ID: 903572227

View in Genome Browser
Species Human (GRCh38)
Location 1:24314419-24314441
Sequence CAAGCTTCCTAGTCCCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903572227_903572230 2 Left 903572227 1:24314419-24314441 CCAGACAGGGACTAGGAAGCTTG No data
Right 903572230 1:24314444-24314466 AGGACTATTTCCACAACTTTGGG No data
903572227_903572229 1 Left 903572227 1:24314419-24314441 CCAGACAGGGACTAGGAAGCTTG No data
Right 903572229 1:24314443-24314465 AAGGACTATTTCCACAACTTTGG No data
903572227_903572231 8 Left 903572227 1:24314419-24314441 CCAGACAGGGACTAGGAAGCTTG No data
Right 903572231 1:24314450-24314472 ATTTCCACAACTTTGGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903572227 Original CRISPR CAAGCTTCCTAGTCCCTGTC TGG (reversed) Intergenic
No off target data available for this crispr