ID: 903548429

View in Genome Browser
Species Human (GRCh38)
Location 1:24141483-24141505
Sequence CTGGGTTGCAAGGAGGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 445}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903548429 Original CRISPR CTGGGTTGCAAGGAGGCTGG TGG Intronic
900137038 1:1122074-1122096 CTGGCTGGGCAGGAGGCTGGGGG + Intergenic
900436959 1:2635373-2635395 CAGGGGTCCAAGGAGGCAGGTGG + Intergenic
900459947 1:2798215-2798237 CTGGGAGGCTGGGAGGCTGGGGG - Intronic
900459999 1:2798359-2798381 CTGGGAGGCTGGGAGGCTGGGGG - Intronic
900460119 1:2798735-2798757 CTGGGAGGCTGGGAGGCTGGGGG - Intronic
900460255 1:2799159-2799181 CTGGGAGGCTGGGAGGCTGGGGG - Intronic
900693012 1:3992999-3993021 CTGGGGTGCATTTAGGCTGGAGG + Intergenic
901091512 1:6644771-6644793 CTGGGGGTCGAGGAGGCTGGAGG - Intronic
902201919 1:14839908-14839930 CTGGGTTGCAATAATTCTGGGGG + Intronic
902289193 1:15425791-15425813 CTTGAGTGCAAGGAGACTGGGGG - Intronic
902383688 1:16064625-16064647 TTGGGTTGCCAGGATGCTGACGG - Intronic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
904204096 1:28841367-28841389 GCAGGTGGCAAGGAGGCTGGGGG + Intronic
904290525 1:29482846-29482868 CTGGGTGGAAAAGAGGCTGCTGG - Intergenic
904311538 1:29632661-29632683 CTGAGGGGCCAGGAGGCTGGGGG - Intergenic
904311549 1:29632693-29632715 CTGAGTGGCTGGGAGGCTGGGGG - Intergenic
904982034 1:34513323-34513345 GTGGGTTGCAGGGAGGAGGGAGG - Intergenic
905137456 1:35810446-35810468 CTAGGTTGCAGGGAGGCGGTGGG - Intronic
905339352 1:37267599-37267621 GTGGCTTGCAGGGAGGCAGGAGG - Intergenic
905478729 1:38246799-38246821 CTGGCTGTCAAGGGGGCTGGAGG - Intergenic
905653134 1:39669591-39669613 CTGGGAGGCAAGAAGCCTGGAGG - Intronic
906245066 1:44267671-44267693 CTTGGCTGCAAGCAGGCAGGCGG - Intronic
907046902 1:51305054-51305076 CAGGGGTGCTAGGAGGCAGGTGG + Intronic
907663352 1:56413755-56413777 CTGGGTTGAAGGAAGGCTGTGGG - Intergenic
908953253 1:69588121-69588143 CTGGGATGGAAGGAGGCAGAAGG - Intronic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
911851505 1:102826909-102826931 CAAGGCTGCAGGGAGGCTGGGGG + Intergenic
912247190 1:107971821-107971843 TTGGGGTGAAAGGAGGTTGGTGG - Intergenic
912543832 1:110436797-110436819 CTAGCGTGCAAGGAGGCTGAAGG + Intergenic
914196916 1:145452417-145452439 CTGGGGTGGGAGGTGGCTGGTGG - Intergenic
915076066 1:153308841-153308863 CTGGAATGGAGGGAGGCTGGGGG - Intronic
915562765 1:156697067-156697089 CCGGAGTGCAGGGAGGCTGGAGG - Intergenic
915677704 1:157547150-157547172 CTGTGGTCCATGGAGGCTGGAGG + Exonic
917080254 1:171250906-171250928 CTGGGGTTCAATCAGGCTGGTGG + Intronic
918094073 1:181320370-181320392 ATGGGCTGCAAGGGGGATGGAGG - Intergenic
918555190 1:185790791-185790813 CTGGGTTGAGAGGAAACTGGAGG + Intronic
918854504 1:189733679-189733701 ATGGGTGTGAAGGAGGCTGGGGG - Intergenic
920137432 1:203781369-203781391 CTGGGCTGCATGGAGCCTGCAGG + Intergenic
920712777 1:208310781-208310803 CTGTGGGGCAAGGAGGTTGGAGG + Intergenic
921103056 1:211948036-211948058 TTGGGTTTCAATCAGGCTGGTGG - Intronic
921612601 1:217230164-217230186 CTGGGGTGAAAGGTGGGTGGGGG + Intergenic
921874327 1:220176985-220177007 CTGTGTGAAAAGGAGGCTGGGGG - Intronic
921939619 1:220826607-220826629 CTGGGTGGGAAGGAGGTGGGCGG + Intergenic
922774395 1:228208146-228208168 CTGGGCAGCACGCAGGCTGGGGG - Exonic
923102968 1:230831728-230831750 CTGGTTTGCACTGTGGCTGGAGG + Intergenic
923410202 1:233700595-233700617 TGGGGTAGAAAGGAGGCTGGGGG - Intergenic
1062898741 10:1125709-1125731 CTGGGTTGGTTGTAGGCTGGGGG + Intronic
1064624306 10:17246647-17246669 ATTGGTTGGGAGGAGGCTGGGGG + Intergenic
1065886829 10:30085713-30085735 CTCAGTTGCAAAGTGGCTGGAGG - Intronic
1066023028 10:31320471-31320493 CTCGGGTGGAAGGAGGGTGGGGG + Intronic
1067309748 10:45101754-45101776 CTGTGTTGAAAATAGGCTGGAGG - Intergenic
1067495465 10:46756955-46756977 CTGGGCGGCAAGGGGGCAGGGGG + Intergenic
1067599188 10:47583433-47583455 CTGGGCGGCAAGGGGGCAGGGGG - Intergenic
1067740114 10:48889103-48889125 CTGGCCTGGAAGGTGGCTGGAGG + Intronic
1067822031 10:49539005-49539027 CTGGGTTCCAAGGCGGCTGGCGG - Exonic
1067830175 10:49607224-49607246 CGGGGTTGCAAGGAGGCGTCAGG - Intergenic
1067948849 10:50710018-50710040 CTGGGCGGCAAGGGGGCAGGGGG - Intergenic
1068599126 10:58937165-58937187 TTGGGTAGCAGGAAGGCTGGGGG - Intergenic
1068763112 10:60733901-60733923 CGGGGTGGAAGGGAGGCTGGGGG - Intergenic
1068770093 10:60811067-60811089 CTCGGTTACAAGGATGCAGGAGG + Intergenic
1068799877 10:61128184-61128206 GTGTTTTGCAAGGAGGCTGTGGG + Intergenic
1069047550 10:63759271-63759293 CTGGGGTGAAATGAGCCTGGAGG + Intergenic
1069707045 10:70465444-70465466 CTGGGTTCCAGGGAGGGAGGAGG + Intergenic
1069903770 10:71720457-71720479 CTGGGGAGAAAGAAGGCTGGGGG - Intronic
1069904354 10:71723777-71723799 CAGGTTCGCAGGGAGGCTGGGGG - Intronic
1070884167 10:79875010-79875032 CTGGGCGGCAAGGGGGCAGGGGG - Intergenic
1071216208 10:83405069-83405091 CTGGGGGGCAAGGAGGATGTGGG - Intergenic
1071650721 10:87391310-87391332 CTGGGCGGCAAGGGGGCAGGGGG - Intergenic
1073435120 10:103511437-103511459 CTGGGGTGCAAGGAGGGAAGAGG + Intronic
1073688382 10:105781116-105781138 CTAGGCGGCAACGAGGCTGGGGG - Intergenic
1074485340 10:113871719-113871741 CTGGGTTTGGAGGAGGATGGTGG + Intronic
1074923731 10:118046547-118046569 CTCGGCCGCAAGGAGGCAGGCGG - Exonic
1075633428 10:124015091-124015113 CTGCTTGGCAAGGGGGCTGGGGG - Intronic
1075941579 10:126394726-126394748 CTGGGGTGGATGGAGGCTGGGGG + Intergenic
1076438397 10:130462317-130462339 CTGGGATGCCAGGAAGTTGGAGG + Intergenic
1076521430 10:131083795-131083817 CTCGGTTCCAATGAGGCAGGAGG + Intergenic
1076741306 10:132487091-132487113 CTGGGCTGCAGGAAGGTTGGGGG - Intergenic
1076802030 10:132835274-132835296 CTGGGTGGCTTGGAGCCTGGAGG + Intronic
1077375996 11:2205371-2205393 CTGGGAGGTAGGGAGGCTGGAGG - Intergenic
1077499415 11:2902483-2902505 CCGGGATGCAGGGAGGCTGGGGG - Exonic
1078107283 11:8366281-8366303 CTGGGCTGCAAAGAGGATGAAGG - Intergenic
1078714746 11:13829123-13829145 CTGGGATGCACTGAGGATGGTGG - Intergenic
1079428409 11:20364688-20364710 CTGGGTTGTAATGGGGGTGGGGG + Intronic
1080896678 11:36453965-36453987 CAGAGTTGCAAGGAAGCTGATGG + Intronic
1081746231 11:45474276-45474298 CTGGGTAGGCAGGAGGCTGGTGG - Intergenic
1083163999 11:60872470-60872492 CTGGGGTGCTAGGAGGGTGTTGG + Intronic
1083173662 11:60936686-60936708 CTGGCCCGAAAGGAGGCTGGGGG + Exonic
1085445137 11:76596466-76596488 TTGGGGTGCAGGGAGGGTGGAGG - Intergenic
1085643821 11:78209839-78209861 CTGGACTCCAAGGAAGCTGGTGG + Exonic
1086078644 11:82880252-82880274 CAAGGTGGCAAAGAGGCTGGGGG - Intronic
1086265523 11:84993348-84993370 CTGGGGTTCAATCAGGCTGGTGG + Intronic
1087119065 11:94553974-94553996 CTGGTTTACCAGGAGGCTTGTGG + Intronic
1087672949 11:101128319-101128341 CTGGGTGGCGCGGCGGCTGGAGG - Exonic
1089112091 11:116065141-116065163 CTGGGTTTGGAGGAAGCTGGAGG - Intergenic
1089195794 11:116693367-116693389 CTGTCCTGCCAGGAGGCTGGGGG + Intergenic
1089531204 11:119130976-119130998 TTGGGGTGGAAGGAAGCTGGGGG + Intronic
1089777780 11:120850674-120850696 GTGGCTAGCAGGGAGGCTGGTGG + Intronic
1089863041 11:121607106-121607128 ATATCTTGCAAGGAGGCTGGAGG - Intronic
1089885959 11:121824128-121824150 CAAGGTGGCAACGAGGCTGGGGG + Intergenic
1090603456 11:128396251-128396273 CAGGGTGGCAATGAGGCTGGGGG - Intergenic
1091182125 11:133614989-133615011 ATGGGTTGTAATGAGGATGGTGG - Intergenic
1091288836 11:134425390-134425412 CTGGATTGCCAGGAGGCTGGGGG - Intergenic
1091556051 12:1574350-1574372 CTGGGGTGAGAGGAGGCTGGTGG + Intronic
1091556079 12:1574431-1574453 CTGGGGTGAGGGGAGGCTGGTGG + Intronic
1091591525 12:1845645-1845667 CTGGGTTGCGAAGCGGCAGGTGG + Intronic
1091618416 12:2067256-2067278 CTGGGATGGAGGCAGGCTGGGGG - Intronic
1091853971 12:3724059-3724081 CTGGATTGGAAGGAGACAGGAGG - Intronic
1094500689 12:31018356-31018378 CTGGGAATCAAGGAGGTTGGAGG - Intergenic
1095465347 12:42483465-42483487 CTGCGTCTGAAGGAGGCTGGCGG + Intronic
1096511294 12:52130933-52130955 CTTGTTTGCAGAGAGGCTGGAGG - Intergenic
1098008586 12:66025569-66025591 CTGGTTAGCAAGCTGGCTGGTGG - Intergenic
1098015535 12:66100441-66100463 CTAGGTGGCAGTGAGGCTGGGGG - Intergenic
1098454049 12:70652430-70652452 CTGTGAAGGAAGGAGGCTGGAGG + Intronic
1103034179 12:117642917-117642939 GTGGGTTACATGGAGCCTGGGGG - Intronic
1103347939 12:120263991-120264013 CTCAGCTGGAAGGAGGCTGGGGG - Intronic
1103995531 12:124827633-124827655 CAGGATAGCAAGGAGGCTGTGGG - Intronic
1104034293 12:125087690-125087712 CTTGTTTGCAAAGAGGCAGGAGG + Intronic
1104972785 12:132539487-132539509 CTGGGTGGGCATGAGGCTGGAGG - Intronic
1105283502 13:18984153-18984175 CAAGGTGGCAATGAGGCTGGAGG + Intergenic
1105617777 13:22035657-22035679 CTGGGTGGGAAGGAAGCTGGTGG - Intergenic
1106358723 13:29010359-29010381 TTTGGTTCCAAGGAGGCTGGAGG - Intronic
1106370323 13:29126541-29126563 CTGGGCTGCATGGAGCCAGGAGG - Intronic
1110454363 13:75673505-75673527 CAGGGTTGCAAGGTAGCTGTTGG - Intronic
1112440662 13:99422437-99422459 CTGGGTTGCAGTGACGTTGGTGG - Intergenic
1115853835 14:37608870-37608892 CTGGGTAGCAAGAGGACTGGTGG + Intronic
1116515171 14:45796177-45796199 CAAGGCAGCAAGGAGGCTGGGGG + Intergenic
1116696741 14:48187496-48187518 CAAGGTGGCAACGAGGCTGGGGG + Intergenic
1118213569 14:63787913-63787935 CTGGGTGCCATGGATGCTGGTGG - Intergenic
1118360617 14:65053554-65053576 GGGGGTTGCATGCAGGCTGGGGG - Intronic
1118413486 14:65507334-65507356 CTGGGGTTCAATCAGGCTGGTGG - Intronic
1119265305 14:73260648-73260670 CTGGGATGCAGGGAGCGTGGGGG + Intronic
1119926895 14:78503275-78503297 CTTGGTTGCTAAGAGGATGGTGG + Intronic
1120585965 14:86312639-86312661 CAAGGCGGCAAGGAGGCTGGGGG + Intergenic
1120955123 14:90075330-90075352 CTGGGAGGCATGGAGGCTGGAGG - Intronic
1121678491 14:95773550-95773572 TTGGGATGGAAGGTGGCTGGTGG - Intergenic
1122770854 14:104097062-104097084 ATGGGCTGGAAGGAGGGTGGTGG - Intronic
1122791098 14:104184517-104184539 GTTGGTGGCAGGGAGGCTGGTGG + Intergenic
1122826171 14:104371754-104371776 CTGAGTGCCAAGGGGGCTGGGGG + Intergenic
1122940586 14:104979251-104979273 CAGGGCAGCAAGGAGGCTGAGGG + Intergenic
1124047560 15:26164141-26164163 GTGGGTGGCAAGGAAGGTGGTGG + Intergenic
1125604867 15:40934476-40934498 ATGGACTGCAAGGAGCCTGGAGG + Intronic
1126048237 15:44663954-44663976 CTGGGTTCCAAGGGAGCTGGAGG - Intergenic
1126122133 15:45262938-45262960 CTGGGTGGCAAGGTCTCTGGAGG + Intronic
1126830044 15:52592744-52592766 CTGGGTTGCATGTGGGCTGTAGG + Intronic
1127355363 15:58193777-58193799 CAAGGCTGCAGGGAGGCTGGGGG + Intronic
1127717307 15:61661718-61661740 CAGGTTTGGAAGGATGCTGGAGG - Intergenic
1130135255 15:81176840-81176862 CTGGGCTGCCAGGATGTTGGGGG - Intronic
1130391137 15:83456400-83456422 CAAGGTGGCAACGAGGCTGGGGG - Intronic
1132685640 16:1160934-1160956 CAGGGCTGCACCGAGGCTGGGGG - Intronic
1132750635 16:1455863-1455885 CTGGGTTCCCTGGAGCCTGGGGG - Intronic
1132986296 16:2769301-2769323 CTGAGTTGAAAGGTGGGTGGGGG + Intronic
1133695464 16:8258603-8258625 CTGGGATGCAGGGCGGTTGGGGG - Intergenic
1133887646 16:9845576-9845598 ATGAGTTACAAGGAGGATGGAGG - Intronic
1133973774 16:10585482-10585504 CAGAGTGGCAAGGAGGATGGAGG + Intergenic
1134556694 16:15171867-15171889 CTGGAGTGCAGGGAGCCTGGTGG - Intergenic
1134824624 16:17274640-17274662 CTGGGGTCCAAGGAGAATGGAGG + Intronic
1134905004 16:17972476-17972498 CAGGGAGCCAAGGAGGCTGGAGG + Intergenic
1134917275 16:18083580-18083602 CTGGAGTGCAGGGAGCCTGGTGG - Intergenic
1136136379 16:28259097-28259119 CTGGATTCCGAGGTGGCTGGTGG - Intergenic
1136280805 16:29210136-29210158 CTGGGGTGGCAGGAGGCAGGTGG - Intergenic
1136545138 16:30950251-30950273 CTGGCTTGCAAGCGGGGTGGAGG - Intronic
1136585356 16:31180783-31180805 CTGGGTTGCCACGCGGCTGGGGG + Intronic
1136656211 16:31710851-31710873 CTGGGGTCCCAGGAGGATGGTGG - Intergenic
1137606146 16:49788043-49788065 CTGGGCAGATAGGAGGCTGGGGG - Intronic
1137625192 16:49903311-49903333 CTGGGTAGGAAGGGGGTTGGTGG + Intergenic
1138539276 16:57678793-57678815 TTCGGTAGAAAGGAGGCTGGTGG - Intronic
1138551894 16:57752971-57752993 CTGGGCTGGAGGGAGGCGGGTGG - Intronic
1141400853 16:83745556-83745578 CTGGGTCGCCATGAGGCTTGTGG + Intronic
1142030269 16:87835088-87835110 CAGGGCTGCAAGGAGCCTGCAGG + Intronic
1142108728 16:88319759-88319781 CTGGGCTGCAGGGAGGCCTGGGG - Intergenic
1142246687 16:88973471-88973493 ATGGGCTGCAAGCTGGCTGGGGG - Intronic
1142469569 17:155862-155884 GGGGGTAGCCAGGAGGCTGGGGG - Intronic
1142501538 17:335871-335893 CTGGGTTGAAAAGGGGCTGGAGG + Intronic
1142851068 17:2704989-2705011 CTGGGCTGCAGGGGGGCTGCAGG + Intronic
1142982148 17:3678553-3678575 CAGTGGGGCAAGGAGGCTGGAGG - Intronic
1142995249 17:3756190-3756212 CTGGGACGCAAGGAGGCCTGGGG + Intronic
1143335502 17:6169003-6169025 CTGGGCTGCAAGTTGGTTGGAGG + Intergenic
1143462506 17:7112834-7112856 CCGGGTTCCATGGAGGCAGGAGG - Intronic
1143868891 17:9943764-9943786 GTGGGTTGAAGGGAGGCCGGAGG + Intronic
1144424562 17:15129779-15129801 CTGAGTGCCAGGGAGGCTGGTGG - Intergenic
1144819099 17:18058990-18059012 CTGGCTTGCTGGGAGTCTGGAGG - Intronic
1144933998 17:18883117-18883139 CTAGGGTGGAAGGAGGCAGGGGG - Intronic
1144955667 17:19017705-19017727 CAGGGTTTCCAGGAGGCTGTGGG - Intronic
1145013407 17:19382282-19382304 CTGGGCAGCCAGGAGGCTGGTGG - Exonic
1145979321 17:29002537-29002559 CGGGCTTCCAAGGAGGCTGGAGG - Intronic
1147193184 17:38748725-38748747 CTGGGCTGAAAGGTGGCTCGTGG + Intronic
1148114917 17:45169871-45169893 CTGGGTCTCAAGGAGGCAGGTGG + Exonic
1148152114 17:45403080-45403102 CTGGAGGGCAGGGAGGCTGGGGG - Intronic
1148162550 17:45459093-45459115 CTAGGCTGCAACCAGGCTGGAGG - Intronic
1148461975 17:47844121-47844143 TTGGGCTCCAAGGGGGCTGGGGG - Intergenic
1148795545 17:50195014-50195036 CTGGGCTGCAAGAAGGATGGCGG + Intronic
1150393778 17:64805757-64805779 CTAGGCTGCAACCAGGCTGGAGG - Intergenic
1150394737 17:64812418-64812440 CAGAGCTGCAAGGAGGCCGGTGG + Intergenic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1151479553 17:74362086-74362108 CTGGGTGGTAAGGAGATTGGGGG - Intergenic
1151826832 17:76528475-76528497 CTGGGTGCCAAGGAAGCTGGAGG - Exonic
1151876423 17:76870005-76870027 CTGGGCAGCGAGGAAGCTGGGGG + Intronic
1152120747 17:78416877-78416899 CTGGGTTGTGGGGAGGCTAGAGG - Intronic
1152293087 17:79451912-79451934 CTGGGTGGCAGGGATGCTGTGGG - Intronic
1152856399 17:82667204-82667226 CTGGGATGCAGGGGGGCTTGTGG - Intronic
1153289874 18:3490350-3490372 TTGGGTTTCAATGAGGCTTGGGG - Intergenic
1155373911 18:25135413-25135435 TTGGGTTGGAAGGATGATGGGGG + Intronic
1156494731 18:37518202-37518224 CTGGCTGGCAGGCAGGCTGGTGG + Intronic
1156527170 18:37778078-37778100 CTGGGGTGGGAGGAGGGTGGGGG + Intergenic
1156529948 18:37805794-37805816 CTGGGTTGCCAGGATCCTTGTGG + Intergenic
1158634497 18:59144774-59144796 AGGGGTTGCAAGGAGGGTAGAGG + Intronic
1159475413 18:68914575-68914597 TTGGATTGCATGGAGGCTGGAGG + Intronic
1160147447 18:76376772-76376794 CTAGGGTGCACGCAGGCTGGAGG + Intronic
1160798676 19:957133-957155 CTGGGGTACAAGGAGCCAGGAGG - Intronic
1160858575 19:1228126-1228148 CTGGGTGGCAGGGGGGCTGTGGG + Exonic
1160864829 19:1251982-1252004 CTGTGCTCCCAGGAGGCTGGGGG + Intronic
1161108273 19:2455311-2455333 CTGGGCTCCAAGGAGACTGGGGG - Intronic
1161285974 19:3468479-3468501 CTGGGTGGGCAGGAAGCTGGGGG - Intronic
1162391893 19:10394989-10395011 CTGAGCTGCCAGGTGGCTGGAGG - Intronic
1162789215 19:13054433-13054455 CTGGGTTCCTAGGGGGCTGGAGG + Intronic
1162948093 19:14055470-14055492 CTAGCATGCAGGGAGGCTGGAGG - Intronic
1163446785 19:17351676-17351698 CTGGGAGGCCAGGAGGCTGGAGG + Exonic
1163559868 19:18012754-18012776 CTGGGGTGCAAGGAGGGTTTTGG - Intronic
1163585382 19:18160987-18161009 TGGGGTTGGGAGGAGGCTGGGGG + Intronic
1163747970 19:19059267-19059289 CTGGATTCCACGGAAGCTGGGGG - Intronic
1163830735 19:19546046-19546068 CTGGGGTCAAAGGAGTCTGGAGG - Exonic
1163836568 19:19578507-19578529 CTGGCAGGCAGGGAGGCTGGAGG + Intronic
1164578645 19:29420837-29420859 GTGGGTGGAGAGGAGGCTGGGGG - Intergenic
1164866930 19:31612352-31612374 CTTGGTGGCAAAGAGGCTGCAGG - Intergenic
1165370654 19:35403730-35403752 CTGAGGTGGGAGGAGGCTGGAGG - Intergenic
1165419326 19:35715329-35715351 CTGGTTTGCAGGGAGCCTGCTGG - Exonic
1165827724 19:38714754-38714776 CTGGCTGGCAAGGTGGCTGCCGG - Intronic
1165863427 19:38921492-38921514 CTGGGTGGCAGGGAGGCCAGGGG - Intronic
1166481273 19:43176244-43176266 CTGGCTTTCAAGGACTCTGGTGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167311596 19:48740441-48740463 CTGGGATGGAAGATGGCTGGGGG + Intronic
1168273438 19:55262737-55262759 CTGGGTGCCAAGAATGCTGGAGG - Intronic
1168286694 19:55338769-55338791 CTGGGCTGTAAGGTGGCCGGCGG - Intergenic
925017615 2:543722-543744 GTGGGAGGCAGGGAGGCTGGAGG + Intergenic
925017686 2:543921-543943 ATGGGAGGCAGGGAGGCTGGAGG + Intergenic
925294845 2:2769549-2769571 CAGGGTGGCAAGGAGGGTGACGG + Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
925410324 2:3636096-3636118 CTTGGTTCTAAGGAGGCAGGTGG + Intronic
925969643 2:9097234-9097256 CTGGGTGGCAGGGAGGCAGGGGG + Intergenic
926046146 2:9711088-9711110 CTGGCTTGCAAGGAGACAGGAGG - Intergenic
927201405 2:20580191-20580213 CTGGGTTTCAAACAAGCTGGAGG + Intronic
927484158 2:23477528-23477550 CTGGGCTGCTGGGAGGCTGAAGG - Intronic
927490739 2:23519333-23519355 CTGGGTGGGAGGGAGCCTGGGGG - Intronic
928610890 2:32991751-32991773 CTGGGTTGCAACAGGGCTGGAGG - Intronic
929873324 2:45775885-45775907 CAGGGATGCAAGGAGGCCAGTGG - Intronic
931866991 2:66424527-66424549 CTGGGTTGCAAAGGGGTTCGGGG + Intergenic
932438256 2:71715899-71715921 CCGGATTGGAAGGAGGCTGAAGG + Intergenic
933880050 2:86660834-86660856 CAAGGTGGCAACGAGGCTGGGGG - Intronic
934080910 2:88467220-88467242 CTGGGTTCCTAGGAGCCCGGAGG - Intergenic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
935925026 2:108058715-108058737 CAGGGAGGCAAAGAGGCTGGAGG + Intergenic
935939474 2:108223173-108223195 CTGGGTAACAGGGAAGCTGGAGG - Intergenic
936163708 2:110102976-110102998 CAGTGTTGGAGGGAGGCTGGTGG + Intronic
937227768 2:120379450-120379472 CTAGTTTGTAAAGAGGCTGGTGG + Intergenic
937231670 2:120401503-120401525 CTGGGGAGGAGGGAGGCTGGTGG + Intergenic
937321729 2:120964985-120965007 CTGGTTTGCTTGGAGGATGGTGG + Intronic
938406973 2:131038231-131038253 CTGGGCTGCAAGGCTGCAGGAGG - Intronic
938407006 2:131038353-131038375 CTGGGCTGCAAGGCTGCAGGAGG - Intronic
938407027 2:131038444-131038466 CTGGGCTGCAAGGCTGCAGGAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
939084838 2:137707339-137707361 CTGGGTGGCAGGCAGGGTGGAGG + Intergenic
940414443 2:153403519-153403541 CAAGGTGGCAGGGAGGCTGGGGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941211255 2:162642809-162642831 GTGGATAGCCAGGAGGCTGGAGG + Intronic
942785955 2:179703021-179703043 CTGTGTTGAAAAGAGGCTGAAGG - Intronic
944493137 2:200278656-200278678 CTGAGGCTCAAGGAGGCTGGTGG - Intergenic
945337158 2:208605953-208605975 CTGGGCTGCACGCAGGCAGGAGG - Intronic
946042350 2:216793046-216793068 CAGGGTTCCAAGGAGGCAAGGGG + Intergenic
946154738 2:217800044-217800066 CTGGGAGGCAGGGAGGGTGGTGG + Exonic
946195655 2:218032011-218032033 CTGGGTGCCAAGGGGCCTGGCGG - Intergenic
946420322 2:219561142-219561164 CTGGGGTGCAAGGAGCAGGGGGG + Intronic
946865828 2:224039902-224039924 CTGGGTTCCCAGGACGCTGCGGG - Intergenic
947445269 2:230158127-230158149 CTGGGTTCCAGGGAGGCCAGTGG + Intergenic
947605103 2:231481037-231481059 CTGGGTTCCAAGTGGGCAGGGGG + Intronic
948022079 2:234742312-234742334 CTGTGGTGCAGGGAGGCAGGAGG + Intergenic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
1170157767 20:13284319-13284341 CTGGGTTTCAAGGATGCCGCTGG - Intronic
1170748235 20:19120076-19120098 CTGAGGAGCAAGGAAGCTGGGGG + Intergenic
1170957161 20:20991789-20991811 CAGGGCTGCAAGGAGTCTTGTGG - Intergenic
1171298770 20:24041376-24041398 GGGGGTAGCCAGGAGGCTGGAGG - Intergenic
1171320823 20:24242593-24242615 CTGGGTTGGAAGGGGTGTGGAGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172493984 20:35364928-35364950 GAGGGTTGCAAGAAGGCTAGGGG - Intronic
1172856154 20:38004294-38004316 CAGGGTTGGCATGAGGCTGGGGG - Intronic
1173998435 20:47357396-47357418 CTGCCTTGCAAGGAGGCATGGGG - Intergenic
1174134350 20:48368754-48368776 CTGGTTTGCCAGGATGCAGGAGG - Intergenic
1174138879 20:48398968-48398990 CTTGGTTTCTGGGAGGCTGGAGG - Intergenic
1174400066 20:50271154-50271176 CTGGGTTCCACTGAGCCTGGTGG - Intergenic
1174439739 20:50540975-50540997 CTAGTTTGCAAGGAGGCTGTGGG + Intronic
1174502002 20:50992041-50992063 CTGGTTTGCAATGAGCCTGAGGG - Intergenic
1175219243 20:57407565-57407587 CTGGGCTGCACGATGGCTGGTGG - Exonic
1175423887 20:58852501-58852523 CGGGGCTGCCTGGAGGCTGGGGG + Intronic
1175440337 20:58986226-58986248 CTGTATTGGGAGGAGGCTGGGGG + Intronic
1176139688 20:63539544-63539566 CTGGGCTCCCAGGAGGGTGGGGG + Intergenic
1176258409 20:64166066-64166088 CGGGGTGGCAGGGAGGCTGGGGG - Intronic
1176264016 20:64199228-64199250 CTGGGAAGGAAGGGGGCTGGCGG - Intronic
1178589204 21:33895075-33895097 CTGGGTGGGAAGGAAGCTCGCGG + Exonic
1178691442 21:34753572-34753594 CTTCTTTGCAAGGAGGCTGGTGG + Intergenic
1179409822 21:41153976-41153998 CAGAGTCGCAATGAGGCTGGAGG + Intergenic
1179958066 21:44752087-44752109 CTGGGAGGCTGGGAGGCTGGAGG - Intergenic
1179983171 21:44906979-44907001 CTGGGTTTCAGCGAGGCTTGTGG + Exonic
1180676212 22:17588166-17588188 CTGGGTTGCAATCTGGCTGCTGG + Intronic
1181049453 22:20231665-20231687 CGGGCTTACAAGGAGGCTGGGGG - Intergenic
1181399126 22:22640606-22640628 TAAGGTTGCAGGGAGGCTGGGGG - Intergenic
1181516165 22:23414942-23414964 CTGGGTTGCACCGTGCCTGGCGG + Intergenic
1182994598 22:34800912-34800934 CTGGGAAGCAGGCAGGCTGGTGG - Intergenic
1183195491 22:36351031-36351053 TTGGATCCCAAGGAGGCTGGGGG + Intronic
1184734081 22:46387968-46387990 CTGGGGTGCACAGAGGCTGAGGG - Intronic
1184920168 22:47600515-47600537 CAGGGATGCACAGAGGCTGGGGG - Intergenic
1184930246 22:47675496-47675518 ATGGGATGCCAGGAGCCTGGAGG + Intergenic
1185082148 22:48715448-48715470 CAGGGAGGCGAGGAGGCTGGGGG + Intronic
1185302184 22:50087658-50087680 CTGGGTGGAGAGCAGGCTGGGGG + Intergenic
1185365625 22:50435387-50435409 CTGAGCTGCAAGGAGCCCGGTGG - Intronic
1185407586 22:50663251-50663273 CTGGGTGGAAAGGAGACTGGAGG + Intergenic
1185418716 22:50723304-50723326 GTGGGCTGCATGGATGCTGGCGG + Intergenic
949190787 3:1245993-1246015 CTGGGTTGCATGCAGCCTGAGGG + Intronic
949325517 3:2859051-2859073 CTGGGGAGCAGGGAGGTTGGAGG - Intronic
950100367 3:10352891-10352913 CTTGGTTTCAAAGACGCTGGAGG + Intronic
950449531 3:13057888-13057910 CTGAGCTGCAGGGAGCCTGGGGG - Intronic
950521110 3:13498604-13498626 CTGGCCTGAAAGGGGGCTGGGGG + Intronic
951477148 3:23118960-23118982 CTGGCTGGCAATGAGGCAGGAGG + Intergenic
951579559 3:24147920-24147942 CTGGGTTGCAAGGGAGGTGGGGG - Intronic
952709490 3:36415379-36415401 CAAGGTGGCAACGAGGCTGGGGG - Intronic
952969691 3:38643179-38643201 GTGGGGTACAAGGAGGCTGAGGG - Intronic
953894794 3:46788703-46788725 CAAGGTGGCAACGAGGCTGGGGG - Intronic
954274930 3:49535917-49535939 CTGGCTGGGAAGGAGGATGGTGG + Intergenic
954402348 3:50325598-50325620 CTGTGTTGGACAGAGGCTGGGGG - Exonic
955319266 3:57962508-57962530 CTGGGAGGCAGGTAGGCTGGTGG + Intergenic
955984015 3:64554667-64554689 ATGAAATGCAAGGAGGCTGGTGG - Intronic
958098171 3:88974058-88974080 CTGGGAAGCATGGAGCCTGGGGG - Intergenic
958165535 3:89874638-89874660 CAAGGTGGCAACGAGGCTGGGGG - Intergenic
958190236 3:90175163-90175185 CAAGGTGGCAACGAGGCTGGGGG - Intergenic
958900452 3:99879993-99880015 CTGCTTTGCAAGAAGGCTGTGGG - Intronic
959856316 3:111162772-111162794 ATGGCTTTCAAGGAGGCTGTTGG - Intronic
960483699 3:118225411-118225433 CTGGTTTGCTTGGAGGCTGATGG + Intergenic
960614815 3:119586757-119586779 ATGGGTAGAAAGGGGGCTGGGGG - Intronic
961633402 3:128317913-128317935 CAGTGTGGCAAGGAGGGTGGGGG - Intronic
962139223 3:132771159-132771181 CTGGGGTCCAAGGAGGAGGGAGG + Intergenic
962923242 3:139969751-139969773 CTCATTTGAAAGGAGGCTGGAGG - Intronic
962924339 3:139977674-139977696 CTGTGTGGCCTGGAGGCTGGTGG + Intronic
963109051 3:141670324-141670346 CAAGGTGGCAATGAGGCTGGGGG + Intergenic
965079808 3:164021346-164021368 TGGGGTGGCAAGGAGGATGGGGG + Intergenic
966881616 3:184354068-184354090 CTGGGTGCCAAGGGGGCTGTGGG - Intronic
968520369 4:1032301-1032323 CTGGGGCCCAAGCAGGCTGGTGG - Intergenic
968672602 4:1859800-1859822 GTGGGGTGAGAGGAGGCTGGAGG - Intergenic
968936575 4:3614243-3614265 CTGGGCTGCAGGGAGGTGGGAGG - Intergenic
969059956 4:4426565-4426587 CTGGGTGGGAAGGAGGCTGCTGG - Intronic
969344280 4:6561456-6561478 CTGGGTCGGAAGGAGGTGGGGGG + Intronic
969509758 4:7611063-7611085 CTGGGCTGCATGGTGGCTGCAGG - Intronic
969683881 4:8658175-8658197 TAGGGTTGCCAGGAGGCTTGAGG - Intergenic
974443204 4:61945527-61945549 CAAGGTGGCAACGAGGCTGGGGG - Intronic
974503186 4:62732535-62732557 CAAGGTGGCAACGAGGCTGGGGG - Intergenic
975657921 4:76660109-76660131 CTGGGGTGCACAGAGGCGGGTGG - Intronic
976847951 4:89511649-89511671 TTGGGGTTCAAGCAGGCTGGTGG + Intergenic
976897352 4:90128014-90128036 CGGGGTGGGAAGGAGGCGGGCGG + Intronic
977037966 4:91978625-91978647 CAAGGTGGCAACGAGGCTGGGGG + Intergenic
978756603 4:112309459-112309481 CAGGGTGGCAGCGAGGCTGGGGG - Intronic
980068202 4:128214203-128214225 CAAGGTGGCAACGAGGCTGGTGG + Intronic
980318505 4:131237615-131237637 CTGGGTTGCAAAGTGACTGCAGG + Intergenic
982200336 4:152954114-152954136 GTGGGTGGGAAGGAGGGTGGAGG + Intronic
983998060 4:174210005-174210027 CTTGGTTGAAAGGAGACTGATGG - Intergenic
984364774 4:178784653-178784675 CTGTCTTGCAAATAGGCTGGAGG + Intergenic
984584652 4:181549472-181549494 CTGTGTTGGAGAGAGGCTGGTGG - Intergenic
985262462 4:188127799-188127821 CTGGGTTCCCAGGCAGCTGGAGG - Intergenic
985430116 4:189871104-189871126 CTGGGTGGCTTTGAGGCTGGTGG + Intergenic
985440350 4:189979372-189979394 CTGGGGTGCAGGGGGGCTGCCGG + Intergenic
985969597 5:3364566-3364588 CTCTGATGCCAGGAGGCTGGGGG + Intergenic
989208578 5:38835933-38835955 CTGAGTTGCAGGGAAACTGGAGG - Intergenic
989608210 5:43266332-43266354 CAAGGTGGCAATGAGGCTGGTGG - Intronic
989828402 5:45886825-45886847 CAAGGTGGCAAGGAGGCTGGGGG - Intergenic
989946005 5:50230515-50230537 CAAGGTGGCAACGAGGCTGGGGG + Intergenic
989977298 5:50601844-50601866 CAAGGTGGCAGGGAGGCTGGGGG - Intergenic
990409237 5:55524342-55524364 CTGGGTTGCATGCAGCCTGTGGG + Intronic
990505569 5:56440904-56440926 CTCAGTTGTAAGGAGTCTGGGGG - Intergenic
991183102 5:63777484-63777506 CTGAATAGCAATGAGGCTGGTGG - Intergenic
991435239 5:66591312-66591334 CAGGGTTGCAAAGTGGCTTGTGG + Intergenic
992068674 5:73129952-73129974 CTGAGGTGCCAGGAGCCTGGGGG + Intronic
992417023 5:76561522-76561544 CTGGGTGGCAGGGAGGCTGGGGG + Intronic
994192627 5:96885146-96885168 CTGGGCTACTAGAAGGCTGGTGG - Intronic
994281085 5:97902860-97902882 CAAGGCTGCAATGAGGCTGGGGG - Intergenic
995468078 5:112471232-112471254 GTGGGTAGCCATGAGGCTGGAGG - Intergenic
996405378 5:123098524-123098546 CTGGGCTGGAAGGAGGCAGGCGG - Intronic
997177610 5:131796328-131796350 CTGAGTTGAGAGAAGGCTGGAGG - Intronic
997626184 5:135332134-135332156 CTGAGTTCGAGGGAGGCTGGGGG + Intronic
998140224 5:139695766-139695788 CAGGGTTCCAATGAGGGTGGGGG + Intergenic
998148065 5:139741543-139741565 CTGGGTGCCAAGGAGGGCGGTGG + Intergenic
998370201 5:141655869-141655891 CTGGGCTTTAAGGATGCTGGTGG + Exonic
998876975 5:146609893-146609915 CAAGGTGGCAACGAGGCTGGGGG + Intronic
999107532 5:149086933-149086955 CTGTGTTTCAAGACGGCTGGAGG - Intergenic
1000975187 5:167756831-167756853 CTTGGTTGGAAGAAAGCTGGGGG - Intronic
1001121173 5:168981381-168981403 CGGGATTGCAATGAGGCTTGGGG + Intronic
1001686252 5:173597050-173597072 CTGGGGGAAAAGGAGGCTGGAGG - Intergenic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1002048579 5:176556047-176556069 CTGGGTTGCAGGGAGAGAGGTGG - Intronic
1002350303 5:178578396-178578418 CTGGTCTGAAAGGAGGCTGCAGG + Intronic
1003977129 6:11354873-11354895 CTGGGTTGCTGGGAGGATGCGGG + Intronic
1005031719 6:21515032-21515054 CTGGATTCCTAAGAGGCTGGTGG - Intergenic
1005398318 6:25406356-25406378 CTGGGTTGAAGTGAGGCTGGAGG + Intronic
1006146048 6:31960323-31960345 CTGGGTTACAAAGAGGTAGGAGG + Exonic
1006912457 6:37572225-37572247 ATGGGGTGCAGAGAGGCTGGTGG + Intergenic
1009875102 6:69495776-69495798 CAAGGTGGCAACGAGGCTGGGGG + Intergenic
1011520344 6:88197502-88197524 TTGGGTCACAAGGATGCTGGTGG + Intergenic
1011524663 6:88251477-88251499 CTGGTTTTCATGGAAGCTGGTGG - Intergenic
1011533527 6:88351230-88351252 CAAGGTGGCAGGGAGGCTGGGGG + Intergenic
1013941266 6:115666182-115666204 CTGGGTAGAAAGGAGGCAGAGGG - Intergenic
1014185232 6:118427221-118427243 CAAGGTGGCAGGGAGGCTGGGGG + Intergenic
1015732865 6:136365953-136365975 CCGGGTGGCAAGGAGGATGTCGG + Exonic
1016792201 6:148077714-148077736 CTGGGATGCAGAGATGCTGGTGG + Intergenic
1017868765 6:158468428-158468450 CTGGGGTTCAATCAGGCTGGTGG - Intronic
1018143702 6:160863958-160863980 CTGAATTGCGCGGAGGCTGGAGG + Intergenic
1018420203 6:163634574-163634596 CTGAGTTTCAGGGAGGGTGGGGG + Intergenic
1018990106 6:168668161-168668183 CTGGGATGCGGGGATGCTGGTGG + Intronic
1019354316 7:570854-570876 TTGGGCTGCAGGGAGGGTGGTGG - Intronic
1019494461 7:1331303-1331325 CTGGGGGCAAAGGAGGCTGGCGG - Intergenic
1019634639 7:2069047-2069069 CTGGGTTGCCAGGAGGGTTCTGG - Intronic
1020683652 7:11267601-11267623 CTGGGATGCAAAGAAGCAGGGGG - Intergenic
1023238943 7:38121696-38121718 GTGGCATGCAAGGAGGCAGGAGG - Intergenic
1025799671 7:64774074-64774096 CTGGGTTACAAGGATGCTGCTGG + Intergenic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1026913694 7:74107238-74107260 CTGGGAAGGAAGGAGGATGGAGG - Intronic
1026988534 7:74569895-74569917 CAGGGTGGCAGGCAGGCTGGGGG + Intronic
1028497872 7:91482384-91482406 CAAGGTGGCAGGGAGGCTGGGGG - Intergenic
1030466106 7:109905842-109905864 CAGGGCGGCAGGGAGGCTGGGGG + Intergenic
1032211391 7:129917468-129917490 CTGGGGTGCAGGGAGGTTGGTGG + Intronic
1033591664 7:142813461-142813483 CTGGTTCCCAGGGAGGCTGGGGG - Intergenic
1033962215 7:146928861-146928883 CAAGGTGGCAGGGAGGCTGGGGG + Intronic
1034966032 7:155391598-155391620 CTGGGCAGCAAGGAGGCTCACGG - Intronic
1035136084 7:156704053-156704075 CTGGGTTACAAGGGGGCTGAGGG + Intronic
1035639496 8:1173599-1173621 CTAGGCGGCAGGGAGGCTGGGGG - Intergenic
1035930799 8:3777782-3777804 CTGCGCTTCAAGGAGGCTGTGGG - Intronic
1036384763 8:8269536-8269558 CTGGGGTACAAGGCGGGTGGAGG + Intergenic
1036642966 8:10595538-10595560 CTGGGGTGCAGGGAGGCACGGGG - Intergenic
1036693812 8:10961641-10961663 CAGTGTTGCCAGGAAGCTGGAGG - Intronic
1036766200 8:11550587-11550609 CTTGATTCCAAAGAGGCTGGTGG - Intronic
1038954600 8:32453806-32453828 ATGGGTTGCAAGGGGGCAGCTGG - Intronic
1039328169 8:36507872-36507894 CTGTGTTCTATGGAGGCTGGGGG + Intergenic
1041192499 8:55367904-55367926 CTGTGTGGCAAGTAGGCTGTGGG - Intronic
1042721393 8:71830507-71830529 CTGGGGTGAAAGGAAGCTGGTGG - Intronic
1042850743 8:73213644-73213666 CTGGGCTGCAGTGGGGCTGGAGG - Intergenic
1043070137 8:75626921-75626943 CAAGGTGGCAACGAGGCTGGGGG - Intergenic
1044143675 8:88686119-88686141 CAGGGCGGCAACGAGGCTGGGGG + Intergenic
1044402432 8:91788214-91788236 CAGGGTGGCAGCGAGGCTGGGGG + Intergenic
1044729815 8:95220759-95220781 CTGGGAGGCAGGGAGGCTTGCGG - Intergenic
1045489702 8:102658779-102658801 ATGGGATGCAATGTGGCTGGAGG + Intergenic
1045746659 8:105430757-105430779 CTGAGTTAGAAGGAGGCTGATGG + Intronic
1047125434 8:121954718-121954740 CAAGGTGGCAATGAGGCTGGGGG - Intergenic
1047683733 8:127282171-127282193 ATGGGCAGCAAGGAGGCAGGAGG + Intergenic
1048300083 8:133245008-133245030 CTGGGGTGAAACGGGGCTGGAGG + Intronic
1049093920 8:140536762-140536784 CTCTGTTGCCAGGAGGCAGGAGG - Intronic
1049567351 8:143348018-143348040 CTGGCTTGCAAGGCTGCTGTGGG - Intronic
1051314781 9:15817624-15817646 CGAGGTGGCAGGGAGGCTGGGGG + Intronic
1053412324 9:37923755-37923777 CTGAGCTGCAAGCAGCCTGGGGG + Intronic
1056537669 9:87545215-87545237 CTGGTTTGCAAGGAGAATTGGGG - Intronic
1057244531 9:93443793-93443815 CTGGGTGCCAGGGAGTCTGGGGG - Intergenic
1057267549 9:93629398-93629420 CAGGTTTGCAAGGGGTCTGGAGG + Intronic
1057855124 9:98595757-98595779 CTGGATAGACAGGAGGCTGGAGG + Intronic
1060053432 9:120392966-120392988 CCAGGTTGCAAGGAGCCTTGTGG - Intronic
1060736113 9:126067461-126067483 CTGGGTGGGAAGGAGGATTGTGG - Intergenic
1061232169 9:129321319-129321341 CTGGGAGGCAAGGAGGGAGGGGG + Intergenic
1061370376 9:130194330-130194352 CGGGGTGGAAAGGAGGCTGTGGG + Intronic
1061702046 9:132423345-132423367 CTGGGTTTCCAGGAGGCTCCTGG + Intronic
1062253610 9:135610623-135610645 CTGGGGTGGGAGGTGGCTGGTGG + Intergenic
1062295295 9:135822030-135822052 CTCAGATGCCAGGAGGCTGGCGG + Exonic
1062327520 9:136019318-136019340 CTGGGTTCCAGGGTGGCAGGAGG + Intronic
1062334265 9:136058148-136058170 CTGGCTGGCAAGGGGGCTGCTGG + Intronic
1062697818 9:137884425-137884447 CTGGGGTGGGAGGTGGCTGGTGG + Intronic
1185648664 X:1632857-1632879 CTGGGGGGCTGGGAGGCTGGGGG + Intronic
1189271618 X:39755890-39755912 CTGGGAGGCTGGGAGGCTGGAGG + Intergenic
1189609611 X:42718043-42718065 CTGGGGTGCAATGGGGCTTGGGG + Intergenic
1190752352 X:53373285-53373307 CTGGGGTGAAAGAAGGTTGGGGG - Intergenic
1191608541 X:63086905-63086927 TTGAGGTGCAAGGATGCTGGGGG - Intergenic
1191861818 X:65671740-65671762 CTGGGTAGGGAGGGGGCTGGTGG + Intronic
1192234866 X:69289371-69289393 CTGGGCTGCAGGGAGGGAGGGGG - Intergenic
1192724045 X:73729017-73729039 TTGGGTTGCAGGGGGGATGGGGG - Intergenic
1193952812 X:87821821-87821843 CAAGGTGGCAACGAGGCTGGGGG + Intergenic
1194516570 X:94862788-94862810 CAAGGTGGCAACGAGGCTGGGGG + Intergenic
1195886583 X:109645072-109645094 CAAGGTGGCAGGGAGGCTGGGGG + Intronic
1195983661 X:110606243-110606265 CAAGGTGGCAGGGAGGCTGGGGG + Intergenic
1197417329 X:126190815-126190837 CAGGGTGGCAGCGAGGCTGGGGG - Intergenic
1197817967 X:130517789-130517811 CAAGGCGGCAAGGAGGCTGGGGG + Intergenic
1198123774 X:133621581-133621603 CAAGGTGGCAATGAGGCTGGGGG + Intronic
1198592415 X:138198705-138198727 CAAGGCTGCAATGAGGCTGGGGG + Intergenic
1199234311 X:145472537-145472559 CTGGGATTCAAGTTGGCTGGCGG + Intergenic
1201310946 Y:12597792-12597814 AGGGGTAGCAAGGGGGCTGGAGG + Intergenic
1201908502 Y:19109063-19109085 CTGGGTTGGTGGGAGGGTGGAGG - Intergenic