ID: 903571297

View in Genome Browser
Species Human (GRCh38)
Location 1:24307588-24307610
Sequence CAGGAAAAGGAGAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903571293_903571297 -10 Left 903571293 1:24307575-24307597 CCACAGGGAGGCACAGGAAAAGG No data
Right 903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG No data
903571292_903571297 -7 Left 903571292 1:24307572-24307594 CCTCCACAGGGAGGCACAGGAAA No data
Right 903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG No data
903571291_903571297 -6 Left 903571291 1:24307571-24307593 CCCTCCACAGGGAGGCACAGGAA No data
Right 903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG No data
903571286_903571297 20 Left 903571286 1:24307545-24307567 CCTGGAGCTGTGAAGAAGAGGGA No data
Right 903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903571297 Original CRISPR CAGGAAAAGGAGAAGGAAGT GGG Intergenic
No off target data available for this crispr