ID: 903573823

View in Genome Browser
Species Human (GRCh38)
Location 1:24325505-24325527
Sequence TAAAACCCCCAATAAGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903573823_903573827 29 Left 903573823 1:24325505-24325527 CCTTGGTCTTATTGGGGGTTTTA 0: 1
1: 0
2: 1
3: 14
4: 105
Right 903573827 1:24325557-24325579 TTGACTCAGAAGAGACTTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 191
903573823_903573828 30 Left 903573823 1:24325505-24325527 CCTTGGTCTTATTGGGGGTTTTA 0: 1
1: 0
2: 1
3: 14
4: 105
Right 903573828 1:24325558-24325580 TGACTCAGAAGAGACTTGTTGGG 0: 1
1: 1
2: 1
3: 17
4: 154
903573823_903573825 2 Left 903573823 1:24325505-24325527 CCTTGGTCTTATTGGGGGTTTTA 0: 1
1: 0
2: 1
3: 14
4: 105
Right 903573825 1:24325530-24325552 TAGCTCAGCCAGAAAGCAGTGGG 0: 1
1: 0
2: 3
3: 12
4: 172
903573823_903573824 1 Left 903573823 1:24325505-24325527 CCTTGGTCTTATTGGGGGTTTTA 0: 1
1: 0
2: 1
3: 14
4: 105
Right 903573824 1:24325529-24325551 GTAGCTCAGCCAGAAAGCAGTGG 0: 1
1: 0
2: 3
3: 43
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903573823 Original CRISPR TAAAACCCCCAATAAGACCA AGG (reversed) Intronic
901564184 1:10098831-10098853 TAAAATCAGCAATAAGAACAAGG + Intronic
901727176 1:11250971-11250993 AATATCCCCCACTAAGACCATGG + Intronic
902427193 1:16333315-16333337 TAAAACCCACATTAAGAGCCAGG + Intronic
902538510 1:17135921-17135943 AAAAACCCCAAATTGGACCATGG + Intergenic
902602634 1:17550666-17550688 AAAAACCCCAAAGAAGTCCAAGG + Intronic
903573823 1:24325505-24325527 TAAAACCCCCAATAAGACCAAGG - Intronic
904115553 1:28159194-28159216 TGAAACACCCAAAAGGACCAGGG + Intronic
906936392 1:50217483-50217505 TCAAACCCACAATAAAACCCTGG - Intergenic
918794141 1:188871319-188871341 TAAAACCTCAAGTAACACCAGGG + Intergenic
923232734 1:232003464-232003486 TAAAACAACCAATAAAACTATGG + Intronic
923673716 1:236063593-236063615 TAAAATCCACAAGATGACCAAGG - Intronic
1065379050 10:25070642-25070664 TCAAACCCCCAATAAATCCAAGG + Intergenic
1068378331 10:56213566-56213588 TAAAGCCACCTAGAAGACCATGG + Intergenic
1068920841 10:62482330-62482352 TAATTCCCCCAATAACACCATGG - Intronic
1074961448 10:118449546-118449568 TAAAACTCCCAAGAAGACCCTGG + Intergenic
1075768400 10:124913242-124913264 TAAAAACCCCAAAAAGACAGTGG + Intergenic
1078706597 11:13749554-13749576 GACAACCCCCAATAACATCAAGG + Intergenic
1085169615 11:74437968-74437990 TAAAACTACTAATAAAACCAAGG - Intergenic
1086045000 11:82522321-82522343 TAATATCACAAATAAGACCAAGG - Intergenic
1088628738 11:111753343-111753365 TAGAACCCCCAAAAAGAAAATGG - Intronic
1094648198 12:32348080-32348102 TAAAAACACGAATAGGACCATGG - Intronic
1097470036 12:59978239-59978261 TAAAACACCCAATCTGACCAGGG + Intergenic
1097936268 12:65255436-65255458 TAAAAGCCCTCATAAGACTACGG - Intergenic
1098631740 12:72731475-72731497 TAAAACCACCAATACTATCATGG + Intergenic
1099867685 12:88304284-88304306 GAATACCCCCAAGAAGACCACGG - Intergenic
1112597895 13:100825900-100825922 TAATACCCCCAAAAAGCCAAAGG - Intergenic
1112727043 13:102316696-102316718 TAAAGCCTACAATAATACCATGG - Intronic
1116763134 14:49039338-49039360 TCAAACCCCAAATGTGACCACGG + Intergenic
1118077642 14:62318229-62318251 TCAAAGCCCCAATAAACCCACGG + Intergenic
1118683568 14:68268477-68268499 TATTACCCCCTATAAGACAAAGG - Intronic
1121519139 14:94573927-94573949 TAAAAACCCCAAAAAGGACAGGG - Intronic
1125109549 15:36014998-36015020 TACAACCACCAAGAAGTCCATGG + Intergenic
1126296349 15:47140616-47140638 TAAAAAGCCCAATCAGACCTAGG - Intergenic
1128113749 15:65092960-65092982 TAAAAACACAAATAATACCAAGG - Exonic
1128894840 15:71363340-71363362 TATAACAGCCAATTAGACCAAGG - Intronic
1131090868 15:89624176-89624198 TCAAAACTCCAAAAAGACCAGGG + Exonic
1135776570 16:25261821-25261843 TAAAACCACCAAATAGCCCAAGG - Intergenic
1137839968 16:51631553-51631575 TGAAATGCCCAATAAGAACAGGG - Intergenic
1137911914 16:52386133-52386155 TAAAACTCCCCATAACACCACGG + Intergenic
1138701598 16:58869113-58869135 TAAAACCCCTAATAAGTCACTGG - Intergenic
1140541165 16:75757571-75757593 AAAAACCATAAATAAGACCATGG - Intronic
1144236814 17:13269551-13269573 TAAAACGCCAAATAACACCAAGG - Intergenic
1153204928 18:2688965-2688987 TAAAACCCAAATTCAGACCAGGG - Intronic
1157738903 18:50074805-50074827 AAAAACCCCCAAAAAAACCATGG - Intronic
927847349 2:26478389-26478411 TAAAACCTCCAAAAAAATCAAGG - Intronic
929319073 2:40518599-40518621 AAAAACCCTCAATAAGACATTGG - Intronic
929577603 2:43062273-43062295 AAAAACCCCCACAAAAACCAGGG - Intergenic
930312102 2:49754953-49754975 TAAAAGCCAGAATAATACCAGGG - Intergenic
930817662 2:55616054-55616076 TAAAACCAACAATCAAACCAAGG + Intronic
933037783 2:77421792-77421814 CAAAACCGTCAATAACACCAGGG + Intronic
933211640 2:79576973-79576995 TAAAACCCCCATGAAGAACATGG - Intronic
937564381 2:123266073-123266095 TTAAACCCCCAATAACACAAGGG - Intergenic
938964706 2:136377991-136378013 TAAAAACCAAAATAAGACCGTGG + Intergenic
942328399 2:174795218-174795240 TAAAACCCCCAAAACTTCCAAGG + Intergenic
943983087 2:194581008-194581030 CAAAAGGCCCAATAAAACCATGG - Intergenic
944344327 2:198642950-198642972 TAAAACCCCTAATCAAACCGTGG + Intergenic
944943600 2:204656999-204657021 TAAAATTACAAATAAGACCAAGG - Intronic
946528730 2:220548537-220548559 TAATACATCCAATGAGACCAGGG - Intergenic
1169425417 20:5493069-5493091 TAAAGTCCCCAAGAAGCCCACGG + Intergenic
1177380068 21:20328668-20328690 TAATATCACCAATAAGTCCAGGG + Intergenic
1178399513 21:32273255-32273277 TAAAACCTCCAAAAAACCCATGG - Intronic
1179395258 21:41033790-41033812 TGAAACCCCAAATATGTCCAAGG - Intergenic
1184077010 22:42187363-42187385 TAAAAGCCCCAATCAAAACATGG + Intronic
950912679 3:16611376-16611398 CAAAACCCCAAATAACACTATGG + Intronic
953050082 3:39333015-39333037 TCAAAACCACAACAAGACCAAGG + Exonic
953392435 3:42541237-42541259 TAAACACCCCAATCAGGCCAGGG + Intergenic
955307200 3:57845795-57845817 TAATATCCCCAATAACTCCATGG + Intronic
955708041 3:61748844-61748866 GAAAACCCACAATGAGACAAAGG - Intronic
956936718 3:74110133-74110155 TTCAACCACCAATAACACCAAGG - Intergenic
960225486 3:115163617-115163639 AAAAACCCCCAGTAAGTCCATGG - Intergenic
961983154 3:131103407-131103429 TATAACCCCCTATAAGACCAAGG - Intronic
965815693 3:172634429-172634451 CAAAACCCCCAAAAAGGTCATGG + Intronic
967252664 3:187558654-187558676 TAAAACTCCAAATAAAACCTTGG - Intergenic
967552838 3:190819121-190819143 TAGAACCTCTAATAAGACCCAGG - Intergenic
974506084 4:62773882-62773904 TAAAACCTACAAAAATACCAAGG + Intergenic
976483348 4:85570566-85570588 GAGAACCCCCAACAAGGCCAAGG + Exonic
978650147 4:110993604-110993626 TAAACCCTCCAATATGACCTTGG + Intergenic
978950126 4:114548114-114548136 CAAAAACCTCAAGAAGACCAAGG - Intergenic
980163402 4:129194989-129195011 TAAATCCCCCAATTACACCCCGG - Intergenic
980291592 4:130852388-130852410 TAAGACACCCAATTTGACCAGGG + Intergenic
984729280 4:183052446-183052468 ATAAACCTCGAATAAGACCATGG + Intergenic
987116670 5:14731327-14731349 TAAGAACCCCCATAAGAACAAGG + Intronic
987481639 5:18466365-18466387 TAAAAACCCCATCAAGACCAGGG + Intergenic
989775197 5:45198347-45198369 TAAAAACCGCAGTGAGACCAAGG + Intergenic
990467720 5:56085618-56085640 TTAAACCACCATTCAGACCAAGG + Intergenic
992487027 5:77207425-77207447 CAAAACCTCCAATATGTCCAGGG - Intergenic
994526521 5:100912451-100912473 TAAAACCCCAAAGAAGACTTTGG + Intergenic
994664921 5:102694819-102694841 AAAAACCCCAAATTAGAGCAAGG + Intergenic
995744661 5:115391254-115391276 TAAAATGACCAAGAAGACCAGGG - Intergenic
995779389 5:115759783-115759805 AAAAAGCCCCAAGAAAACCAAGG + Intergenic
996348061 5:122509030-122509052 TTAAATCCTCAATAAGAGCAAGG + Intergenic
997530505 5:134578810-134578832 CAAAGCCCCCAAGAAGACCTGGG + Exonic
998032769 5:138886256-138886278 TAAAATGACCAAGAAGACCAGGG + Exonic
999432344 5:151535344-151535366 TAAAACCCACAATTAGAAAAGGG - Intronic
1002872453 6:1179166-1179188 TAAAACCCCCAAAAAGGGCTGGG + Intergenic
1004862993 6:19824697-19824719 TAAAAACCCCAAGATGAGCAGGG - Intergenic
1006254814 6:32822344-32822366 AAAAACACCCATTAAGATCAAGG - Intronic
1006760622 6:36457314-36457336 TAAAATCCACAATATGACCGAGG - Intronic
1012857048 6:104514477-104514499 TAGAACCCCCAACAAGACATGGG - Intergenic
1012978725 6:105807841-105807863 TAAAACACCTAACAATACCAAGG - Intergenic
1012981850 6:105839226-105839248 TAAAACCCCAAAGAGGACAAGGG - Intergenic
1013189283 6:107788664-107788686 TAAAACCCTCCCTAATACCAGGG - Intronic
1014143231 6:117967501-117967523 AGAAACCCCCATAAAGACCAAGG - Intronic
1019447141 7:1077120-1077142 GAAAGCCCCCAAGAATACCAGGG - Intronic
1040455390 8:47592869-47592891 AAAAACCCCCAACAGAACCAAGG - Intronic
1042093973 8:65191495-65191517 TAAAACCCCAAATAAAACAATGG - Intergenic
1043842043 8:85118263-85118285 TAAAACCTTCAACAAGACAATGG - Intronic
1044563884 8:93641783-93641805 TAAGCCCCCAAATAAGACAATGG - Intergenic
1054848979 9:69826936-69826958 CAAAATCCCCACTAAAACCAGGG + Intronic
1055740498 9:79383070-79383092 TAAACCCCACAATATGACCCAGG + Intergenic
1057853473 9:98583529-98583551 GAAAACCACCAATATGACCCTGG + Intronic
1188970943 X:36614069-36614091 TAAAACCCTCAAAAACACCAAGG + Intergenic
1190407673 X:50103815-50103837 TAAAACTCCAAATAATACTAAGG - Intergenic
1191047939 X:56159288-56159310 TAAAATCCTCAATAAAACAATGG - Intergenic
1193140714 X:78023897-78023919 TAAAAACCCCAAGAAAACCTGGG - Intronic
1193495539 X:82206746-82206768 GAAAACCCCCAATAAAATAATGG + Intergenic
1195704483 X:107729138-107729160 TAACATCCCCAATATGCCCAAGG - Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197410794 X:126113982-126114004 GAAAACCTTCAATAAGAGCAGGG + Intergenic
1197964928 X:132050013-132050035 TAAGACCCCCAGTAAGACTCTGG - Intergenic
1199294759 X:146144477-146144499 TAAAACCCCCTCCAAGATCAGGG - Intergenic