ID: 903567977

View in Genome Browser
Species Human (GRCh38)
Location 1:24283442-24283464
Sequence GCAATTTGTACAATTACCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903567977_903567986 24 Left 903567977 1:24283442-24283464 CCCGGGGTAATTGTACAAATTGC No data
Right 903567986 1:24283489-24283511 TGGTTACCCAATGCTTACTCAGG No data
903567977_903567980 -10 Left 903567977 1:24283442-24283464 CCCGGGGTAATTGTACAAATTGC No data
Right 903567980 1:24283455-24283477 TACAAATTGCCCATGCAGATGGG No data
903567977_903567987 28 Left 903567977 1:24283442-24283464 CCCGGGGTAATTGTACAAATTGC No data
Right 903567987 1:24283493-24283515 TACCCAATGCTTACTCAGGTAGG No data
903567977_903567983 4 Left 903567977 1:24283442-24283464 CCCGGGGTAATTGTACAAATTGC No data
Right 903567983 1:24283469-24283491 GCAGATGGGTGCCTCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903567977 Original CRISPR GCAATTTGTACAATTACCCC GGG (reversed) Intergenic
No off target data available for this crispr