ID: 903564496

View in Genome Browser
Species Human (GRCh38)
Location 1:24254618-24254640
Sequence CCGCTCCTTACTTGGAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903564496_903564503 7 Left 903564496 1:24254618-24254640 CCAGACTTCCAAGTAAGGAGCGG No data
Right 903564503 1:24254648-24254670 CCACCATCTTGGTCTTGGATAGG No data
903564496_903564500 -4 Left 903564496 1:24254618-24254640 CCAGACTTCCAAGTAAGGAGCGG No data
Right 903564500 1:24254637-24254659 GCGGGTAATTTCCACCATCTTGG No data
903564496_903564501 2 Left 903564496 1:24254618-24254640 CCAGACTTCCAAGTAAGGAGCGG No data
Right 903564501 1:24254643-24254665 AATTTCCACCATCTTGGTCTTGG No data
903564496_903564505 20 Left 903564496 1:24254618-24254640 CCAGACTTCCAAGTAAGGAGCGG No data
Right 903564505 1:24254661-24254683 CTTGGATAGGCAATGCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903564496 Original CRISPR CCGCTCCTTACTTGGAAGTC TGG (reversed) Intergenic
No off target data available for this crispr