ID: 903552810

View in Genome Browser
Species Human (GRCh38)
Location 1:24169716-24169738
Sequence CCGTCCAGACAGGCAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903552805_903552810 9 Left 903552805 1:24169684-24169706 CCTCTGTTTGGCTGGACTGACTT 0: 1
1: 0
2: 0
3: 13
4: 121
Right 903552810 1:24169716-24169738 CCGTCCAGACAGGCAGCCACTGG 0: 1
1: 0
2: 1
3: 15
4: 160
903552804_903552810 10 Left 903552804 1:24169683-24169705 CCCTCTGTTTGGCTGGACTGACT 0: 1
1: 0
2: 0
3: 11
4: 139
Right 903552810 1:24169716-24169738 CCGTCCAGACAGGCAGCCACTGG 0: 1
1: 0
2: 1
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903552810 Original CRISPR CCGTCCAGACAGGCAGCCAC TGG Intronic
900296464 1:1954165-1954187 CCCCCCAGACAAGCAGCCCCGGG + Intronic
903552810 1:24169716-24169738 CCGTCCAGACAGGCAGCCACTGG + Intronic
905457327 1:38097262-38097284 CTGGCCAGAAAGGCATCCACAGG - Intergenic
906127456 1:43436001-43436023 TCCTCCAGACAGGCAGCCACAGG + Intronic
917535367 1:175870701-175870723 CAGACCAAACAGGCTGCCACTGG + Intergenic
920045450 1:203129443-203129465 CAGGCCTGACAGGCAGCCTCAGG - Intronic
922156875 1:223047498-223047520 GCTTCCAGACAGCCTGCCACGGG - Intergenic
922582504 1:226709333-226709355 CAGCCCAGACAGGCAGCCCAGGG - Intronic
923786520 1:237073434-237073456 CTGTCCAGTATGGCAGCCACTGG + Intronic
1063121475 10:3107835-3107857 CTCTCCAGACAGGCAGGCACTGG - Intronic
1063384406 10:5607039-5607061 CCTTCCTGAAAGGCAGGCACAGG + Intergenic
1072780348 10:98246958-98246980 CAGGCCAGGCAGCCAGCCACCGG - Intergenic
1072995169 10:100237108-100237130 CCTTACAGACAGGCTGACACAGG - Intronic
1074298863 10:112215285-112215307 CCGTGCAAACAGGCACCCAGAGG - Intronic
1075597035 10:123739617-123739639 CCGTGGAGAAAGGCAGCCCCAGG - Intronic
1076171764 10:128325846-128325868 CAGTACAGAAAGGGAGCCACAGG - Intergenic
1076530229 10:131140201-131140223 AGGTCCAGCCAGGCACCCACAGG - Intronic
1077176867 11:1195111-1195133 CCGACCAGCCAGCCTGCCACCGG + Intronic
1077465865 11:2733407-2733429 CCTTCCAGACAGGCTGGCCCAGG + Intronic
1077507849 11:2940411-2940433 GCTTCCAGCCAGGCAGGCACTGG + Intergenic
1078541000 11:12212985-12213007 CCTTCCCAACAGGCAGTCACAGG - Intronic
1084755962 11:71238854-71238876 CTGTCCAGACACACAGTCACAGG + Intronic
1085252060 11:75150587-75150609 CCACCCAGGCAGGCTGCCACTGG + Intronic
1088096353 11:106105407-106105429 CCCTCCAAACAGGCAGCCTTAGG - Intergenic
1090590381 11:128261091-128261113 CCATTCAGACAGGCAGGCGCAGG + Intergenic
1091602189 12:1924685-1924707 CTGCCCAGGCAGGCAGCCGCTGG + Intergenic
1091663805 12:2403999-2404021 CCGTCCAGCCAGGCAGGGCCTGG + Intronic
1094411566 12:30172613-30172635 CTCTCCAAACTGGCAGCCACTGG - Intergenic
1095841776 12:46701536-46701558 TCCTCCAGACAGCCAGCCTCTGG + Intergenic
1096522933 12:52194277-52194299 CCGGCCAGAAAGGAAGCAACAGG - Intergenic
1096560770 12:52434260-52434282 CCTTCCAGTCTGGCAGCCGCAGG - Exonic
1096596757 12:52700790-52700812 CAGTCGAGACAAGAAGCCACTGG + Intronic
1102221443 12:111197623-111197645 CACTCAAGACAGGCCGCCACTGG - Intronic
1103008354 12:117439294-117439316 CCCTCCAGTCACGCAGCCGCAGG - Intronic
1103278323 12:119732872-119732894 CTGTGCAGACAGGAAGTCACGGG + Intronic
1103428093 12:120856163-120856185 CTGTCCAGCAAGGTAGCCACTGG - Intronic
1103579305 12:121902574-121902596 GCCCCCAGACAAGCAGCCACAGG - Intronic
1103856219 12:123972823-123972845 CCGCCCAGCCCGGCAGACACAGG - Exonic
1104893435 12:132150960-132150982 CCCTGCAGACAGACAGACACAGG - Exonic
1104931814 12:132343635-132343657 CAGTGCTGACGGGCAGCCACTGG + Intergenic
1105422991 13:20269641-20269663 CCGCCCAGCATGGCAGCCACTGG - Intergenic
1105511528 13:21055914-21055936 CTGTCAAGCCAGGAAGCCACAGG + Intronic
1105540793 13:21314737-21314759 CCTTACAGAAAGACAGCCACGGG + Intergenic
1107064597 13:36199413-36199435 CCATCCATACAGGCATTCACTGG + Intronic
1113948094 13:114056130-114056152 CCTTCCTGCCAGGCAGGCACAGG - Intronic
1113994947 14:16057366-16057388 CCGGCCAGTCAGACAGCAACGGG - Intergenic
1114440498 14:22742763-22742785 CCCACCAAAGAGGCAGCCACAGG + Intergenic
1115448753 14:33521987-33522009 CCGTCCAGAAATGCAGCAAGAGG - Intronic
1120912481 14:89680088-89680110 CTGTCCATCCAGGTAGCCACTGG + Intergenic
1122917745 14:104866507-104866529 CCAGCCAGACAGGCAGGCACTGG - Intronic
1123123533 14:105929060-105929082 CCCTCCACACAGGCATCCTCAGG + Intronic
1202865614 14_GL000225v1_random:115110-115132 CTGCCCAGACAGCCAGCCAGCGG + Intergenic
1123406176 15:20020561-20020583 CCCTCCACACAGGCATCCTCAGG + Intergenic
1123515506 15:21027209-21027231 CCCTCCACACAGGCATCCTCAGG + Intergenic
1124142899 15:27093044-27093066 TCCTCTAGACAGGCAGCCATTGG + Intronic
1125502263 15:40247084-40247106 CCTTCCTGAAAGTCAGCCACTGG + Intronic
1129917931 15:79290877-79290899 GCGTGCAGACAGGAAGCAACAGG - Intergenic
1129952098 15:79600982-79601004 AGGTCCAGGAAGGCAGCCACAGG + Intergenic
1130375833 15:83327724-83327746 CCTTGCAGAGAGCCAGCCACTGG + Intergenic
1132851072 16:2025323-2025345 CAGGCCAGACAGGCAGCCTCTGG + Intergenic
1133065304 16:3202189-3202211 CCTTCCAGACTAGCAGCCACAGG - Intergenic
1133149437 16:3816552-3816574 CAGTTCAGACCCGCAGCCACAGG - Intronic
1133239346 16:4405202-4405224 CAGACCAGACAGGCGGCCAGAGG + Intronic
1136566357 16:31073110-31073132 CCCGCCAGCCAGGCAGCCCCTGG + Intronic
1138959883 16:62016411-62016433 CCGTCCTGACTTGCAGCCAAGGG + Intronic
1142005394 16:87687413-87687435 CCTCCCAGACAGGCAGCAAGAGG - Intronic
1142157321 16:88538497-88538519 CCGTCGGGACAGGCCGCCAACGG - Intergenic
1142261602 16:89045037-89045059 GGGTCCAGACAGGCGGCCTCAGG + Intergenic
1142697842 17:1643459-1643481 CCTGCCCGGCAGGCAGCCACGGG - Exonic
1143535977 17:7539910-7539932 CCTTCCACAGAGGAAGCCACTGG + Intergenic
1145812876 17:27775005-27775027 TGGTCCAGCAAGGCAGCCACTGG + Intronic
1147374286 17:40014915-40014937 TCTCCCAGACAGGCAGCCTCCGG + Intergenic
1148232756 17:45947190-45947212 CCCAGCACACAGGCAGCCACTGG - Intronic
1150128697 17:62654543-62654565 CCATCCACAGAGGCAGCCAGAGG - Intronic
1152459180 17:80432381-80432403 CCATCCAGACAGGACTCCACAGG - Intronic
1152906437 17:82973054-82973076 CTGTCCAGGCTGGCAGCCGCGGG - Intronic
1161284078 19:3459844-3459866 CCCTCCAACCAGGCAGCCACTGG - Intronic
1164758321 19:30707535-30707557 CCTTCCTGACAGCCAACCACAGG - Intronic
1167123484 19:47533030-47533052 GCGTCCACACAGGCAGGCAGAGG - Intronic
1167249127 19:48391417-48391439 CCGTTCAGACCAGCAGCCTCGGG - Exonic
1167661910 19:50800196-50800218 TTGTCCAGTCTGGCAGCCACTGG - Intronic
926145142 2:10392756-10392778 CAGTCCAGCCATGCAGCCCCTGG + Intronic
931632319 2:64312211-64312233 CAGTCCAGACAATCAGCCAAGGG - Intergenic
932445610 2:71779213-71779235 CCATCCAGCCAGGCAGGAACTGG - Intergenic
935695819 2:105769717-105769739 CAGTACAGCCAGGCGGCCACAGG + Intronic
939607887 2:144274696-144274718 AGGTACAGACAGGCAGCCAGAGG - Intronic
940133088 2:150406388-150406410 CGTTACAGACAGGCAGCCCCTGG + Intergenic
947532530 2:230921777-230921799 CCCTGCAGACAGACAGCCTCGGG - Intronic
947546097 2:231011484-231011506 CAGACCAGACAGGCAGCTGCAGG - Intronic
947972021 2:234332606-234332628 CTGTCCAGACAGACAGACACGGG - Intergenic
948729284 2:239952987-239953009 CTGTGGAGACTGGCAGCCACAGG - Intronic
948924654 2:241087590-241087612 TCGCCCAGATAGGCAGCCCCTGG + Exonic
948962804 2:241354668-241354690 CCCTCCAGACTGCCAGCCTCAGG + Intergenic
1170407864 20:16058551-16058573 CTGTCCAGACAGGCACACATAGG + Intergenic
1172354164 20:34268188-34268210 CCTTCGATACAGGTAGCCACTGG - Intronic
1174199376 20:48796507-48796529 CCCTCCCCAGAGGCAGCCACTGG - Intronic
1174381691 20:50159812-50159834 CAGTCCAGACAGGCAACATCTGG - Intergenic
1174987781 20:55474762-55474784 CTGTCCAGTGTGGCAGCCACAGG + Intergenic
1175065738 20:56286047-56286069 GCTTACAGACAGGCATCCACTGG - Intergenic
1175847833 20:62067903-62067925 CCGTCCAGCCTGGCAGCTGCAGG + Intergenic
1179986763 21:44926537-44926559 CCCTCCAGCCAAGCAGCCACAGG + Intronic
1179990780 21:44947281-44947303 CCAGGCAGACAGGCACCCACAGG - Intronic
1180312145 22:11250043-11250065 CCGGCCAGTCAGACAGCAACGGG + Intergenic
1181593595 22:23899079-23899101 GCATCCAGACAGGGAGACACTGG + Intergenic
1182276899 22:29195523-29195545 CCCTCCTGACAGGCAGCCCTTGG - Intergenic
1183318382 22:37149221-37149243 CTGTCCAGTCATGCAGCCAAGGG + Intronic
1183985895 22:41570251-41570273 CCCTCCAGTCAGGAAGGCACTGG - Intronic
1184129924 22:42511692-42511714 GCGGCCAGCCAGCCAGCCACAGG - Exonic
1184600838 22:45542459-45542481 CTGCCCAGCCAGGCGGCCACTGG + Intronic
1184782531 22:46656351-46656373 CCTTCCTGCCCGGCAGCCACAGG - Intronic
1185095820 22:48805520-48805542 CAGTCCAGACATGCAGCAAGAGG + Intronic
952925520 3:38316775-38316797 CCATCCAGACAGGCAGGCAGGGG - Intronic
955108744 3:55926727-55926749 TCCTCCAGCCAGGCAGCCCCTGG + Intronic
955461795 3:59190972-59190994 CTGTCCAGTAAGGTAGCCACTGG + Intergenic
960058841 3:113298067-113298089 GAGGCCAGGCAGGCAGCCACAGG - Intronic
960582736 3:119294658-119294680 CCGTGCAGACTGGCAGCCGCGGG - Exonic
961333429 3:126156222-126156244 CTGTCCAACAAGGCAGCCACTGG - Intronic
961825639 3:129597716-129597738 CCGCCCAGACAGGCATCCAGTGG - Intronic
964996655 3:162891175-162891197 CACTCCAGACTGGCTGCCACTGG - Intergenic
968662025 4:1802614-1802636 CCGCCCAGAGAGGCCGCCTCGGG + Intronic
969042332 4:4308916-4308938 CCCTGCAGACAAGCAGGCACTGG + Intronic
976468675 4:85401622-85401644 CTCTCCAGCAAGGCAGCCACTGG - Intergenic
979158021 4:117422562-117422584 ACTTCCAGTCAGGCAGCTACTGG - Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
985859543 5:2460026-2460048 CCCTCCACACAGGCATGCACAGG - Intergenic
986062725 5:4207151-4207173 CTGTCCAGAGAGGAACCCACAGG - Intergenic
986238346 5:5933658-5933680 CCTTGCAGACAAGCAGCAACTGG + Intergenic
986961477 5:13218461-13218483 CCCTCCAGAAAGGTGGCCACTGG - Intergenic
990005507 5:50939802-50939824 CCCAACAGACAGGCAGCCTCTGG + Intergenic
990735066 5:58851357-58851379 CCGTGCACACAGGCAGCTCCAGG + Exonic
996874480 5:128226083-128226105 CCATTCACAGAGGCAGCCACAGG + Intergenic
997614600 5:135237691-135237713 CCCTCCTGACAGCCAGGCACAGG - Intronic
997690974 5:135827310-135827332 CATTCCAGACAAGCAGCCATCGG - Intergenic
998848310 5:146331878-146331900 CCATCCAGCCAGGCAGGCAGGGG + Intronic
1003412102 6:5874618-5874640 CCTTACAGAAAGACAGCCACGGG - Intergenic
1004991517 6:21143866-21143888 CGATCCAGACAGGCTGTCACCGG - Intronic
1007729938 6:43939617-43939639 CAGGCCAGACTGGCAGCCTCTGG + Intergenic
1015460079 6:133480445-133480467 CCGTCCAGTGCTGCAGCCACTGG + Intronic
1016427599 6:143950915-143950937 CCGTCCAGGACAGCAGCCACTGG - Intronic
1018083353 6:160277714-160277736 TCCTCCAGACAGGCAGCTGCTGG + Intergenic
1019332889 7:469619-469641 CCGTCCAACATGGCAGCCACCGG - Intergenic
1019518314 7:1449220-1449242 CCGTCCAGCCCAGCAGCCGCCGG + Intronic
1019696718 7:2450429-2450451 CGTTCCAGGCAGGCAGGCACAGG + Intergenic
1020029221 7:4921047-4921069 CTGTCCAGGTTGGCAGCCACTGG - Intronic
1022590159 7:31653919-31653941 CTGTCCAGTCAGGCAGCCAGTGG + Intronic
1022724345 7:32967025-32967047 CCCTACAGACAGGAAGCCAGAGG - Intronic
1025049263 7:55720808-55720830 CCCTACAGACAGGAAGCCAGAGG + Intergenic
1026470980 7:70694146-70694168 CCGTCCAGCCAGGGAGCCCGCGG + Intronic
1029184900 7:98731497-98731519 CCGGCCAGACCAGCAGCCCCAGG + Intergenic
1032516756 7:132512149-132512171 CCTTCCAGACAGGCAGGTGCAGG + Intronic
1035153175 7:156892544-156892566 CCGCCCAGAGAGGAAGCCCCTGG + Intronic
1035223576 7:157421022-157421044 CCGTCCACAGAGGCAGCCTTGGG - Intergenic
1039951983 8:42179962-42179984 CCGTCCAGTCCGGCAGCTGCAGG + Exonic
1041462058 8:58121911-58121933 CCATCCAGAAGGGCAGCCAAAGG - Intronic
1042249773 8:66744312-66744334 GCTTCCAGAGAGGCAGCAACAGG - Intronic
1049606834 8:143533469-143533491 TGGTGGAGACAGGCAGCCACTGG - Intronic
1049771198 8:144382825-144382847 CTGTCCAGAGACGCAGCCAATGG - Intronic
1049780981 8:144428742-144428764 CCCGCCTGCCAGGCAGCCACGGG + Intergenic
1051067750 9:13125108-13125130 CCTTCCAAACAGTGAGCCACAGG + Intronic
1053413306 9:37929486-37929508 CACACCAGACAGGCGGCCACTGG - Intronic
1057200107 9:93135162-93135184 CTGTCCAGTCAGGCTGCCACCGG + Intergenic
1060927363 9:127464314-127464336 CTGTCCAGAGCGGCAGCCACTGG + Intronic
1060927372 9:127464370-127464392 CTGTCCAGAGCGGCGGCCACTGG + Intronic
1060927380 9:127464426-127464448 CTGTCCAGAGCGGCAGCCGCTGG + Intronic
1061355383 9:130100798-130100820 GGGCCCAGACAGGCTGCCACAGG - Intronic
1061444156 9:130628372-130628394 ACGTCCAGCCAGGGGGCCACTGG + Intronic
1062244911 9:135561341-135561363 CCGTGCAGTCAGTCACCCACTGG + Intergenic
1062249629 9:135587705-135587727 GGGTCCAGACTGGCAGCCAGTGG - Intergenic
1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG + Intergenic
1203738724 Un_GL000216v2:161048-161070 CTGCCCAGACAGCCAGCCAGCGG - Intergenic
1186482691 X:9908023-9908045 ACATCCAGACAGACTGCCACTGG - Intronic
1188237859 X:27751505-27751527 CAGTGTAGACAGGAAGCCACAGG - Intergenic
1194447624 X:94007578-94007600 CAGTCCAGACAGCCTGCAACTGG + Intergenic
1198228057 X:134664613-134664635 CTGTCCAGAAAGGGAGCCAGAGG + Intronic
1200055029 X:153455805-153455827 CCCACCAGCCAGGCTGCCACCGG + Intronic
1201751445 Y:17436366-17436388 CCATGCAGACAGGCAGGCACAGG + Intergenic