ID: 903572650

View in Genome Browser
Species Human (GRCh38)
Location 1:24317934-24317956
Sequence CTGTGTTGGGGGAAGCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 1, 2: 7, 3: 58, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903572650 Original CRISPR CTGTGTTGGGGGAAGCCCAG GGG (reversed) Intergenic
901866824 1:12111892-12111914 CTGTGTTGGGGACAGACCTGGGG - Exonic
902180748 1:14686672-14686694 GGGTGTAGCGGGAAGCCCAGAGG + Intronic
902862734 1:19257726-19257748 CTGTGATGGGGGAAGGCCCAGGG + Intronic
902942982 1:19813887-19813909 CAGTGTTAGAGGAAGCGCAGTGG + Intergenic
903572650 1:24317934-24317956 CTGTGTTGGGGGAAGCCCAGGGG - Intergenic
903884226 1:26531624-26531646 CTGTGAGAGGGGAAGACCAGCGG + Intronic
904388717 1:30164853-30164875 CTGTGGCCTGGGAAGCCCAGAGG - Intergenic
904596409 1:31648835-31648857 CTGAGTTCGTGGAAGCCCTGCGG + Intergenic
904808993 1:33151231-33151253 CTGTGCTGCTTGAAGCCCAGGGG + Intronic
905918313 1:41700979-41701001 CTGTGTTGGAGGGAGGCCTGTGG + Exonic
906210697 1:44010939-44010961 CCCTGCTGGGGGAGGCCCAGAGG - Intronic
906707341 1:47904311-47904333 GTGTGGTGGAGGAAGCCCTGGGG + Intronic
907080857 1:51620449-51620471 CTGTGATAGAGGAAGCACAGGGG + Intronic
907526659 1:55057704-55057726 CTGTATTAGAGGGAGCCCAGAGG + Intronic
911102095 1:94103297-94103319 ATGTGTTGGGGGCAGCCCACTGG - Intronic
912024652 1:105153569-105153591 CTGTCATGGGAGAAACCCAGTGG - Intergenic
912578411 1:110697295-110697317 CTGTGTTTGACAAAGCCCAGTGG + Intergenic
913048092 1:115090082-115090104 CTGGGTTGAGGGCAGCCCACAGG - Intergenic
914337048 1:146724862-146724884 GTGTGAAAGGGGAAGCCCAGGGG + Intergenic
915709582 1:157882760-157882782 CTATGAAGGCGGAAGCCCAGGGG - Intronic
918045060 1:180936470-180936492 CTGTGATGGGGGCAGCTCACAGG - Exonic
919046458 1:192458783-192458805 TTGTCTTGGGGGACTCCCAGGGG - Intergenic
919369789 1:196708702-196708724 CTCTGTTAGGGCAAGCCCACTGG + Intronic
919785213 1:201254301-201254323 CTCTGCTGGGGGAAGCTCTGGGG + Intergenic
921597157 1:217066699-217066721 CTGTGTGGGGGGATGCCCTGTGG + Intronic
923665637 1:235996201-235996223 CTGTGCTGGGGGATGCACACAGG + Intronic
924775634 1:247113051-247113073 GTGTACTGGGGGAAGCCCCGGGG - Intergenic
1063255257 10:4320671-4320693 CTGTGTTGGAGGAAGATGAGAGG - Intergenic
1063454688 10:6174736-6174758 CTCTGCTGGGGGAAGCTCTGGGG + Intronic
1064124636 10:12649379-12649401 GTGTGCTGGGGGGAGCCCATGGG + Intronic
1067534604 10:47099720-47099742 ATGTGTGGAGGGAAGCCCAGGGG - Intergenic
1068388230 10:56359732-56359754 CTCAGATGGAGGAAGCCCAGAGG - Exonic
1068565361 10:58568757-58568779 CTGAGTTGAGGGAAGGCAAGGGG - Intronic
1069598300 10:69686915-69686937 CTGGGATGGGAGAAGCCCTGGGG + Intronic
1069756220 10:70775782-70775804 AAGGGATGGGGGAAGCCCAGAGG + Intronic
1070683145 10:78463030-78463052 CTGTCTTGGGGAAAGCCCAGTGG - Intergenic
1070780588 10:79135424-79135446 CTCTGTTGGGGGAGGCCAGGAGG + Intronic
1073102615 10:101014561-101014583 GTGTGCTGGGGGAAGCTAAGGGG - Intronic
1073315836 10:102580198-102580220 CTGTGTTGGGAGAAAGGCAGGGG + Intronic
1074494207 10:113964873-113964895 GTCTGTTGGGGGAAGGCAAGTGG + Intergenic
1075135512 10:119781993-119782015 TAGTGTTGGGGGAATCCCTGGGG + Intronic
1075477950 10:122752914-122752936 AGGAGTTGGGGGAAGCACAGTGG - Intergenic
1075786460 10:125053420-125053442 CTGTGTTGGGGGATGCCAGGAGG - Intronic
1075846423 10:125548697-125548719 CTCTGTTGGGAGCAGCACAGTGG - Intergenic
1075968619 10:126633741-126633763 GCGTGTTGGGGGAAGCAGAGAGG - Intronic
1076692285 10:132230010-132230032 TTGTGTTGGGGGCTGCCCAGAGG + Intronic
1077154024 11:1083573-1083595 CTTTGTTGGGGCAACCCCGGTGG - Intergenic
1077311903 11:1892575-1892597 TGGTGTTGGGGGAGGCCCCGAGG - Intergenic
1077477055 11:2795518-2795540 CTGGGTTGGGGGAAGCTCCGTGG - Intronic
1080174317 11:29343583-29343605 CTGTGATGGGGGAATCCAGGGGG - Intergenic
1080801235 11:35612166-35612188 ATGTTACGGGGGAAGCCCAGTGG - Intergenic
1081851541 11:46278064-46278086 CTGGAGTGAGGGAAGCCCAGTGG + Exonic
1083310748 11:61782444-61782466 ATGTGATGGGGGAACCCCATGGG + Intronic
1083592548 11:63904099-63904121 CTCCGTGGGGGGCAGCCCAGAGG - Exonic
1084225713 11:67713664-67713686 CTGAGTTGGGGGCCACCCAGTGG + Intergenic
1084263531 11:67993521-67993543 CTGAGTTGGGGGCCACCCAGTGG + Intronic
1084432142 11:69116985-69117007 CTGTGTTGGGGTTTGCCCCGTGG - Intergenic
1084473174 11:69374876-69374898 CTGGGGTGGGGGGACCCCAGGGG + Intergenic
1084702753 11:70798256-70798278 CTGGTTTGGATGAAGCCCAGAGG + Intronic
1084809873 11:71605600-71605622 CTGAGTTGGGGGCCACCCAGTGG - Intergenic
1085274140 11:75287433-75287455 CTGTCTTGGAGGAAACCCTGCGG + Intronic
1085642178 11:78199524-78199546 CTGGGGTGAGGGCAGCCCAGGGG - Intronic
1085828971 11:79879273-79879295 CTATGATGGGGGAAGCTTAGAGG + Intergenic
1086190104 11:84069093-84069115 CTCTGGAGGGGGAAGCTCAGTGG - Intronic
1086652356 11:89308249-89308271 GTGTGTGGGGTGAAGTCCAGGGG + Intergenic
1088090021 11:106026865-106026887 ATGTCTTGGGAGGAGCCCAGTGG + Intergenic
1089901060 11:121985387-121985409 CTTTGTTGGGACAATCCCAGAGG + Intergenic
1090411334 11:126511928-126511950 CCGCCCTGGGGGAAGCCCAGGGG - Intronic
1091679108 12:2513507-2513529 GAGTGTTGGGGGAAGCCCAGAGG + Intronic
1092696507 12:11177466-11177488 CTGGGTTGGGGGGAGGGCAGGGG + Intergenic
1094718844 12:33040950-33040972 GTGGGGTGGGGGAAGCCCAAAGG - Intergenic
1096269239 12:50151128-50151150 GTGAGTTTGGGGAAGGCCAGAGG - Intronic
1096743148 12:53709291-53709313 ATGGGCTGGGGGAAACCCAGGGG - Intronic
1097315890 12:58171276-58171298 CTGTGTTGGTGGAAGCCCCGTGG + Intergenic
1098082539 12:66804313-66804335 CCGTGTTGATGGTAGCCCAGAGG - Intergenic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1100934625 12:99648758-99648780 CTGTGTTGGAGGAAGTGCAGAGG + Exonic
1102677775 12:114669655-114669677 CTGTGTGGGGGGTTGCCGAGTGG + Intergenic
1103176311 12:118866417-118866439 CTATGATGGAGGAAGCTCAGAGG - Intergenic
1103404281 12:120664258-120664280 GTGTGCTGGGGGAAGCACAGGGG + Intronic
1105407257 13:20142721-20142743 CCGTGTTGGGGCAGGGCCAGCGG + Exonic
1106106076 13:26734529-26734551 CTGTGATGGGGGGAAGCCAGGGG + Intergenic
1106558518 13:30830026-30830048 TTGTGCTGGGAGCAGCCCAGGGG + Intergenic
1107807258 13:44165190-44165212 ATGTGTTGGGGGAAAACCATTGG - Intergenic
1108097915 13:46924023-46924045 CAGTGTTAGGGGAAGCCACGTGG - Intergenic
1109178959 13:59190092-59190114 CTGTTTTGGGGACAGCTCAGAGG + Intergenic
1113029202 13:105975394-105975416 CTGTCTGGGTGGAAGCCCTGGGG + Intergenic
1113074921 13:106458827-106458849 CAGAGATGGGGGAAGCCCATGGG - Intergenic
1113811589 13:113146052-113146074 CTGGGGTGGGGGAAGACCTGGGG - Intronic
1113911360 13:113842957-113842979 ATGAGTTGGGGGAGGCCCCGGGG - Intronic
1114627627 14:24139615-24139637 CTGTGTAGAGGGAAGATCAGAGG + Intronic
1115524911 14:34270386-34270408 CTGTGTTGGTGGTAGCTCAGAGG - Intronic
1116899541 14:50348588-50348610 CTTTTTTGGGAGAAGCTCAGAGG + Intronic
1117199497 14:53373721-53373743 CTGTGTCTTGGGAAGCCCAGAGG - Intergenic
1117255996 14:53978350-53978372 CAGTGTTAGGGGAATCCCATTGG + Intergenic
1118905504 14:70020547-70020569 CAGTGTTAGAGGGAGCCCAGAGG + Intronic
1121121150 14:91376684-91376706 CTGTCTGTGGGGAGGCCCAGGGG + Intronic
1121325978 14:93019797-93019819 CTGTGCAGGGGGATGCCCGGGGG + Intronic
1122126626 14:99581935-99581957 GTTTGTTGGGAGAAGCCAAGGGG - Intronic
1122263371 14:100535528-100535550 CTGAGCTGGGGGCAGCCAAGAGG - Intergenic
1122466785 14:101939123-101939145 TTTCATTGGGGGAAGCCCAGTGG - Intergenic
1122722027 14:103727575-103727597 CTGCGTGGTGGGGAGCCCAGGGG + Intronic
1123025152 14:105420563-105420585 CCCTGCTGGGGGAAGCCCCGGGG - Intronic
1123472031 15:20562640-20562662 CTTTGGTGGGGGTAGCCCAGAGG - Intergenic
1123645972 15:22437713-22437735 CTTTGGTGGGGGTAGCCCAGAGG + Intergenic
1123732335 15:23157631-23157653 CTTTGGTGGGGGTAGCCCAGAGG - Intergenic
1123750470 15:23355013-23355035 CTTTGGTGGGGGTAGCCCAGAGG - Intronic
1124270298 15:28274496-28274518 CTGAGGGGTGGGAAGCCCAGCGG - Intronic
1124282840 15:28378929-28378951 CTTTGGTGGGGGTAGCCCAGAGG - Intronic
1124299859 15:28532684-28532706 CTTTGGTGGGGGTAGCCCAGAGG + Intronic
1124481376 15:30083221-30083243 CTTTGGTGGGGGTAGCCCAGAGG - Intronic
1124487831 15:30135317-30135339 CTTTGGTGGGGGTAGCCCAGAGG - Intronic
1124542921 15:30604294-30604316 CTTTGATGGGGGTAGCCCAGAGG - Intronic
1124562873 15:30791722-30791744 CTTTGGTGGGTGGAGCCCAGAGG - Intergenic
1124755698 15:32403004-32403026 CTTTGGTGGGGGTAGCCCAGAGG + Intronic
1126103238 15:45132076-45132098 CTGTCCTTGGGGGAGCCCAGAGG - Intronic
1126585240 15:50279758-50279780 CTGAGTGGGGTGAAGGCCAGGGG + Intronic
1127160629 15:56181027-56181049 CTTTGTTGGGAGTAGCCCACAGG - Intronic
1127207403 15:56734452-56734474 CAGTGCTGGGGGAAGCCCTCAGG - Intronic
1127356426 15:58205187-58205209 CTGTGTTGGGCCAAGCCTAGAGG - Intronic
1127395049 15:58537767-58537789 CAGGGTTGGGGGAATCACAGAGG - Intronic
1127776844 15:62270431-62270453 CTTTGGTTGGGGAAGCCCAGAGG + Intergenic
1128084724 15:64877859-64877881 CTGTCTCTGGGGAAGGCCAGGGG + Intronic
1128589236 15:68880006-68880028 CATTGTTGGGGGAAACACAGTGG + Intronic
1128674645 15:69599754-69599776 CTGTGCTGGGGAAAGCCCTCAGG - Intergenic
1129397270 15:75258807-75258829 CTTTGGTGGGGGGAGCCCAGAGG - Intronic
1129474488 15:75775796-75775818 CTTTGGTGGGGGGAGTCCAGAGG - Intergenic
1129686081 15:77686815-77686837 CTGAGGTGGGGGAGGCCCAGGGG - Intronic
1129730266 15:77926595-77926617 CTTTGGTGGGGGGAGTCCAGAGG + Intergenic
1129760262 15:78125153-78125175 CTGTGTTGGGTGAGGAGCAGGGG - Intronic
1130233424 15:82113711-82113733 CAGTGTGGGGTCAAGCCCAGGGG - Intergenic
1130260331 15:82349151-82349173 CTTTGGTTGGGGGAGCCCAGAGG + Intronic
1130268399 15:82430282-82430304 CTTTGGTTGGGGGAGCCCAGAGG - Intronic
1130276180 15:82477424-82477446 CTGTGTTTGGGGAGACCCACCGG - Intergenic
1130280902 15:82519856-82519878 CTTTGGTTGGGGGAGCCCAGAGG - Intergenic
1130412663 15:83660086-83660108 CTGTGTTGGTGGCAGCAAAGAGG - Intronic
1130468539 15:84204817-84204839 CTGTGTTTGGGGAGACCCACCGG - Intergenic
1130472272 15:84236037-84236059 CTTTGGTTGGGGGAGCCCAGAGG - Intronic
1130479765 15:84350608-84350630 CTTTGGTTGGGGGAGCCCAGAGG - Intergenic
1130483898 15:84387041-84387063 CTTTGGTGGGGGGAGCCCAGAGG - Intergenic
1130492005 15:84437521-84437543 CTTTGGTTGGGGGAGCCCAGAGG + Intergenic
1130495725 15:84468725-84468747 CTGTGTTTGGGGAGACCCACCGG + Intergenic
1130503621 15:84516561-84516583 CTTTGGTTGGGGGAGCCCAGAGG + Intergenic
1130590832 15:85209416-85209438 CTGTGTTTGGGGAGACCCACCGG - Intergenic
1130594570 15:85240673-85240695 CTTTGGTTGGGGGAGCCCAGAGG - Intergenic
1130857664 15:87855413-87855435 CTGTTCTGGGAGAAGCCCAGGGG + Intergenic
1132433971 15:101781799-101781821 CTTTGTTGGGGGAACCCCAGAGG + Intergenic
1134192651 16:12134520-12134542 CTGTGTTGGGAGCAGCCCCACGG - Intronic
1134907608 16:17994288-17994310 CTGTGATGGGGGAGGCTCAAAGG - Intergenic
1135625882 16:23994419-23994441 CTATGATGGGTGAAGCCAAGAGG + Intronic
1136867073 16:33767330-33767352 CAGCGCTGGGGGAAGCCCACAGG - Intergenic
1137568182 16:49547316-49547338 TTGTGTTGGGTGAAGCCTTGTGG - Intronic
1138195994 16:55052730-55052752 CTGAGTTGGGGACAGCTCAGAGG + Intergenic
1138395194 16:56698619-56698641 CTGTAATTGGGGAAGCTCAGTGG + Intronic
1139489857 16:67280274-67280296 ATGAGTCGGGGGATGCCCAGAGG + Exonic
1139997222 16:70992457-70992479 GTGTGAAAGGGGAAGCCCAGGGG - Intronic
1203105091 16_KI270728v1_random:1348873-1348895 CAGCGCTGGGGGAAGCCCACAGG + Intergenic
1203128423 16_KI270728v1_random:1613495-1613517 CAGCGCTGGGGGAAGCCCACAGG - Intergenic
1142610573 17:1107563-1107585 CTGTGCTGGGGGCTTCCCAGAGG + Intronic
1143575723 17:7792115-7792137 CTGAGATGGGGGATGCCCAGGGG - Intronic
1144345763 17:14347742-14347764 CTGTTTTGGAGGAAGCTCATGGG + Exonic
1144739565 17:17574027-17574049 CTGTGATGCCAGAAGCCCAGTGG - Intronic
1144778632 17:17797055-17797077 GGGTGCTGGGGGCAGCCCAGTGG + Exonic
1145058447 17:19717738-19717760 CTGTGTTTGGGGCCGCCCATGGG - Intronic
1147210592 17:38870548-38870570 GTGTGTTGGGGGAAGGTTAGGGG + Intronic
1147982420 17:44282677-44282699 CTGTGTGGTGGGAAGTCAAGCGG + Intergenic
1148446843 17:47743087-47743109 CTGTGTTGGGGGAGTCCGGGTGG - Exonic
1148782716 17:50130500-50130522 CTGGGCTGGGGGATTCCCAGAGG + Intergenic
1149517986 17:57294871-57294893 CTGGGTTGGGTGCAGGCCAGGGG + Intronic
1149560566 17:57605278-57605300 GTGTGTTGGGGGAGGCCGGGTGG + Intronic
1149578273 17:57729046-57729068 CTGGTTTGGGGAGAGCCCAGGGG - Intergenic
1150132484 17:62676606-62676628 CTGTTTATGGGGAAGCCCTGGGG - Intronic
1151673329 17:75585045-75585067 CTGTGCTGGGGCAGGCTCAGAGG - Intergenic
1152015331 17:77746952-77746974 CTGGGCTGGGGCAGGCCCAGGGG - Intergenic
1152563840 17:81091421-81091443 CTATGCTGGGGGCAGCCCGGGGG + Intronic
1152566084 17:81101035-81101057 CTGTGCCGGGGGACGCCTAGCGG - Intronic
1152566107 17:81101119-81101141 CTGTGCTGGGGGACGCCTAGCGG - Intronic
1152595510 17:81235923-81235945 CGGTTTTGGGGTGAGCCCAGTGG + Intronic
1152716852 17:81904381-81904403 CCGTGTTGGGGGGTGCCCAGTGG + Exonic
1152726133 17:81947313-81947335 CAGGGTTGGAGGACGCCCAGCGG + Intergenic
1152726146 17:81947359-81947381 CCGGGTTGGAGGACGCCCAGCGG + Intergenic
1152928686 17:83099425-83099447 GGGTGTTGGGGGAATCCCACAGG - Intergenic
1155106471 18:22671114-22671136 CTGTCTTGCTGGAAGCCCAGGGG + Intergenic
1158883806 18:61806469-61806491 CTGTGTTTGTGGAAGGCCTGAGG + Intergenic
1159924993 18:74261422-74261444 CTGGCCAGGGGGAAGCCCAGTGG + Intronic
1160666756 19:334352-334374 CTGTGTTGGGTGGAGCCCTCCGG - Intronic
1161152796 19:2718368-2718390 CTGGGTTGGCGGAAGAGCAGGGG - Intronic
1161348969 19:3782094-3782116 CTGTGTAGGGAAGAGCCCAGAGG - Intronic
1163018800 19:14472070-14472092 TTGTGTTGGGGGGCGCCCAGGGG + Intergenic
1163630753 19:18417011-18417033 CTGTGATGGGGGAGGCGCGGAGG - Intergenic
1163862004 19:19747608-19747630 ATGTTTTGGGGGCAGCCCAAGGG + Intergenic
1164051964 19:21591421-21591443 CTGTGGTGAGGACAGCCCAGAGG + Intergenic
1164148902 19:22532203-22532225 CTTTGATGGGGGGAGCCCAGTGG + Intronic
1164622106 19:29702626-29702648 GGGAGTTGGGAGAAGCCCAGCGG - Exonic
1164717511 19:30404297-30404319 CTGTATTTGGGGCAGGCCAGAGG + Intronic
1165431744 19:35776824-35776846 CTGGGATGGGGGAACCTCAGGGG + Intronic
1165468892 19:35991858-35991880 CTGTGTTGGAGGAAGCAAACTGG - Intergenic
1165494876 19:36146622-36146644 TTGTGCTTGGGGAAGCCTAGAGG + Intronic
1165714386 19:38035035-38035057 CTGTGATCGGGGAAGCCCAGGGG + Intronic
1165803640 19:38567520-38567542 CTGGGATGGAGGAAGCTCAGGGG - Intronic
1166110491 19:40619859-40619881 CTGTGACGGGGAAAGCCCAGGGG + Intronic
1166112926 19:40634090-40634112 CTGCGGTGGGGGAAGATCAGAGG + Intergenic
1166366123 19:42279377-42279399 CTGAGTCTGGGGAAGCCAAGGGG + Intronic
1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG + Intronic
1166375998 19:42327372-42327394 CTTTGATGGAGGAACCCCAGAGG + Intronic
1167507988 19:49881231-49881253 CTGTGTTGGGGGAAGCGCGTGGG - Intronic
1167666054 19:50823331-50823353 GTGGGGTGGGGGAAGCCCATGGG + Intronic
1168323671 19:55525953-55525975 CTGTCATGGGTGAAGCACAGGGG - Intergenic
926294751 2:11560956-11560978 CTGTGTGTTGGGCAGCCCAGTGG - Intronic
927199564 2:20569962-20569984 CAGGGCTGGGGGCAGCCCAGAGG - Intronic
927842529 2:26454752-26454774 CTGTGTAGAGGGCATCCCAGAGG - Exonic
928293593 2:30061509-30061531 CTGTGGTGGGGGAGGCCATGAGG + Intergenic
929097619 2:38278855-38278877 GAGTGATGGGGGAAGGCCAGTGG + Intergenic
929209270 2:39336116-39336138 ATGTGCTGGGGTTAGCCCAGTGG - Intronic
929564256 2:42974987-42975009 CTGTGACGGGGGAAGCCCTGGGG + Intergenic
930102467 2:47614023-47614045 CTGTCCCGAGGGAAGCCCAGGGG - Intergenic
930281396 2:49374284-49374306 TGGTGTTAGGGGAAGCACAGAGG + Intergenic
931518299 2:63067031-63067053 AAGTGTTATGGGAAGCCCAGAGG - Intergenic
933793642 2:85903382-85903404 CTGAGTTGGGGGTAGGACAGGGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
935260324 2:101350126-101350148 CTGTGGTGGGGAAAGCGGAGAGG - Exonic
935657083 2:105432625-105432647 TTGTGTTGGGGGAAGAGAAGAGG - Intronic
935950802 2:108326550-108326572 CTGTGCTCGGGGAAGCCCTGGGG - Intergenic
939879563 2:147614506-147614528 CTGTGTTGGTGGAGACACAGGGG - Intergenic
940863283 2:158791691-158791713 CTGTGCTGGGCGGGGCCCAGAGG + Intergenic
944384664 2:199151155-199151177 CTGTGTGGGTGAAAGCACAGTGG - Intergenic
946504537 2:220284845-220284867 TTGGGGTGGGGGAAGCCCACAGG - Intergenic
947138760 2:227001382-227001404 CTATTTTGGGGGAATCCCACAGG - Intergenic
947466857 2:230358589-230358611 CAGTCTTGGGGGAAGAGCAGGGG + Intronic
947475460 2:230443805-230443827 CAGTCTTGGGGGAAGAGCAGGGG + Intronic
948029638 2:234806653-234806675 CTGTGCTGGGGGAAGATGAGAGG + Intergenic
948330541 2:237160878-237160900 CTGTGGTGTGGGGAGCCTAGGGG + Intergenic
948355264 2:237372643-237372665 CTGTCTCTGGCGAAGCCCAGTGG - Intronic
948662116 2:239514128-239514150 CTGTGTTGGGGGATGGCCCTCGG - Intergenic
948751348 2:240135203-240135225 CTGGGTTGGGGGATGCCGACTGG - Intronic
948794150 2:240393592-240393614 GTGTGGTGGGGGATGGCCAGGGG - Intergenic
1169522583 20:6389460-6389482 TTGTGTTGTGAGAAGCCAAGAGG + Intergenic
1169988055 20:11469214-11469236 CTGGGTTGTGGAATGCCCAGGGG + Intergenic
1170080818 20:12472749-12472771 CTGTGTAGGAGGAAGACCACAGG + Intergenic
1171020677 20:21581768-21581790 CTGTGCTGGGGGAATCCTAGAGG - Intergenic
1172335331 20:34111481-34111503 CTCTGTTAAGGGAAGCTCAGGGG + Intronic
1172509941 20:35493597-35493619 CTGTGTTGGGGAAGGACCATGGG - Intronic
1172520611 20:35563075-35563097 CTGTGTTGGATAAAGCCCTGTGG + Intergenic
1172572876 20:35984129-35984151 CTGTTTTGGGGTAAGCCCAGGGG + Exonic
1172902449 20:38344954-38344976 CTGTGGTGGGGAAAGCGCAAAGG + Intergenic
1173335253 20:42107322-42107344 CTGTCTTGGGGACAGCTCAGAGG - Intronic
1173482863 20:43416802-43416824 GTGTGCTGGGGGAAGCCCATGGG - Intergenic
1173529833 20:43760770-43760792 CAGTATTGGGGTGAGCCCAGTGG + Intergenic
1173550923 20:43932735-43932757 CTGGGTTGGGTGAAGGCAAGGGG + Intronic
1173560752 20:44003777-44003799 CTGTGTAGGGGAGAGCCCAGAGG + Intronic
1173666352 20:44766074-44766096 CTGTGGTGGGGGAGGGACAGGGG + Intronic
1174340303 20:49891147-49891169 CTGTGTGGGGAGAAGCTCAGTGG + Exonic
1175180857 20:57146221-57146243 CAGGTTTGGTGGAAGCCCAGAGG - Intergenic
1175968173 20:62670252-62670274 TGGTGTTTGGGGAAGCCCAAAGG + Intronic
1176002029 20:62836511-62836533 CTGTGTGGGGGGATGATCAGCGG + Exonic
1177495316 21:21882057-21882079 CTGTGTAGGGGGAAGAGCATGGG - Intergenic
1177805175 21:25868274-25868296 CTCTGTTGGGGAAAGCTCTGGGG + Intergenic
1180072174 21:45442018-45442040 CTGTGTGGGGTTCAGCCCAGGGG + Intronic
1181926189 22:26360704-26360726 CTGTGCTGGGGAAAGCGCACAGG - Intronic
1182441142 22:30365100-30365122 CTGAGATGGTGGAAGCCCAGAGG + Intronic
1182551140 22:31101254-31101276 CTGTGATGGGGGAAGCCCAGGGG + Intronic
1183273725 22:36878150-36878172 CTGTGTTGGGGGGAAACCCGAGG + Intergenic
1183362165 22:37388325-37388347 TTGTGATGGAGGAAGCACAGGGG - Intronic
1183401564 22:37608092-37608114 GTGTGATAGGGGAAGCCCACGGG - Intergenic
1184034309 22:41911221-41911243 CTGTTGTGGGGGGAGCCCCGGGG + Exonic
1184074036 22:42164853-42164875 CTGTGTGTGCAGAAGCCCAGAGG + Intronic
1184292937 22:43508011-43508033 CTGGGGTGGGGGGATCCCAGAGG + Intergenic
1184405790 22:44299604-44299626 CTTTGCTGGGGGCAGCTCAGAGG - Intronic
1184457501 22:44620126-44620148 CGGGGGTGGGAGAAGCCCAGGGG + Intergenic
1184608621 22:45588532-45588554 CTGGGTTGGGGTGACCCCAGTGG - Intronic
1184725539 22:46342943-46342965 CTGTGTTGGAGGAGTCCCAGAGG + Intronic
1184967787 22:47994081-47994103 CTGGGTTGGAGGAGGCCGAGTGG - Intergenic
949128431 3:473107-473129 CTGTGTAGTGGCCAGCCCAGAGG - Intergenic
950152894 3:10702088-10702110 CTGGGTAGCGGGAAGCCCACTGG - Intronic
950531430 3:13554281-13554303 CTGTGTTGGGGCCAGCCCTTGGG + Intronic
952974420 3:38681892-38681914 CTGTGGTGGGGCAAGTACAGGGG - Intergenic
953406954 3:42664444-42664466 CTGGGTTGGGGGCAGGCCTGGGG - Exonic
954111546 3:48436364-48436386 CTGTCTTTGGAGAAGCTCAGCGG + Intronic
954149303 3:48649290-48649312 CTATGCTGGGGGAATCCCTGAGG + Intronic
954371237 3:50170535-50170557 ATGGGTTGGGGGAAGACCTGAGG + Intronic
955983321 3:64548591-64548613 TTATGTGGGGGGGAGCCCAGTGG + Intronic
956626023 3:71267728-71267750 CTGTGTTGGGCCAGGCGCAGTGG + Intronic
957160468 3:76602656-76602678 CTGTCATGGGAGGAGCCCAGTGG - Intronic
957243702 3:77691504-77691526 CTGTCTTGGGGGGAACCCAGTGG + Intergenic
957494572 3:80975296-80975318 CAGTGATGGGGGAAGGCAAGGGG + Intergenic
960884439 3:122380339-122380361 CTGGTTTGGGGGAAGCACCGTGG - Intronic
962900671 3:139758811-139758833 GTGTGATGGGGCAAGCACAGAGG - Intergenic
963172487 3:142265089-142265111 CTGTTGTGGGAGAAGCCCAGTGG + Intergenic
966863278 3:184242251-184242273 CTGTGTTGCAGGGAGCTCAGAGG - Exonic
967097222 3:186186994-186187016 CTGTGTTGGAGGAACCAGAGTGG + Intronic
967270489 3:187728609-187728631 CTGTGTGTAGGCAAGCCCAGAGG + Intronic
968265695 3:197361250-197361272 GTGTCGTGGGGGAAACCCAGTGG + Intergenic
969022049 4:4145428-4145450 CTGAGTTGGGGGCCACCCAGTGG + Intergenic
969344003 4:6560049-6560071 AGGTGTTGGGGGAACCACAGGGG + Intronic
969731816 4:8961965-8961987 CTGAGTTGGGGGCCACCCAGTGG - Intergenic
969791413 4:9496072-9496094 CTGAGTTGGGGGCCACCCAGTGG - Intergenic
969992131 4:11275553-11275575 CTTTGTTAGAGGAAGCCCAGGGG - Intergenic
970200116 4:13595865-13595887 CTGTGTGGGGGAAAGCCAAGTGG - Exonic
970738916 4:19209695-19209717 CAGTGTTGGAGGAGGCCTAGTGG - Intergenic
971729692 4:30361419-30361441 CTGGCTTGTGTGAAGCCCAGAGG - Intergenic
972639042 4:40909072-40909094 CTGTGACAGGGGAGGCCCAGAGG - Intronic
976037994 4:80847437-80847459 TAGTGTTGGGGGAAGTCTAGTGG + Intronic
976383948 4:84433882-84433904 CTGAGTTGAGGGAATTCCAGGGG + Intergenic
977751425 4:100614362-100614384 GGGTATTGGGGGAAGCCTAGGGG - Intronic
981637611 4:146898700-146898722 CTTTGCTGTGGGAAACCCAGAGG - Intronic
981659723 4:147152198-147152220 GTGTGTTTGAGGCAGCCCAGAGG + Intergenic
981718595 4:147776586-147776608 CTGTCTTGGGGGAGCCCCACAGG - Intronic
985366600 4:189237585-189237607 CTGTGCTGGGGGAGTCCCTGTGG + Intergenic
985803584 5:2021999-2022021 CTGTGTTAGGGGGAGGCAAGGGG - Intergenic
986725752 5:10595142-10595164 CTGTGTTGGGGCCAGACCGGAGG + Intronic
988846836 5:35135869-35135891 CTGTGGTGTGGGAAGGCCAGGGG + Intronic
990789126 5:59456231-59456253 GTGTCGTGGGGGAAACCCAGTGG + Intronic
991969574 5:72126116-72126138 CTGTGTTGAGGGAAGCAGGGAGG + Intronic
993386455 5:87268240-87268262 CTGGGTTACGGGAAGCCAAGTGG - Exonic
993733906 5:91453027-91453049 AAGTGTTAGTGGAAGCCCAGAGG - Intergenic
994656102 5:102594528-102594550 CTGTGATGGGAGTAACCCAGTGG - Intergenic
995332573 5:110961566-110961588 CTCTGTTGAGGGAACCCCAAAGG + Intergenic
997646412 5:135484953-135484975 CTGAGTGAAGGGAAGCCCAGAGG - Intergenic
998174514 5:139893673-139893695 GGGTTTTGGGGGAAGCCCAGAGG + Intronic
998712664 5:144844681-144844703 CTGTGATGGGGGAAACCAACAGG - Intergenic
998756818 5:145390546-145390568 CTGTGGTGGGAGGATCCCAGTGG - Intergenic
999698417 5:154206522-154206544 CAGTGCTGCGGGAAGCCAAGAGG + Intronic
1001808547 5:174609442-174609464 CTGGCTTGGGGGAAGCCCTGTGG + Intergenic
1002575378 5:180171106-180171128 CTGGGCTGGGGGAAGGCCACAGG - Intronic
1003313097 6:4986424-4986446 GTGTGTTGGGGGAAGTACATAGG + Intergenic
1003616663 6:7660677-7660699 CTGTTATGGGAGAATCCCAGAGG - Intergenic
1006245919 6:32735667-32735689 CTGTGAGGTGGGAAGCCCACTGG + Intergenic
1006301223 6:33194387-33194409 TTGTGCTGGGGGAAGGACAGAGG + Exonic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006516998 6:34550711-34550733 GTCTGTTGGGGGAAGTACAGGGG + Intronic
1007605331 6:43113932-43113954 GTCTGTTGGTGGAAGGCCAGAGG - Intronic
1010434088 6:75810578-75810600 CTTGGATGGGGGAAACCCAGAGG - Intronic
1010526752 6:76909409-76909431 CTGGGTAGGGGGAATCCCAATGG + Intergenic
1011551614 6:88535648-88535670 CTGTTCTGGAGGCAGCCCAGAGG - Intergenic
1012773125 6:103466378-103466400 GTGTGTTTGGGGAAGCAGAGGGG + Intergenic
1014616463 6:123606966-123606988 ATGTGTGGGGGGACTCCCAGAGG - Intronic
1015480416 6:133702281-133702303 CTGGGTTGGGGGAGGCAGAGAGG - Intergenic
1016492839 6:144626583-144626605 CAGTGTTGGGGGAAACTGAGTGG - Intronic
1017611321 6:156189392-156189414 CTGTCTTGGTGGAAGACCAAAGG - Intergenic
1019013713 6:168863980-168864002 CTGTGGTTGGTGAACCCCAGTGG + Intergenic
1019049633 6:169173212-169173234 CTGTCTTTGGGGAAGCACAGTGG - Intergenic
1020309473 7:6857469-6857491 CTGAGTTGGGGGCCACCCAGTGG + Intergenic
1021456518 7:20835271-20835293 CTGTGAGGCGGGAAGCCCAGTGG - Intergenic
1022025940 7:26447950-26447972 ATGTGTTGGGGCAAGCCCAAGGG - Intergenic
1024636897 7:51298512-51298534 CTGGGGTGGGGGATGCCCTGTGG - Intronic
1026735921 7:72948720-72948742 TGGTCTTGGGGGAAGCCCGGAGG + Exonic
1026800007 7:73394244-73394266 CTGGGTTGGGGGTAGAGCAGGGG - Intergenic
1027107812 7:75416341-75416363 TGGTCTTGGGGGAAGCCCGGAGG - Intergenic
1028904429 7:96137067-96137089 CTTGCTTGGGGGAAGCCAAGAGG - Intronic
1029382144 7:100221266-100221288 CTGGGAGGGGGAAAGCCCAGTGG - Exonic
1029402297 7:100353711-100353733 CTGGGAAGGGGAAAGCCCAGTGG - Intronic
1031096773 7:117429438-117429460 CTGAGATGGGGGAAGACCAGTGG + Intergenic
1031193824 7:118588069-118588091 CTTTGTAGGGGGAACCCCTGTGG + Intergenic
1032097397 7:128946374-128946396 CTGTGTTGGGGGCAGCTTTGGGG + Intronic
1033338623 7:140474431-140474453 GTGGGTTGGGGGGGGCCCAGAGG + Intronic
1033528894 7:142243891-142243913 CTGGGCTGGTGGAAGACCAGGGG - Intergenic
1035022745 7:155808865-155808887 CCGCGCTGGGGGAAGCCCACCGG - Intronic
1035390260 7:158499317-158499339 CAGTGTGGTGGGCAGCCCAGCGG - Intronic
1035530133 8:344832-344854 CTGAGCTGGGGGAAGGCCAGTGG - Intergenic
1038090491 8:24247750-24247772 CTGTGTTGGGGTAAGTGGAGTGG - Intergenic
1038694848 8:29797477-29797499 TTGTGTTGGGGGAAGGGCTGGGG - Intergenic
1039895234 8:41712463-41712485 CTGGTTTAGGGGAAGCTCAGAGG - Intronic
1041318149 8:56585218-56585240 ATGTGTGAGGGGAGGCCCAGAGG + Intergenic
1042512969 8:69630632-69630654 CTGTGGTGTGGGAATCCCTGAGG + Intronic
1043479812 8:80641466-80641488 CTGTCTTACAGGAAGCCCAGGGG - Exonic
1043702956 8:83313373-83313395 CTGAGTTGGCGGAAGCCAGGGGG - Intergenic
1043976893 8:86594178-86594200 CCCTGTTGGGGGAGCCCCAGTGG - Intronic
1044546363 8:93464845-93464867 CTGTGAGGAGAGAAGCCCAGGGG - Intergenic
1046327754 8:112672280-112672302 CTGTGTGGGGGAAAGTCAAGTGG + Intronic
1048528660 8:135227705-135227727 CTGGGTTGGGGGAACGTCAGGGG - Intergenic
1049377118 8:142294556-142294578 CTGAGCTGTGGGAATCCCAGAGG - Intronic
1049472127 8:142781152-142781174 CTGAGTTGGGGGCTGGCCAGTGG + Intergenic
1049770081 8:144375863-144375885 GTGTGTTGGGGGAAGGCCCTGGG + Intronic
1052839916 9:33284084-33284106 CTGTATTGGGGAAAGGCCAAAGG + Intergenic
1054923613 9:70566210-70566232 GTGTGATGCGGGAAGCCCACGGG + Intronic
1056452959 9:86734389-86734411 CTGGGTTGAGGGACGCCTAGAGG - Intergenic
1058649189 9:107159230-107159252 CTGTGTTGTGGGAAGGACAGGGG + Intergenic
1060294815 9:122336204-122336226 CGGTGCTGGGGGCAGACCAGAGG - Intergenic
1060821452 9:126663884-126663906 CTGTCTTTGGGGAATCCCGGGGG + Intronic
1061489869 9:130938976-130938998 GTGTGTCGGGGGAGGCCGAGGGG - Intronic
1061539199 9:131268449-131268471 TTGTGGTGGGGGAATCCCCGTGG - Intronic
1061884544 9:133585046-133585068 CTGGGGTGGGGGACGCACAGGGG - Intronic
1186425907 X:9464682-9464704 ATGTGATGGGGGTAGCCCTGGGG + Intronic
1188262777 X:28038605-28038627 CAGTGTTGGGGTGAGCACAGGGG + Intergenic
1189796563 X:44651439-44651461 CCGTGGTGGGGGCTGCCCAGAGG + Intergenic
1191053684 X:56221296-56221318 CTGTGTTGGAATAAGGCCAGGGG - Intergenic
1191108638 X:56788378-56788400 AAGTGCTGGGGAAAGCCCAGGGG + Intergenic
1193789082 X:85797054-85797076 CTGTCTTGGGCGGAGCCCACAGG - Intergenic
1194807850 X:98351507-98351529 CTGTTTTACTGGAAGCCCAGTGG + Intergenic
1194968157 X:100313292-100313314 CTGTGGTGGGGGAAGCCCTGAGG + Intronic
1195816415 X:108894028-108894050 CTGTGCTGGAGGAAGACCTGGGG - Intergenic
1196050630 X:111299881-111299903 CTGTGTAGGGGGGAACCCAGTGG - Exonic
1197730121 X:129803017-129803039 CTGAGTTGGGGCCAGGCCAGGGG - Intergenic
1199270579 X:145878405-145878427 CTGGGTTGGGGCAAGTCCTGTGG + Intergenic
1200210787 X:154345819-154345841 CTGTGTGGGGGGCAGGCCCGAGG - Intergenic
1200220065 X:154386273-154386295 CTGTGTGGGGGGCAGGCCCGAGG + Intergenic
1200234065 X:154459809-154459831 AGGCGTTGGGGGCAGCCCAGAGG + Intronic
1202366326 Y:24168389-24168411 CTTTGGTTGGGGGAGCCCAGAGG - Intergenic
1202374178 Y:24218255-24218277 CTTTGGTGGGGGGAGCCCAGAGG + Intergenic
1202496603 Y:25451865-25451887 CTTTGGTGGGGGGAGCCCAGAGG - Intergenic
1202504455 Y:25501734-25501756 CTTTGGTTGGGGGAGCCCAGAGG + Intergenic