ID: 903574546

View in Genome Browser
Species Human (GRCh38)
Location 1:24330797-24330819
Sequence CAGGGCACACAGAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 2, 2: 10, 3: 61, 4: 682}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903574546_903574551 0 Left 903574546 1:24330797-24330819 CCTTCCTGCCTCTGTGTGCCCTG 0: 1
1: 2
2: 10
3: 61
4: 682
Right 903574551 1:24330820-24330842 CAGCCTTCAACTCCAGTTCCTGG 0: 1
1: 0
2: 2
3: 26
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903574546 Original CRISPR CAGGGCACACAGAGGCAGGA AGG (reversed) Intronic
900181626 1:1313596-1313618 CAGGACACACAGGGCCAGGTGGG + Intronic
900210743 1:1454692-1454714 CAGGGGACACCGAGGCAGACAGG - Intronic
900223701 1:1523090-1523112 CAGGGGACACCGAGGCAGACAGG - Intronic
900843088 1:5071476-5071498 GAGGCCCCACAGAGCCAGGAAGG - Intergenic
900909570 1:5585477-5585499 GAGGGCAAACAGTGGCAAGACGG - Intergenic
900971892 1:5996396-5996418 CAGGGCACCCTCAGGCAGGGAGG - Intronic
901042545 1:6374211-6374233 CAGCCCAAACAGAGGCGGGAGGG + Intronic
901490551 1:9594383-9594405 CAGGGCCCACAGGGGCAGCTGGG - Intronic
901530868 1:9851773-9851795 CAGGACAGGCAGTGGCAGGAGGG + Intronic
901637376 1:10676591-10676613 CAGGGCACCCCTAGGCAGGTTGG - Intronic
901770228 1:11526443-11526465 CAAGGCTCAGAGAGGGAGGAAGG + Intronic
902074846 1:13776160-13776182 CAAGCCACACACAAGCAGGAAGG - Intronic
902534727 1:17112928-17112950 TGGGGCACACAGAGACAGAAAGG - Intronic
903501685 1:23803811-23803833 CAGGGCCCTCAGTGGCGGGACGG - Intronic
903551070 1:24157601-24157623 CAGGGCACTCGGAGGCTGGTGGG - Exonic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904001757 1:27342801-27342823 CAGGGCACAGAGAGGGACGTGGG + Intronic
904028385 1:27519288-27519310 CAGGGCCCTCACAGGCAGGGGGG - Intergenic
905174174 1:36125670-36125692 CCGGGGTCACAGAGGCAGGCGGG + Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905937864 1:41839172-41839194 CAGGGTCCACAGAGGAGGGAAGG + Intronic
906654689 1:47539177-47539199 CAGGGCTCCCAGCGGCAGGGAGG - Intergenic
906860814 1:49357193-49357215 GAGGACACAGAGAAGCAGGAGGG - Intronic
907119736 1:51998009-51998031 CAGGGCACACACTGTCAGCAGGG + Intergenic
908245926 1:62227760-62227782 AAGGGGACAGAGAGGCAGGCGGG - Intergenic
908582839 1:65535470-65535492 GTGGGGACACTGAGGCAGGAGGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
911164396 1:94712096-94712118 CAGGCCACACAGCGGGAGGTGGG + Intergenic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
914224362 1:145707863-145707885 CAGGGCAGAGGGAAGCAGGATGG - Intronic
914330613 1:146666877-146666899 CCAAGCACACAGAGGCAGGCAGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915586469 1:156846399-156846421 CCTGGCCCACAGAGGCTGGAAGG - Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
917027484 1:170659847-170659869 CAGGGCACCCATAGGCAAGCCGG - Intergenic
917488182 1:175474346-175474368 CAGGGCATCCAGAGGCACCAGGG + Intronic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
919530046 1:198705750-198705772 GAGTGGCCACAGAGGCAGGAAGG - Intronic
919797463 1:201329862-201329884 CAGGGGACACTGTGGCAGGGTGG + Intronic
919869665 1:201810829-201810851 AAGGGAACAATGAGGCAGGAAGG - Intronic
920306576 1:205022013-205022035 CAGGGTGCAGAGAGGCAGCAGGG + Exonic
920436547 1:205950513-205950535 CAGGGAGCTCAGAGGCAGCAGGG + Intergenic
920835840 1:209509994-209510016 CAGGTCACAGGGAGCCAGGAAGG - Intergenic
921361647 1:214335249-214335271 CAGGGCACAGCCAGGCTGGAAGG + Intronic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
922484033 1:225959402-225959424 AAGGCCACTCAGAAGCAGGAAGG - Intergenic
922551690 1:226498769-226498791 AAGAGCAAAGAGAGGCAGGAGGG + Intergenic
922591966 1:226784219-226784241 CAGGGCACATAGAGGAGAGAAGG - Intergenic
923211659 1:231808922-231808944 GAGGGCACAGAGAGTCGGGAGGG + Intronic
923296971 1:232603573-232603595 CAGGACCCACAGAGCCGGGAGGG + Intergenic
923544766 1:234916119-234916141 CAGGGCAAACAAAGTTAGGAAGG - Intergenic
924199930 1:241648063-241648085 CAGGGGACAAAGAGGTAGGCAGG - Intronic
924322744 1:242865906-242865928 CAAAGCACATAGAGGCAGGAGGG - Intergenic
1062995202 10:1859065-1859087 CAGGGCACAGAGGGGCGGGCTGG + Intergenic
1063018753 10:2104925-2104947 CAGGGCAGCCGGAGGCGGGAGGG + Intergenic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1063977916 10:11431740-11431762 CTGAGCAGACAGAGGCATGATGG + Intergenic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066488771 10:35874028-35874050 TGGGACACACAGAGGCAGAAAGG - Intergenic
1066519396 10:36198808-36198830 CAGTGGACATAGTGGCAGGAAGG - Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067082542 10:43219673-43219695 GAGGGCCTCCAGAGGCAGGAAGG + Intronic
1067808421 10:49409013-49409035 CTGGGCACAGAGAGGCAGCTGGG - Intergenic
1068952291 10:62789697-62789719 CAGGACACACAGGAGCTGGAAGG - Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069893730 10:71667752-71667774 AAGGGGACAAAGAGACAGGAGGG + Intronic
1071917450 10:90310650-90310672 GAGAGCACATGGAGGCAGGATGG + Intergenic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072735373 10:97875607-97875629 CTGGGCACAGGGAGGCAGGGAGG + Intronic
1073038172 10:100578799-100578821 CAGGCCACAAAAAGTCAGGAGGG + Intergenic
1073125338 10:101145833-101145855 CTGGGCACAGTGAGGCTGGAGGG - Intergenic
1074532055 10:114304973-114304995 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074532092 10:114305087-114305109 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532103 10:114305123-114305145 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532148 10:114305267-114305289 GAGGGCACGCGGATGCAGGAGGG + Intronic
1074532189 10:114305429-114305451 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532198 10:114305465-114305487 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532224 10:114305549-114305571 GAGGGGACACAGATGCAGGAGGG + Intronic
1074532324 10:114305906-114305928 GAGGGGACACAGGTGCAGGAGGG + Intronic
1074532351 10:114305995-114306017 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532355 10:114306013-114306035 GAGGGGACGCAGATGCAGGAGGG + Intronic
1074532358 10:114306031-114306053 GAGGGGACACAGATGCAGAAGGG + Intronic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1074916513 10:117961294-117961316 CAGTGCTCACAGTGGCAGAATGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075257770 10:120939182-120939204 CTGGTGACACTGAGGCAGGAGGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075345914 10:121681880-121681902 AAAGGCACACAGAGGCAGGATGG - Intergenic
1075443952 10:122500985-122501007 CAGGGCACACAGAGGTCAGCGGG - Intronic
1075573765 10:123563612-123563634 CAGCGACCACAGAGCCAGGAAGG - Intergenic
1075786307 10:125052511-125052533 CAGACAACACAAAGGCAGGACGG - Intronic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1076259745 10:129055886-129055908 CAGTGAACACAGCGGCAGGAGGG + Intergenic
1076462728 10:130657328-130657350 CAGGGGACACAGGGGCTGGGGGG + Intergenic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076783035 10:132734972-132734994 AAGGCCACACAGAGGCGGGCAGG + Intronic
1076838378 10:133032585-133032607 CATGGAGCACAGAGGCCGGAGGG + Intergenic
1077034706 11:489033-489055 CGGGGCACCCACAGGCAGGAGGG - Intronic
1077194009 11:1270355-1270377 AAGGACCCACAGAGGCAGGATGG - Intergenic
1077393938 11:2312052-2312074 CAGGGCAGGCAGAGCCAGGCAGG + Intronic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1078126554 11:8570702-8570724 GAGGGCCGAGAGAGGCAGGATGG + Intronic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078440303 11:11359543-11359565 CAGAGTCCACAGAGTCAGGAAGG - Intronic
1078454943 11:11467610-11467632 CAGGGCACAGACAGGCACCATGG + Intronic
1078901850 11:15649938-15649960 CTGGGGACACAGGGGCACGAGGG - Intergenic
1078926072 11:15876204-15876226 TGGGGCACACAGAGGCTGGGAGG - Intergenic
1079496034 11:21045088-21045110 CAGGGCAAGTAAAGGCAGGAGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080338334 11:31225907-31225929 CAGGAAACACAGAGCTAGGAAGG + Intronic
1080878935 11:36301322-36301344 GAGGGAACTCTGAGGCAGGACGG + Intronic
1081062894 11:38503110-38503132 CAGGTCACACATAGGCTTGAAGG + Intergenic
1081946835 11:47003357-47003379 GAGGGGACAGAGAGGAAGGAAGG + Intronic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082766113 11:57169362-57169384 CAGGTCACACTGATGCAAGAGGG + Intergenic
1082778746 11:57269752-57269774 AAAGGCAGACAGAGGCTGGAAGG - Intergenic
1083273999 11:61586835-61586857 AGGGGCCCACTGAGGCAGGAGGG - Intergenic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083683329 11:64361288-64361310 CAGAGCAGGAAGAGGCAGGAAGG - Intronic
1083871362 11:65490340-65490362 CGGGGCACTAAGAGACAGGAGGG + Intergenic
1084190417 11:67496121-67496143 GAGGGCACACACAGGAAGGGAGG - Intronic
1084275759 11:68050216-68050238 CAGGGCCCACAGGCGCAGGTAGG - Exonic
1084345356 11:68543606-68543628 CAGGGAAGACTGGGGCAGGAGGG - Intronic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1085804149 11:79619095-79619117 CAGGCCACTAAGAGTCAGGAAGG - Intergenic
1085880457 11:80462243-80462265 CAGCACACCCAGGGGCAGGAGGG + Intergenic
1086433959 11:86763346-86763368 CAGGACCCACAGAGGCACGAAGG + Intergenic
1086719323 11:90100882-90100904 CAGGGGACAGAAAGGAAGGATGG + Intergenic
1087692411 11:101336893-101336915 CAGGGAACACAGTGTCAGGATGG + Intergenic
1088341427 11:108772371-108772393 CAGGGAAGACAGAGACAGAAGGG + Intronic
1088421510 11:109653319-109653341 CTGGGCACTCAGTGGCTGGAAGG - Intergenic
1089038812 11:115426057-115426079 CAGGTGACAAGGAGGCAGGAGGG + Intronic
1089333707 11:117708082-117708104 TAGGGCACAGAGAGGGAGGCAGG - Intronic
1089462587 11:118661756-118661778 CAGGGCAGAGGGAGGCAGCAGGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089566028 11:119372315-119372337 CAGTGCACCCTGTGGCAGGAGGG - Intronic
1089619924 11:119716257-119716279 TGGGGCACACACAGCCAGGAGGG + Intronic
1089688633 11:120172484-120172506 CAGGCCACACAGGAGCAGGAGGG - Intronic
1090265502 11:125350818-125350840 CAGCGCGCACAGGGGCAGGAGGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1091196185 11:133732742-133732764 CAGGGCTCAGAGCAGCAGGAGGG - Intergenic
1091337734 11:134785212-134785234 CATGTCACACTGAGGCTGGATGG + Intergenic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1091860351 12:3776026-3776048 GAGGGCCCACAGAGACAGGCTGG + Intergenic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1094154396 12:27322750-27322772 CACAGCACACACAGGCAGAATGG - Exonic
1094490736 12:30959072-30959094 CTCGGCAGACAGAGGCAGGTAGG + Intronic
1094710451 12:32956711-32956733 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1096216118 12:49798341-49798363 CTGGGCAGAGAGAGGTAGGAGGG - Exonic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1096484610 12:51970209-51970231 CTTGGCACACAGAGCCAGCAGGG - Intronic
1096524151 12:52200707-52200729 GAGGGCAAACAGTGCCAGGAGGG + Intergenic
1096620430 12:52861210-52861232 CTGGGCACAGCCAGGCAGGAGGG + Intergenic
1097229200 12:57498884-57498906 CAGGACACAGAGAGGAAGGGAGG - Intronic
1097399713 12:59114190-59114212 GAGGGCACACTGAGGCAGTGGGG - Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1100339009 12:93660240-93660262 CATGCCACACAGAGCCAGGTGGG - Intergenic
1102204150 12:111078777-111078799 AAGGTCACTCAGAGGCAGGTGGG + Intronic
1102458566 12:113086434-113086456 CAGGTCACACAGGGTCTGGAAGG + Intronic
1102519680 12:113470686-113470708 CAGGGCCCACAGGGGTAGGGGGG + Intronic
1103041641 12:117700644-117700666 AAGCACATACAGAGGCAGGAAGG - Intronic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1104091091 12:125518364-125518386 CTAGGCCCCCAGAGGCAGGAAGG + Intronic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1105865054 13:24451691-24451713 CAGGGGCCACAGAGGCAGGCAGG + Intronic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1105993692 13:25649502-25649524 AAGGCCCCACACAGGCAGGAAGG - Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106685867 13:32057998-32058020 CAGGCCACACAGAAGCAGAAAGG + Intronic
1107711347 13:43153300-43153322 GAGGGCACACAGAGATAGGAAGG - Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109276106 13:60306208-60306230 AAGGGCACACTGATGCAAGATGG + Intergenic
1109718412 13:66246478-66246500 CAGGTCACACTGATGCAAGAGGG - Intergenic
1110260823 13:73483338-73483360 CAGGTCACAGAGAGGATGGAAGG - Intergenic
1110915368 13:81014380-81014402 AAAGGCACAGAGTGGCAGGATGG - Intergenic
1111192661 13:84830774-84830796 CAGGGCTGTCAGAGGCTGGAGGG + Intergenic
1112543655 13:100342827-100342849 CCAGGGACACTGAGGCAGGAGGG - Intronic
1112861609 13:103834152-103834174 CAGGTCACACTGATGCAAGAGGG - Intergenic
1112899951 13:104345959-104345981 TAGGGCCTACAGAGGCAGGCAGG + Intergenic
1113734443 13:112668121-112668143 CAGTGCAGACCGAGGCAGGGTGG + Intronic
1113880408 13:113622367-113622389 GCGGCCACACAGAGGCAGCAAGG - Intronic
1114651949 14:24290893-24290915 TTGGGCACACGGAGGAAGGAGGG + Exonic
1115339001 14:32272570-32272592 GAGGGCACACAGAAACAGGGTGG + Intergenic
1115827226 14:37291774-37291796 AAGGGCAAAAAGAGGCAAGAGGG + Intronic
1116199881 14:41778691-41778713 TATTGCACACAGAGGCAGAAAGG - Intronic
1116618722 14:47172183-47172205 CGGGGCCTACAGAGGCAGGCAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117098790 14:52324240-52324262 CAGGAGGCAGAGAGGCAGGAGGG + Intronic
1117275440 14:54188623-54188645 CATGGCACACAAGGGAAGGAGGG - Intergenic
1117572129 14:57058026-57058048 CAGGGCACTCAGATGCAGTTGGG - Intergenic
1118105115 14:62649985-62650007 CAGGGCACACATATGCAGAGTGG + Intergenic
1118327691 14:64792678-64792700 CAGGTCACACAGAGGAAAAATGG - Intronic
1118383935 14:65239683-65239705 CAGGGCAGACAGAGGCCAGGAGG + Intergenic
1118615150 14:67569928-67569950 CAGGGGAAACAAGGGCAGGAGGG - Exonic
1119350604 14:73961626-73961648 CAGGGCCCACAGTAGCAAGAGGG + Intronic
1119663706 14:76469037-76469059 CAGAGCACAGAAGGGCAGGAGGG - Intronic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121113873 14:91330437-91330459 CAGGACAGACAGAGGCAGACTGG + Intronic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1122154026 14:99739558-99739580 CAGGGCAGACAGAGCCAGCCTGG - Intronic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122293875 14:100694201-100694223 CAGGGCACACAGAGCGGGGGCGG + Intergenic
1122487715 14:102092606-102092628 TGGGGCAGACAGGGGCAGGAGGG + Intronic
1122622327 14:103066533-103066555 AAGGTCACACACAGGAAGGAAGG - Intergenic
1122634600 14:103124045-103124067 TTGGGCCCACTGAGGCAGGAAGG - Intronic
1122805262 14:104253282-104253304 CAGGGCACACAGTGGCCCCAGGG - Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1202852408 14_GL000225v1_random:30010-30032 AAGGGCAGAGAGAGGCTGGAGGG - Intergenic
1202863456 14_GL000225v1_random:100150-100172 AAGGGCACAGAGAGGCGAGAGGG + Intergenic
1123583680 15:21738433-21738455 CCAGGCACACAGAACCAGGAAGG - Intergenic
1123620330 15:22181036-22181058 CCAGGCACACAGAACCAGGAAGG - Intergenic
1123885907 15:24728240-24728262 AAGGGCACAATGAGTCAGGAGGG - Intergenic
1124008132 15:25810914-25810936 AAAGGCACACAAAGCCAGGACGG + Intronic
1125501630 15:40243281-40243303 CAGGGCGGGAAGAGGCAGGATGG + Intronic
1125825185 15:42670364-42670386 CAGGTGACACAGAGCCAGGTGGG - Intronic
1126065642 15:44824434-44824456 CAGAGCACACAGAGGCTGCTGGG - Intergenic
1126094193 15:45076133-45076155 CAGAGCACACAGAGGCTGCTGGG + Exonic
1127276007 15:57444753-57444775 GTGGGAACACAGAGCCAGGATGG + Intronic
1127360678 15:58242303-58242325 CGGGGCACACTGAGGCACCAAGG + Intronic
1127817354 15:62622947-62622969 CAGGGCACACAGACAGATGATGG - Intronic
1128184201 15:65630485-65630507 CAGGACCCACAGAGGCAGGGGGG - Intronic
1128380336 15:67107578-67107600 CAAGGCTCAGAGAGGCGGGAAGG - Intronic
1128412501 15:67413723-67413745 TGGGGCACACAGAGGCAGCTTGG - Intronic
1128752055 15:70156790-70156812 CAGGGCTCCCAGTGGCAAGAAGG + Intergenic
1129195216 15:73960581-73960603 CGGAGCACAAAGAGGCAAGAGGG - Intergenic
1129604452 15:77018030-77018052 CAGGGGAGATGGAGGCAGGAGGG + Intronic
1129681872 15:77662651-77662673 TAGGTCACAGAGAGGCAGGCAGG - Intronic
1129699154 15:77757682-77757704 CAGGGCAAAGAGAGCCAGCAGGG + Intronic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131341758 15:91608890-91608912 CAGGGCACAGGCAGGCAGGGAGG + Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132367168 15:101266044-101266066 TAGGACACAGAGAGGCAGGAGGG + Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132626650 16:894562-894584 CAAGGCGCAGAGAGGAAGGACGG + Intronic
1132720123 16:1311639-1311661 CAGGCCACAGAGAGGCCAGACGG - Intronic
1132761519 16:1510733-1510755 CCGGGCACCCAGAGGCAGGTGGG + Exonic
1132919584 16:2379363-2379385 CAGAGCACACAGCAGCACGAAGG - Intergenic
1133108882 16:3533716-3533738 CAGGGCACATGGAGGCAGCCTGG - Intronic
1133224226 16:4332971-4332993 AAGGGAACACTGAGGCAGGAAGG + Intronic
1133247198 16:4456877-4456899 CAGAGCACATAGAGGCAGATGGG + Intergenic
1133336211 16:5008344-5008366 TGGGGAACACAGTGGCAGGAGGG - Intronic
1133862620 16:9610422-9610444 CAGAGCTCAGAGAGGCAGGAAGG + Intergenic
1135208876 16:20507173-20507195 CAGGACACACTGATGCAAGAGGG + Intergenic
1136173509 16:28502509-28502531 CTGGGCACATGGAGGAAGGATGG - Intronic
1137036828 16:35575239-35575261 CAGGGCCCCCAGAGGAAGCAGGG + Intergenic
1138345072 16:56315706-56315728 CTGGGCCCCCAGAGGCAGGGGGG - Intronic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1139599307 16:67976975-67976997 CAAGGAACCCAGAGGCAGGGTGG - Intronic
1139730961 16:68944825-68944847 CAGGGCATACACAGACAGGGTGG + Intronic
1140002941 16:71044029-71044051 CCAAGCACACAGAGGCAGGCAGG - Intronic
1141183900 16:81773502-81773524 CATGGGACACAGAGACAGGTGGG - Intronic
1141587279 16:85042838-85042860 CGTGGCACTCAGAGGCAGGCAGG + Intronic
1141704645 16:85658181-85658203 CAGGGCAGGCAGGGGCAGGGAGG - Intronic
1141918407 16:87118028-87118050 GAGGGCACGCAGGGGCAGGTGGG + Intronic
1141983398 16:87563678-87563700 CAGGGCAGACTGAGGCTGTAGGG + Intergenic
1142103878 16:88291766-88291788 CAGGACACCCAGACGCAGGGAGG - Intergenic
1142145475 16:88491210-88491232 CAGGGGACACTGAGGCAGTCAGG - Intronic
1142277981 16:89132917-89132939 CAGGGCCCACAGAGGACGGCGGG + Intronic
1142285596 16:89170294-89170316 CACTGACCACAGAGGCAGGATGG + Intergenic
1143171468 17:4932990-4933012 CAGGGCACCAAGAGGCAGCGAGG - Exonic
1143646207 17:8231955-8231977 GGGGGCACCCAGAGGAAGGAGGG - Exonic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144770621 17:17757476-17757498 CAAGGCACACACTGGCAGGTGGG - Intronic
1144782793 17:17816321-17816343 CAGGGCACTCAGCGCCAGGTTGG + Exonic
1146461454 17:33049026-33049048 TGGGGATCACAGAGGCAGGAAGG + Intronic
1146530344 17:33603077-33603099 CATGGCACACAGAGGAAGATGGG - Intronic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1146951865 17:36912556-36912578 AAGGCCACACAGATGAAGGAGGG - Intergenic
1147139689 17:38454072-38454094 CAGGGCAGCCAGAGGCAGCGCGG - Intronic
1147844263 17:43393850-43393872 CAGGGAACACTGAGGCAGGCAGG - Intergenic
1148588221 17:48796195-48796217 GAGGGCACAGAGAGGAAGCAGGG - Intronic
1148606127 17:48930442-48930464 AAGGGCACACAGCAGCAGGCAGG - Exonic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1150306252 17:64087825-64087847 CAGGGCACAGAGAGACTGAAGGG + Intronic
1150621658 17:66812312-66812334 CCGGCCCCACAGAGGCAGCAGGG + Intergenic
1150854735 17:68741107-68741129 CAGGTCACACATAGGCTTGAGGG - Intergenic
1151802669 17:76387018-76387040 CAGGGCTGCCAGACGCAGGAAGG - Exonic
1151930515 17:77229012-77229034 CCGGTCACACAGAGGTAGGAAGG - Intergenic
1152299088 17:79485024-79485046 CAGGGCTCCCAGAGCCAGGATGG + Intronic
1152301010 17:79495397-79495419 AAGGGCACAAGGAGGTAGGAAGG + Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152592959 17:81222715-81222737 CAGGGCGCACGGAGGTTGGAGGG - Intronic
1153658265 18:7304554-7304576 CACCCCACACAGAGGCATGAGGG - Intergenic
1154038743 18:10833154-10833176 CAAGGAACACAGTGGCAGGATGG + Intronic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155901539 18:31396891-31396913 CAGGGCACACACAGCTGGGAAGG - Intronic
1156154654 18:34287550-34287572 CAGGGCACACACTGGTATGAGGG + Intergenic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157551124 18:48582505-48582527 GAGGGGACCCTGAGGCAGGAGGG - Intronic
1157596905 18:48869672-48869694 CAGGGCACTCAGGGCCAGGGAGG + Intergenic
1159011862 18:63065607-63065629 CAGGAAGCACAGAGCCAGGAAGG - Intergenic
1159284267 18:66328848-66328870 CAGTTCACATTGAGGCAGGATGG - Intergenic
1159890854 18:73951777-73951799 CAGGCCACACAGAGTCATCAGGG + Intergenic
1159913412 18:74167218-74167240 CTGGGCACACAGAGACACCAGGG + Intergenic
1160111260 18:76033987-76034009 TAGAGCACACAGAGGGAAGACGG + Intergenic
1160327865 18:77967347-77967369 CTGGGCACACAGAGTCACCAAGG + Intergenic
1160389415 18:78518860-78518882 CTGTGCCCACAGAGCCAGGATGG + Intergenic
1160740308 19:682546-682568 AGGGGCACACAGAGGCAGTGGGG - Exonic
1160854393 19:1209855-1209877 GAGGGAACACGGAGGCAGGGAGG + Intronic
1161030523 19:2056044-2056066 CACGGCCCACACAGGCAGGTGGG - Intergenic
1161275304 19:3412984-3413006 CAGTGGACACAGGGGCTGGAAGG + Intronic
1161545583 19:4878312-4878334 CAGGGAACAAAGAGGCAGCCGGG - Intergenic
1161642859 19:5435301-5435323 CTGGACCCACAGTGGCAGGAGGG - Intergenic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1162051482 19:8036532-8036554 GAGGGGACAATGAGGCAGGATGG + Intronic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1162651471 19:12092106-12092128 CAGGGCACAGGGAGGGAGGTGGG + Intergenic
1162680114 19:12334058-12334080 CAGGCCACACTGCAGCAGGAGGG + Intergenic
1162795100 19:13082905-13082927 CAGAGCACACCAAGGCAGCACGG - Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163648609 19:18504185-18504207 GACGGCACAGAGAGGCTGGAGGG + Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1164604671 19:29589222-29589244 CCTGGTACACAGAGCCAGGATGG - Intergenic
1164711284 19:30358891-30358913 CAGGTCACACAGTGACAGGGTGG - Intronic
1164976932 19:32580756-32580778 CGGTGCACACAGAGGCCGGCCGG - Intergenic
1165357227 19:35311733-35311755 CAGGGGCCACAGAGGTGGGAAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165753978 19:38280953-38280975 CAGGGCTCACTGTGGCAGGGCGG + Intronic
1165952106 19:39480274-39480296 AAGGGAACTCAGAGGCTGGAGGG + Intergenic
1166178202 19:41089285-41089307 CGGGGCAGAGAGAGGCAGGGAGG - Intronic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1167072475 19:47228703-47228725 CAGGGCTCACACAGGACGGATGG + Intronic
1167723124 19:51192525-51192547 CAAGACACACATAGGGAGGAAGG + Intergenic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1167761084 19:51449737-51449759 CAAGACACACATAGGGAGGAAGG - Intergenic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925204709 2:1996251-1996273 CAGTCCACACTGAGGCAGGGCGG - Intronic
925204722 2:1996320-1996342 CAGCCCACACTGAGGCAAGACGG - Intronic
925204733 2:1996389-1996411 CAGTCCACACTGAGGCAAGACGG - Intronic
925204758 2:1996527-1996549 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204771 2:1996596-1996618 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204812 2:1996799-1996821 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204863 2:1997071-1997093 CAGCCCACACTGAGGCAGGGCGG - Intronic
925211658 2:2053484-2053506 CAGAGCCCACAGTGGCAGCAAGG + Intronic
925542324 2:4979303-4979325 CTGGGCTCAGAGAAGCAGGAAGG - Intergenic
926038530 2:9654440-9654462 CACAGCACACAGAGGCAGCTAGG - Intergenic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
926905985 2:17806072-17806094 CAGGGTGCACAGAGCCAGCAGGG + Intergenic
927517847 2:23682464-23682486 AAATCCACACAGAGGCAGGATGG - Intronic
927699980 2:25261841-25261863 GAGGGGACGCACAGGCAGGAGGG - Intronic
927740941 2:25569093-25569115 CAGGGCATTCAGACACAGGAGGG + Intronic
927757602 2:25721791-25721813 CAGGGCACACATGTGCAGCAGGG + Intergenic
927872711 2:26633774-26633796 CACAGCCCAGAGAGGCAGGAGGG + Intronic
928173428 2:29017996-29018018 CAGGGCATCCTGAGGCAGCATGG - Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930519342 2:52444407-52444429 GTGGGAACACTGAGGCAGGAGGG - Intergenic
931212254 2:60208354-60208376 CAGTGGAGACAGAGGCAGGTTGG - Intergenic
931812900 2:65872382-65872404 AAGGGGACAAAGAGGAAGGAGGG + Intergenic
932599030 2:73111750-73111772 CAGGACACAGAGGGACAGGATGG + Intronic
932607849 2:73176441-73176463 CAGGGCCCCCAGAGGTCGGAAGG + Intergenic
932833617 2:75013577-75013599 CTGGGCACTGACAGGCAGGAGGG + Intergenic
933730920 2:85455805-85455827 CAGGGGACAGACAAGCAGGAAGG + Intergenic
934513139 2:94964348-94964370 CAGGGGACACAGAATCACGATGG - Intergenic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
935171405 2:100613619-100613641 GAAGGCACAGAGAGGCAGAAGGG - Intergenic
935337372 2:102029192-102029214 GAGGGGACAGAGAGGAAGGAAGG - Intergenic
935515905 2:104038341-104038363 TGGGGCACAGAGAGGCAAGATGG - Intergenic
935795277 2:106634917-106634939 CAGACCACACACAGGGAGGAAGG + Intergenic
936108805 2:109648234-109648256 CAGAGAACTCAAAGGCAGGAAGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936929324 2:117771016-117771038 CAAGACACACAGAGACAGAAAGG + Intergenic
936994494 2:118398856-118398878 CAGGTCACACTGAGGCAAGGTGG - Intergenic
937263388 2:120600780-120600802 AAGGGCACAGACAGCCAGGAAGG - Intergenic
937384333 2:121413863-121413885 CTGGGGACAGAGTGGCAGGAAGG + Intronic
937854301 2:126661312-126661334 CAGGGACCACAGAGCCAGGCAGG - Intronic
938181606 2:129189747-129189769 CAGGGAAGACTGTGGCAGGAAGG + Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
939237091 2:139508733-139508755 CAAGGCATACAGAGGAGGGAGGG + Intergenic
939487413 2:142832152-142832174 CAAGGTACAGAGGGGCAGGAGGG + Intergenic
940073657 2:149717427-149717449 TAGGGCACAGATAGGCAAGAGGG - Intergenic
940904938 2:159160715-159160737 CAGGGTTCTCAGAGGCAGGGAGG - Intronic
942191957 2:173479093-173479115 CAGGACACACAGAGCCTGGTAGG - Intergenic
942218968 2:173750602-173750624 CAGGGCATAGAGAGGAAAGAGGG + Intergenic
943712445 2:191111975-191111997 CAGAGCACGGAGAGGTAGGAGGG + Intronic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944503031 2:200381407-200381429 CAGGCCACACTGTGGCACGAGGG - Intronic
944619386 2:201498447-201498469 CAAAGCAGACAGAGGAAGGAGGG - Intronic
944619990 2:201504652-201504674 GAGGGCACAGTGAGTCAGGAGGG - Intronic
944674303 2:202022346-202022368 GAGAGCACATGGAGGCAGGAAGG + Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946023351 2:216656941-216656963 TTGTGCCCACAGAGGCAGGAAGG - Intronic
946083605 2:217149392-217149414 CAGAGCACACAGAGGCTCCAGGG + Intergenic
946203898 2:218089664-218089686 CTGTGCTCACAGAGGAAGGAGGG - Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
947583229 2:231334766-231334788 CCCGGCACACAGAGGCTGGCAGG - Intronic
947633226 2:231666757-231666779 CAGGGGACAAAGAGCCAGGTGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947876640 2:233471881-233471903 CTGTGCAGAGAGAGGCAGGAAGG + Exonic
948708296 2:239809471-239809493 CAGCGCCCACACAGGGAGGAGGG - Intergenic
948732844 2:239978063-239978085 CAGGGATCCCAGAGGCAGGGAGG - Intronic
948732858 2:239978120-239978142 CAGGGATCCCAGAGGCAGGGGGG - Intronic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
948853883 2:240721204-240721226 CAGGGGCCACAGGGGCTGGAGGG - Intronic
948894535 2:240922080-240922102 TCAGGCACACAGGGGCAGGATGG - Intronic
1168989214 20:2079893-2079915 TATAGCAAACAGAGGCAGGATGG + Intergenic
1169458149 20:5770872-5770894 CATGGCAAACAGATTCAGGATGG + Intronic
1169592908 20:7164466-7164488 CAGGTCACACTGATGCAAGAAGG - Intergenic
1169791427 20:9414336-9414358 CATGGAACACAGAGGCATGCAGG - Intronic
1171276520 20:23860741-23860763 AAGGGAACTCAGAGGCTGGAGGG - Intergenic
1171392841 20:24812181-24812203 TAGGGCAGACAGTGTCAGGAGGG - Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172274882 20:33674067-33674089 CAGGTCACACAAGGGCAGAAAGG + Intronic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1172837520 20:37882568-37882590 CCGGGGACACAGAGTCAGGAGGG + Intergenic
1172837981 20:37885199-37885221 CAGGTCACACACAGGAAGGCTGG - Intergenic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1173428670 20:42966387-42966409 GAGGGAACACAGAGGAAAGAGGG - Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174197813 20:48785936-48785958 CAGGGCAGAAAGAGCCGGGATGG + Intronic
1174435542 20:50503979-50504001 CTGGGTACACATAGCCAGGAAGG - Intergenic
1174517086 20:51100978-51101000 CAAGGCACAAAGAGGCACAAAGG - Intergenic
1174725698 20:52859563-52859585 CAGGGCACATTAAAGCAGGAGGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175220043 20:57411647-57411669 CAGTGCACAGGCAGGCAGGAAGG + Intergenic
1175370178 20:58483059-58483081 CAAGGCACACATAGGCAGTGGGG - Intronic
1175408633 20:58751775-58751797 CAGGGCACCGAGATCCAGGAAGG + Intergenic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176165004 20:63668151-63668173 CCGGGCACACACTGGGAGGAGGG - Intronic
1176179768 20:63743803-63743825 ACGGCCACAGAGAGGCAGGACGG + Exonic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1177911379 21:27037172-27037194 TAGGGGACACAGAGACAGGGTGG - Intergenic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179086221 21:38220196-38220218 GAGGGCACAGGGAGGGAGGAGGG + Intronic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1179451573 21:41472066-41472088 CAAGACACCCAGAGGCAGGATGG + Intronic
1180015820 21:45082938-45082960 CAGGGCTCTGAGTGGCAGGAAGG - Intronic
1180048060 21:45318749-45318771 CAGGGCAGGAAGGGGCAGGATGG - Intergenic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181079399 22:20403912-20403934 CAAGACACGCAGAGGCAGGAAGG - Intronic
1181273287 22:21673328-21673350 CAGGGCACAGGCAGGCAGCAGGG - Intronic
1181443212 22:22949284-22949306 CAGGGCAACCAGGGGCAGGGTGG + Intergenic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1182292255 22:29289475-29289497 AAGGGCAGGCAGAGGCAGCAGGG - Intronic
1182446710 22:30393890-30393912 CAGCTCTCACAGAGGCAGGAGGG + Intronic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1182869346 22:33632589-33632611 GAGGCAACACAGAGGCAGGAAGG - Intronic
1183103397 22:35597985-35598007 CAGGGCACCCACAGGATGGAAGG + Intergenic
1183228568 22:36566544-36566566 TGAGGCACACAGAGGCAGGTGGG + Intronic
1183484662 22:38082527-38082549 CAGGGTTCCCACAGGCAGGAAGG + Intronic
1183698484 22:39436710-39436732 CAGTGGACACAGATGCATGAGGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184054503 22:42035362-42035384 CAGGGCCCAGAGGGGCAGGTGGG - Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184148410 22:42624652-42624674 CAGGTCACACAGGGACAGAAGGG + Intronic
1184209923 22:43029385-43029407 GAGGGCACTCAGAGGCAGAAAGG + Intergenic
1184317104 22:43702985-43703007 AAGGACCCACATAGGCAGGAAGG + Intronic
1184400405 22:44270620-44270642 GTGGTCTCACAGAGGCAGGATGG - Intronic
1184478306 22:44733476-44733498 CAGGGCAACCAGAGCAAGGAAGG + Intronic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184605808 22:45574268-45574290 CAGGGCACATGGAAGCTGGAGGG + Intronic
1184810570 22:46828734-46828756 CAGTCCAAACAGAGACAGGAGGG - Intronic
1184818579 22:46891377-46891399 CAGGACACATACAGGCAGGTGGG + Exonic
1184920340 22:47601108-47601130 CGGGGTACACAGAGGCTGGGAGG - Intergenic
1184947122 22:47811378-47811400 CAGCACACACAGAAGCAGGCAGG - Intergenic
1185008396 22:48299325-48299347 CAGGTCACAGCCAGGCAGGAAGG + Intergenic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
1185133740 22:49056589-49056611 CAGGGCTCACAGAGGTTGCAGGG + Intergenic
949483648 3:4517251-4517273 AAAGGCAGACAGAGGCAGAATGG + Intronic
950077393 3:10196687-10196709 CAGGCAGCACTGAGGCAGGAAGG - Intronic
950494309 3:13324485-13324507 AGGGGCACACAGAGGTAGGTAGG - Intronic
950847726 3:16031163-16031185 CAGGGGACACAGAGTCAAGTAGG - Intergenic
951072559 3:18349419-18349441 CTGGGCAGACAGAGTCTGGATGG + Exonic
951543821 3:23806600-23806622 CAGGGCGGCCAGAGGCAGGCAGG + Intronic
951742404 3:25939070-25939092 CATGGCACACAGAAGCCAGATGG - Intergenic
952496334 3:33919052-33919074 CAGGTCACACAGATTCAGGCTGG - Intergenic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953226596 3:41027185-41027207 GACAGCACAAAGAGGCAGGAAGG + Intergenic
953784046 3:45897098-45897120 CAGGACACAGACAGGCAGGATGG + Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
954335185 3:49912132-49912154 CATGGCAGACAGTGGCAGAAGGG - Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954577765 3:51686213-51686235 CTGGTCCCACAGAGGCAGGGAGG - Intronic
954613022 3:51956164-51956186 CAGGGCCCAGAGCGGCCGGAAGG - Exonic
954637445 3:52078923-52078945 GGTGGCACACACAGGCAGGAGGG + Intronic
955237280 3:57150464-57150486 CATGGCACAAAGAGCCAGGAAGG - Intronic
955570131 3:60295830-60295852 CTGGGCATACATAGGAAGGAGGG + Intronic
957232315 3:77536220-77536242 CAGGCCACAAAGAAGCAGGTGGG + Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
961016172 3:123469972-123469994 CAGGGCCCACAGGGGCAGGGAGG + Intergenic
961137858 3:124528525-124528547 GAGGGCACACTGAGGCAGTTGGG - Intronic
961253697 3:125527602-125527624 CAGGGCCCAGAGAGTAAGGAAGG - Intergenic
961356463 3:126343039-126343061 CAGGGCAGACAGAGCCAGAAGGG - Exonic
961448991 3:126993985-126994007 CAAGGCTCAGAGAGGCTGGACGG - Intronic
961555544 3:127694545-127694567 CAGGGCACACAGGTGCTGGCAGG - Intronic
962321726 3:134396161-134396183 CAGGAGACAAAGAGACAGGAAGG - Intergenic
962855358 3:139340179-139340201 AAAGGGACAGAGAGGCAGGAAGG + Intronic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
965784901 3:172325098-172325120 CTGGTCACACACAGGCAGCAGGG - Intronic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966734922 3:183180619-183180641 CACTGCAGAGAGAGGCAGGATGG - Intronic
966912968 3:184569477-184569499 CGGGGCCCACAGAGACAGGCGGG - Intronic
967896021 3:194396888-194396910 CAGGGCCCAGAGCGGCAGGCCGG + Exonic
968130140 3:196188441-196188463 CAGGGCACCCAGGGGCAAGGAGG + Intergenic
968474845 4:799380-799402 CTGGGCACATGGAGGCTGGAAGG + Intronic
968664007 4:1810864-1810886 CAGGCCACGCTGAGGCAGGTAGG + Intergenic
968762252 4:2448798-2448820 CAGGACACATTGAGGCAGGCTGG + Intronic
968908113 4:3463751-3463773 CAGGGCAGACTGAGGCCCGAGGG + Intronic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969624538 4:8295597-8295619 CAGGAGACACAATGGCAGGAGGG - Intronic
969636674 4:8373561-8373583 CTGGGAACACAAAGCCAGGACGG + Exonic
969706455 4:8794815-8794837 CAGGTCACACAGAGCCAAGCAGG - Intergenic
970640195 4:18055701-18055723 CTGGGAACACAGGGGCAAGATGG + Intergenic
970719838 4:18973540-18973562 CAGAGCACACAAAGCCAGGGAGG - Intergenic
970897878 4:21124508-21124530 GAGGGCAGACAGAGCAAGGAAGG - Intronic
971336448 4:25727906-25727928 GAGGGCCCACAGAATCAGGAAGG - Intergenic
971377904 4:26069802-26069824 CTGGGCACAGAAAGGCAGAAAGG - Intergenic
972365120 4:38367418-38367440 CAGGCCACACGCAGCCAGGATGG - Intergenic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
973899851 4:55457709-55457731 TCAGGGACACAGAGGCAGGATGG - Intronic
974771045 4:66414064-66414086 CAGGAAACACAGATGCTGGAGGG + Intergenic
975350374 4:73339333-73339355 CAGGTCACACTGATGCAAGAGGG + Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975489593 4:74974136-74974158 GAGCACACACAGAGGAAGGAGGG - Intronic
976072218 4:81254453-81254475 CTGGGTACACAGGGACAGGAAGG - Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976259823 4:83135172-83135194 CAGGTCACACTGATGCAAGACGG + Intronic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977971628 4:103219280-103219302 CAGAGCATAGAGAGGCAGCATGG + Intergenic
979215506 4:118159135-118159157 CAGGGGACAGAGGGGCAGAAGGG + Intronic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
979794035 4:124822079-124822101 TAAGGCACACACAGGCTGGAAGG - Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980967714 4:139539179-139539201 AAGGGAACACAGTGGAAGGAAGG - Intronic
981108704 4:140910940-140910962 ATGGGCACACAGAGCCAGGTGGG + Intronic
985371788 4:189292704-189292726 CAGGCCACACTGATGCAAGAGGG - Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985835675 5:2270229-2270251 GAGGGCAGGCAGAGGCAGGGTGG + Intergenic
986569929 5:9154358-9154380 CAGGACTCTCAGAGGCATGAAGG + Intronic
989182770 5:38595210-38595232 CATGGGACACAAAGCCAGGAAGG + Intronic
989948961 5:50274340-50274362 TAGGGCATTCAGAGGCAAGAAGG + Intergenic
991967937 5:72109623-72109645 GGGGGCCCAGAGAGGCAGGAAGG + Intronic
993733944 5:91453394-91453416 CAGGCCACACAGAGACAGGGAGG - Intergenic
996536727 5:124585435-124585457 CAGGTCACACACAGGCTTGAAGG + Intergenic
996982818 5:129520158-129520180 CAGGAGACTTAGAGGCAGGAAGG - Intronic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997395587 5:133557416-133557438 TAAGGGACACAGAAGCAGGAAGG - Intronic
997628413 5:135347492-135347514 CAGGACAGGTAGAGGCAGGAGGG - Intronic
997837828 5:137210704-137210726 CAAGGCACACAGGGGCAGCTGGG + Intronic
997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG + Intronic
999262126 5:150244766-150244788 CAGCCCACACATAGGCAGGACGG + Intronic
1000343285 5:160294204-160294226 CGGGGCAGAGAGAGGAAGGAGGG - Intronic
1000751681 5:165102844-165102866 CCTGGAACACAGAGGCAGGGGGG - Intergenic
1000858435 5:166428881-166428903 CAAGGGACAAAGAGTCAGGAGGG + Intergenic
1001257666 5:170196782-170196804 CACGGCACACACAGGCAGCGAGG + Intergenic
1001408695 5:171495263-171495285 CATGCCCCACAGAGGAAGGAAGG + Intergenic
1001412880 5:171523355-171523377 CTGGGCACACAAAGGAAGTAGGG - Intergenic
1001912810 5:175534857-175534879 CAGTGCCCACAGAAGCAGCATGG + Intergenic
1002049313 5:176560980-176561002 TAGGGCACACTGGGGGAGGAGGG + Intronic
1002189106 5:177469679-177469701 CAGGGCACACAAAGCTAGGGAGG - Intronic
1002342672 5:178527151-178527173 CAGGGCTCAGGGAGGCAGCAAGG + Intronic
1002419087 5:179136199-179136221 TAGGAGACACAGAGACAGGAAGG - Intronic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1002994293 6:2268476-2268498 CATGGGACACAGAGCCAGGAGGG + Intergenic
1003724365 6:8743507-8743529 CAGTTCACACAGAGACAGCAAGG - Intergenic
1004252536 6:14034008-14034030 CAGGGCAGACAGAGACAATATGG - Intergenic
1004766065 6:18728410-18728432 AATGGCACAGAGTGGCAGGATGG + Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005290946 6:24378273-24378295 CATGGCACACAGAAGCGGGAGGG - Intergenic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1006294508 6:33164168-33164190 CAGGGCACCCAGGGGGAGCAGGG - Intronic
1006535496 6:34696228-34696250 TAGGGACCACGGAGGCAGGAGGG - Intronic
1006591294 6:35159935-35159957 TAGGCCTCACAGAGGAAGGAAGG - Intergenic
1007185983 6:39972615-39972637 CAGATCACACTGATGCAGGAGGG - Intergenic
1007360425 6:41351581-41351603 GAGGGCACACAGTCCCAGGAAGG + Intergenic
1007731713 6:43951491-43951513 CAGTGCAGCCAGAGACAGGAGGG + Intergenic
1007833862 6:44659296-44659318 CTGGGCACACAGTGGCGGCAAGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008167025 6:48151185-48151207 CAGAGCACAGAGAGGAAGCATGG + Intergenic
1008796695 6:55311718-55311740 TAGAGCCCACAGAGGCAGGCAGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1010834118 6:80565940-80565962 CAGGGTACAAAGGGGCAGTAGGG - Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011057431 6:83220395-83220417 CAGACCACACAGGGCCAGGAGGG + Intronic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011907280 6:92387450-92387472 CATGGCAGCCTGAGGCAGGAAGG + Intergenic
1013928665 6:115503165-115503187 CAAGGCACACTGATGCAAGAGGG - Intergenic
1016505994 6:144779615-144779637 CAGGGGTAACAGAGGCAGAAAGG + Intronic
1017103142 6:150865886-150865908 CAGGGCACACGGAGGCGGCGCGG - Exonic
1017246192 6:152228341-152228363 CAGGTCAGACAGTGTCAGGAGGG - Intronic
1017747743 6:157461794-157461816 CAGTGCACCCAGCGGCTGGATGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018581898 6:165315142-165315164 GAGAGAACAGAGAGGCAGGAGGG - Intergenic
1018899022 6:168041999-168042021 GGGAGCAAACAGAGGCAGGAAGG + Exonic
1018952656 6:168389232-168389254 GAGGGCAGGCAGAGGCATGAAGG - Intergenic
1018977433 6:168575976-168575998 CATGAGACACAGAGGCAGGGTGG + Intronic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019401877 7:859451-859473 CAGAGGCCACACAGGCAGGAGGG + Intronic
1019406570 7:887162-887184 CAGAGCACAGCGAGGAAGGAAGG - Intronic
1019611843 7:1940678-1940700 CAGGGCACACAAGGCCAGCATGG + Intronic
1019714711 7:2533277-2533299 CAGGACACACAGGAGCAGGTGGG + Intergenic
1019731004 7:2629673-2629695 CAGGGTACACACATGCAGGCAGG - Intergenic
1019741608 7:2677776-2677798 CAGGACACACAGGAGCAGGTGGG - Intergenic
1020982680 7:15091217-15091239 CTTAGCAAACAGAGGCAGGAAGG + Intergenic
1021299165 7:18950223-18950245 CAGGGCAAGTAGAGGCAGAATGG - Intronic
1021413447 7:20354689-20354711 CCAGGCAGAAAGAGGCAGGATGG + Intronic
1021642835 7:22756632-22756654 CAGGGCACACAGCACCAAGAAGG + Intergenic
1022108075 7:27210936-27210958 CAGGCCTGACAGAGGCAGGAGGG - Intergenic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1023018292 7:35987161-35987183 CATGGCAAAAAGAGGCAGAACGG + Intergenic
1023418407 7:39951863-39951885 CAAGGCACACACAGGCAGAACGG - Intronic
1023905286 7:44517367-44517389 CATGGCACACAGAAGATGGAAGG + Intronic
1023965994 7:44963272-44963294 CAGGGCCCCGAGAGGGAGGAGGG - Intronic
1024044772 7:45579240-45579262 CAGGGCACACAAAGGCATACGGG - Intronic
1024209666 7:47192510-47192532 CAAGGTACAGTGAGGCAGGATGG - Intergenic
1024283467 7:47737820-47737842 CAGGGCAGACAGTGGCAACAGGG + Intronic
1024292122 7:47812280-47812302 CAGGGGACCCTCAGGCAGGAGGG + Intronic
1024292999 7:47819203-47819225 CAGAGCACCCAGAGGCAGTGAGG + Intronic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024929776 7:54657868-54657890 AAGGGCACAAAGAGCCAGGAGGG - Intergenic
1026529557 7:71185154-71185176 GAGGGGACAGAGAGGAAGGAAGG - Intronic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1026981460 7:74529151-74529173 GGGAGCACACAGAGGCATGAAGG + Intronic
1027232351 7:76280367-76280389 CACGGCACACAGATGGGGGAGGG - Intronic
1028577024 7:92363475-92363497 CAGGGCATGCAGAGGCTAGAGGG + Intronic
1029097947 7:98104113-98104135 CAGGACAGACACTGGCAGGAGGG + Intergenic
1030112775 7:106040801-106040823 CAGAGGTCACAGAGCCAGGATGG + Intergenic
1030361515 7:108599979-108600001 CGGGGCTCAGAGAGGTAGGATGG + Intergenic
1030505553 7:110417356-110417378 CAAGGAACTCAGAGTCAGGAGGG - Intergenic
1030847252 7:114435366-114435388 AAGGGTACACAAAGACAGGAAGG + Intronic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1033150893 7:138914073-138914095 CGGGGGAAACAGAGGCAGAATGG + Intronic
1033573438 7:142656717-142656739 CATGGCATGAAGAGGCAGGATGG - Intergenic
1033753860 7:144381075-144381097 CAGGGCACAGAGACACAGAAGGG - Intergenic
1033767948 7:144515199-144515221 CTGGGCACACAGAGAAAGAAAGG + Intronic
1034381921 7:150704245-150704267 AAGGACACACAGAGGCTGAAAGG + Intergenic
1034451835 7:151141365-151141387 CATGGCATAGACAGGCAGGAAGG - Intronic
1034674498 7:152882838-152882860 ATGGGCACACAGAGGCAAGACGG - Intergenic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034998777 7:155594981-155595003 GAAATCACACAGAGGCAGGAGGG + Intergenic
1035585060 8:766387-766409 CAGCTCACATAGAGGAAGGATGG - Intergenic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1036428910 8:8671471-8671493 CTGGGAACACAGGGGCAAGAGGG + Intergenic
1036458939 8:8934787-8934809 CTTGGGACACTGAGGCAGGAGGG + Intergenic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1037611722 8:20481534-20481556 AAGGGGACACAGAGGCACAAAGG - Intergenic
1038358547 8:26854557-26854579 CAGGGCACAGAGAGCCTGGTGGG - Intronic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039836528 8:41260608-41260630 CAAGGGACACAGAGGTAGGCTGG - Intergenic
1040915274 8:52562557-52562579 CAGGAAACCCTGAGGCAGGAGGG - Intronic
1040947329 8:52897271-52897293 CATGGCAGAAAGAGGCAGGGGGG + Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041977388 8:63815748-63815770 CAGGGACCACAGAGCCAGCATGG - Intergenic
1042786332 8:72550900-72550922 CAGGGCTGACAGAGACAGGCAGG + Intronic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1045461055 8:102426210-102426232 CAGGGCAACCAATGGCAGGAAGG - Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048093163 8:131262621-131262643 TGGAGCCCACAGAGGCAGGAAGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048387327 8:133924371-133924393 AAGGGCACAGAAAGGCAGCAAGG - Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049048882 8:140175705-140175727 CAGCACACAGAGAGGCTGGATGG - Intronic
1049635924 8:143689413-143689435 CAGGACCCACTGTGGCAGGAGGG + Intronic
1049673777 8:143880791-143880813 CAGGGCAGATGCAGGCAGGATGG + Intergenic
1049806707 8:144544284-144544306 GTGGGCACACAGAGGCAGGGTGG - Intronic
1050062449 9:1724133-1724155 CAGGGCAAACAGAGGTATCAGGG - Intergenic
1050562920 9:6852981-6853003 CAAGGCACACACAGGCAAGCTGG - Intronic
1050581439 9:7061629-7061651 CAGAGCCCAATGAGGCAGGAGGG + Intronic
1051175137 9:14353026-14353048 GAGGGCACACAGAGGCAAGCTGG + Intronic
1051617120 9:19016941-19016963 CAGGCCTCACAGAGGAAGGTGGG - Intronic
1052016646 9:23476079-23476101 CCAGGAACCCAGAGGCAGGAAGG - Intergenic
1052829332 9:33202356-33202378 CAGGGCAGACAGAGCAAGGGTGG + Intergenic
1053119916 9:35538779-35538801 AAGGGCCCACAGGGGCTGGAAGG + Exonic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056408387 9:86299062-86299084 CAGGTCAGCCAGAGGAAGGAGGG + Intronic
1057147907 9:92770769-92770791 CAGGGAACAGTGAGGAAGGAGGG - Intergenic
1057164694 9:92916436-92916458 CAGGGCTCAGACAAGCAGGAGGG + Intergenic
1057227877 9:93302042-93302064 CCAGGGGCACAGAGGCAGGAGGG - Intronic
1057287821 9:93774543-93774565 GCGGGCACACAGAGCCAAGAGGG + Intergenic
1057485848 9:95483531-95483553 CAGGGCGCTGAGAGACAGGAAGG - Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058528864 9:105886365-105886387 CAGGAGACACAGAGGCAGTTGGG - Intergenic
1059161869 9:112042092-112042114 CAGGGGACACACAGGCATGTTGG - Exonic
1059421535 9:114195505-114195527 CAGGCCACACAGGAGCAGGAGGG - Intronic
1059561628 9:115340410-115340432 CAGAGGACACAGAGCCAGGCAGG + Intronic
1059663066 9:116420477-116420499 CAGGGCCCACAGAGGGTGAACGG + Intergenic
1059756315 9:117296939-117296961 CAGTGGCCACCGAGGCAGGATGG - Intronic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1060434211 9:123579750-123579772 CAGGGGACACAAAGACAGGCAGG + Intronic
1060816590 9:126638410-126638432 CAGGGCAGCCAGTGGCAGCAGGG - Intronic
1060903064 9:127278761-127278783 CACGGCCCTCAGAGGGAGGATGG - Intronic
1060932206 9:127496258-127496280 CAGGGCACACACAGGCGGCTGGG - Intronic
1061022069 9:128022423-128022445 CAGGACAGAAAGAGGCAAGAGGG + Intergenic
1061389875 9:130311552-130311574 CAGGGCACCGAGTGGCTGGAAGG + Intronic
1061626833 9:131845482-131845504 CGGGGAACACAGTGGCAGGGAGG + Intergenic
1061848276 9:133400326-133400348 CAGGGCCCCCAGAGGCTGGTAGG - Intronic
1061848797 9:133402807-133402829 CAAGGACAACAGAGGCAGGAAGG + Intronic
1061880808 9:133568003-133568025 CAGGGCACGAAGGGGCAGGAAGG + Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1062398599 9:136362723-136362745 GAGGGCAGGCAGAGGCAGGGAGG + Intronic
1062447275 9:136600225-136600247 CAGAGCAGACAGAGGCTGGGAGG - Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1203740875 Un_GL000216v2:175862-175884 AAGGGCACAGAGAGGCGAGAGGG - Intergenic
1185822912 X:3221846-3221868 CAGGACACTCTGAGGCAGGGGGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186522758 X:10220663-10220685 AACGCCAGACAGAGGCAGGAGGG + Exonic
1187285332 X:17898762-17898784 CATCACACGCAGAGGCAGGAAGG - Intergenic
1188276478 X:28207292-28207314 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1190466216 X:50727047-50727069 CAGGGCATAGTGATGCAGGAGGG - Intronic
1191783704 X:64895018-64895040 CTGGGCACACAGGTGCAGTAAGG + Intergenic
1191791284 X:64975213-64975235 CCTGGCACACAGGGGCGGGAAGG + Intronic
1192202031 X:69072582-69072604 CAGGACACACAAAGGCTGGCTGG + Intergenic
1193195971 X:78631840-78631862 CAGGGCACACTGATGCAAAAGGG - Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1194739549 X:97556604-97556626 GAGGGCACACAGAGGTAAGAAGG - Intronic
1195931100 X:110077407-110077429 AAGGGCACAGAGTGGCAAGATGG - Intronic
1197013377 X:121594132-121594154 CAGGTCACACATAGGCTTGAAGG + Intergenic
1197702233 X:129608088-129608110 TGGGGCACACAGTGTCAGGAGGG - Intergenic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1198019900 X:132647325-132647347 GAGGGGACATAGAGGCTGGAGGG - Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201794344 Y:17878678-17878700 GAGATCACAAAGAGGCAGGATGG + Exonic
1201807210 Y:18027307-18027329 GAGATCACAAAGAGGCAGGATGG - Exonic
1202355724 Y:24046477-24046499 GAGATCACAAAGAGGCAGGATGG + Exonic
1202515054 Y:25623632-25623654 GAGATCACAAAGAGGCAGGATGG - Exonic