ID: 903549661

View in Genome Browser
Species Human (GRCh38)
Location 1:24149181-24149203
Sequence GTGTGGGGATGGAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903549652_903549661 -3 Left 903549652 1:24149161-24149183 CCTAGACTGCTGGTGTGCAGGTG No data
Right 903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903549661 Original CRISPR GTGTGGGGATGGAGGGAGGT GGG Intergenic
No off target data available for this crispr