ID: 903548468

View in Genome Browser
Species Human (GRCh38)
Location 1:24141676-24141698
Sequence AGGAGGAAAAGGAGCGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4246
Summary {0: 1, 1: 2, 2: 33, 3: 397, 4: 3813}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903548468_903548475 15 Left 903548468 1:24141676-24141698 CCCTCCTCGCTCCTTTTCCTCCT 0: 1
1: 2
2: 33
3: 397
4: 3813
Right 903548475 1:24141714-24141736 TTCCTCAGCCTGTGTTGCTTCGG 0: 1
1: 0
2: 3
3: 28
4: 223
903548468_903548478 25 Left 903548468 1:24141676-24141698 CCCTCCTCGCTCCTTTTCCTCCT 0: 1
1: 2
2: 33
3: 397
4: 3813
Right 903548478 1:24141724-24141746 TGTGTTGCTTCGGCACTTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 71
903548468_903548479 26 Left 903548468 1:24141676-24141698 CCCTCCTCGCTCCTTTTCCTCCT 0: 1
1: 2
2: 33
3: 397
4: 3813
Right 903548479 1:24141725-24141747 GTGTTGCTTCGGCACTTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903548468 Original CRISPR AGGAGGAAAAGGAGCGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr