGGAGCCCAGGCTCGG - Intergenic
1020027745 7:4911117-4911139 CTCCCTGAAGCCCCCAGGCCTGG + Intronic
1022101557 7:27172525-27172547 TTTCCTGTAGCCCCCAGGCTAGG + Intronic
1022870125 7:34469546-34469568 CTCGCTCTGGCGCCCAGGCTGGG + Intergenic
1023534602 7:41194979-41195001 GTCCCTCAGGCCTTCAGACTTGG - Intergenic
1023679495 7:42670804-42670826 CTCCCTCTGTCGCCCAGGCTGGG + Intergenic
1023813392 7:43929671-43929693 CTCTCACAGGGCCCCAGGCTTGG + Intronic
1023828811 7:44027807-44027829 GTCCCTGAGGCCCCCAGACCTGG - Intergenic
1024272735 7:47655004-47655026 TTCCCACAGGCGCCCAGCCCTGG + Intergenic
1024757043 7:52546472-52546494 CTCCCTGAGACACCCAGGCTGGG + Intergenic
1025098629 7:56116781-56116803 TTACCTCAGTCTCGCAGGCTGGG - Intergenic
1026550199 7:71361985-71362007 CTCCCTCAGTTGCCCAGGCTGGG + Intronic
1027445414 7:78267794-78267816 TTCCCTGAAACCCCTAGGCTAGG - Intronic
1028434449 7:90785754-90785776 CTCACTCAGCCGCCCAGGCTGGG - Intronic
1029156164 7:98519469-98519491 TTGCCTCAGGTCTCCAGACTGGG + Intergenic
1029594253 7:101528436-101528458 TTCCCTCAGGCCCCAAGGGTGGG + Intronic
1029739110 7:102482064-102482086 GTCCCTGAGGCCCCCAGACCTGG - Intergenic
1029757111 7:102581243-102581265 GTCCCTGAGGCCCCCAGACCTGG - Exonic
1029775052 7:102680304-102680326 GTCCCTGAGGCCCCCAGACCTGG - Intergenic
1029814253 7:103076917-103076939 CTCCCTCTGTCACCCAGGCTCGG + Intronic
1030267671 7:107636905-107636927 GTCGCTCAGTCACCCAGGCTGGG - Intergenic
1030304377 7:108003466-108003488 GTCCCGCCGGCCCCCTGGCTGGG - Intergenic
1030794708 7:113773205-113773227 CTCCCTCTGTCACCCAGGCTGGG - Intergenic
1031326325 7:120403345-120403367 CTCCCTCGGTCACCCAGGCTGGG + Intronic
1031377714 7:121048568-121048590 CTCCCTCTGACACCCAGGCTGGG + Intronic
1032082814 7:128868623-128868645 CTCCCTCAGGAACCCATGCTTGG + Intronic
1032091591 7:128914196-128914218 GTTCCTCCTGCCCCCAGGCTGGG - Intergenic
1033057557 7:138073118-138073140 TTCACTCCATCCCCCAGGCTAGG - Intronic
1033107972 7:138547704-138547726 TTCCCTCTGTCACCCAGGCTTGG + Intronic
1033361687 7:140642444-140642466 CTGCCTCAGCCTCCCAGGCTTGG + Intronic
1034080099 7:148268622-148268644 CTCCCTCTGTCGCCCAGGCTGGG - Intronic
1034225234 7:149476281-149476303 CTCACTCTGTCCCCCAGGCTTGG - Intronic
1034474456 7:151274577-151274599 AACCCTCAGGGCCCCAGGCAGGG - Intronic
1035062401 7:156079321-156079343 TTCCCACAGGCTCCCTGGATGGG + Intergenic
1035635498 8:1140602-1140624 TTCCCTCACTCAGCCAGGCTGGG + Intergenic
1036446042 8:8822554-8822576 TCACCTCAGGCCCCCTGACTTGG - Intronic
1037811855 8:22091100-22091122 TACCCTCAGGTCGCCAGTCTAGG + Intronic
1037835325 8:22211999-22212021 TTCCCTCTTGCCACCAGGCAGGG - Exonic
1037867911 8:22462210-22462232 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1038323030 8:26546889-26546911 CTCCCTCAGTCGCCCAGGCTGGG - Intronic
1038561993 8:28588828-28588850 TTCGCTCTGTCGCCCAGGCTGGG + Intergenic
1038748609 8:30275884-30275906 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1038799431 8:30735806-30735828 CTCACTCTGTCCCCCAGGCTGGG - Intronic
1038968814 8:32608207-32608229 TTCACTCTGTCACCCAGGCTAGG + Intronic
1038987637 8:32829697-32829719 CTCCCTCTGTCCCCCAGGCTGGG - Intergenic
1039390428 8:37176212-37176234 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1039646162 8:39285292-39285314 CTCCCTCAGAAACCCAGGCTGGG - Intergenic
1039831783 8:41221202-41221224 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1040009329 8:42648264-42648286 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1041802243 8:61812973-61812995 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1042233233 8:66580889-66580911 TTCACTCAGTTGCCCAGGCTGGG + Intronic
1042389129 8:68212976-68212998 TATCCTGAGGCCCCCAGGATGGG - Intronic
1042510849 8:69609313-69609335 CTCACTCAGTCGCCCAGGCTGGG - Intronic
1042649211 8:71021531-71021553 TTCGCTCTGTCGCCCAGGCTGGG + Intergenic
1043937792 8:86161527-86161549 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1045281231 8:100751334-100751356 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1046420792 8:113980506-113980528 TTCCTCCAGGCCCTCAGGGTGGG - Intergenic
1046924767 8:119774138-119774160 CTCGCTCTGTCCCCCAGGCTAGG - Intronic
1047444331 8:124906092-124906114 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1047712679 8:127567988-127568010 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1048226502 8:132592296-132592318 TTCCCTGAGCCCCCAAAGCTAGG - Intronic
1049379271 8:142303930-142303952 TTTCCTCAGGCCCCTCGGCAGGG + Intronic
1049797413 8:144503053-144503075 GCCCCTCTGGCCCCCAGGCCGGG - Intronic
1050511010 9:6395740-6395762 GTCACTCAGGCACTCAGGCTGGG + Intergenic
1051136882 9:13932814-13932836 TTCCCTCACTCCCTCAGGGTTGG + Intergenic
1051656991 9:19392620-19392642 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1052817425 9:33112268-33112290 ACCCCTCAGGCCCCTAGGCTGGG - Exonic
1052947848 9:34182739-34182761 TTCACTCAGTCGCCCAGGCTGGG + Intronic
1055328913 9:75161928-75161950 ATCCCTCTGTCACCCAGGCTGGG + Intergenic
1055730704 9:79277149-79277171 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1055939067 9:81632057-81632079 TTCGCTCTGTCACCCAGGCTGGG - Intronic
1056673159 9:88648886-88648908 CTCCCTCTGTCACCCAGGCTGGG + Intergenic
1057414444 9:94848589-94848611 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1057485215 9:95477486-95477508 TGCCACCCGGCCCCCAGGCTTGG - Intronic
1057496117 9:95562726-95562748 GTCCCCCAGGCCCCCACCCTGGG - Intergenic
1058890325 9:109355646-109355668 TTTGCTCTGTCCCCCAGGCTGGG + Intergenic
1058942243 9:109823917-109823939 CTCACTCTGGCGCCCAGGCTGGG + Intronic
1059335603 9:113566736-113566758 TGCCCTCAGGCCTTCTGGCTGGG + Intronic
1059786437 9:117591333-117591355 TTCCCTGAACCCTCCAGGCTAGG - Intergenic
1060023334 9:120150714-120150736 TTCCCCCAGTTGCCCAGGCTGGG - Intergenic
1060025671 9:120168952-120168974 ATCCCTCAGGCCACCCAGCTGGG + Intergenic
1060420710 9:123467740-123467762 GTCACACAGGGCCCCAGGCTTGG - Intronic
1060807847 9:126588662-126588684 TGCCCTCAGCTCCCCAGCCTGGG - Intergenic
1060985795 9:127818302-127818324 CTCCCTCAGGCCCCAAGTCCAGG + Exonic
1061215043 9:129216849-129216871 CTCACTCTGTCCCCCAGGCTGGG + Intergenic
1061225242 9:129277448-129277470 TTCACTCTGTCACCCAGGCTGGG + Intergenic
1061370873 9:130196711-130196733 CTCCCTCTGTCACCCAGGCTGGG - Intronic
1061743819 9:132725619-132725641 TGCCCCCAGCCCCCCAGCCTCGG - Exonic
1061820551 9:133225311-133225333 CTAGCTCAGGCCTCCAGGCTGGG - Intergenic
1061930323 9:133829052-133829074 CTGCCTCTGGACCCCAGGCTGGG + Intronic
1062211726 9:135368050-135368072 CTCCCTCTGTCCCCCAGGCTGGG - Intergenic
1062308648 9:135923685-135923707 TCCCCTGCGACCCCCAGGCTGGG + Intergenic
1062361127 9:136188706-136188728 TTCACTCAGTTGCCCAGGCTGGG - Intergenic
1062409977 9:136418694-136418716 TATCCTCAGGCCACCAGGCCAGG + Intronic
1185635382 X:1548205-1548227 TTCGCTCTGTCACCCAGGCTGGG - Intergenic
1186105341 X:6199974-6199996 TTCCCTCAGTCTCCCTGGCTTGG + Intronic
1187877925 X:23819425-23819447 CTCCCTCTGCCACCCAGGCTGGG - Intergenic
1189452917 X:41156332-41156354 TTCCCTGAGGCTGCCAGTCTAGG + Intronic
1189480609 X:41389666-41389688 TTCCATGTGGCCCCCAGGTTGGG - Intergenic
1190100490 X:47518992-47519014 CTCCCTCTGTCACCCAGGCTAGG - Intergenic
1190295866 X:49027146-49027168 TTCCCTCTGTCACCCAGGCTGGG - Intergenic
1190634134 X:52417856-52417878 TTCCCTCTGTTGCCCAGGCTGGG - Intergenic
1191054612 X:56229138-56229160 TTCCCTCCAGCCCTCAGACTGGG + Intergenic
1191586167 X:62828997-62829019 TTCCTTCAGGCCCACAGCATTGG + Intergenic
1192193461 X:69013061-69013083 ATCCCTCAGGACTCAAGGCTAGG + Intergenic
1192205381 X:69092462-69092484 TTCTCTCTGGCCACCAGCCTAGG - Intergenic
1195030224 X:100920788-100920810 CTCCCTCTGTCGCCCAGGCTGGG + Intronic
1196035293 X:111137247-111137269 TTCTCTCAGGACTACAGGCTTGG + Intronic
1196204140 X:112919981-112920003 CTCGCTCTGTCCCCCAGGCTGGG + Intergenic
1196793673 X:119485882-119485904 TTCCCTCTGTCGCCCAGGCTGGG - Intergenic
1197768482 X:130074179-130074201 TTCCCTCAGGGCACAAGGCAGGG + Intronic
1200170046 X:154065979-154066001 CTCACTCAGTCACCCAGGCTGGG + Intronic