ID: 903575136

View in Genome Browser
Species Human (GRCh38)
Location 1:24335178-24335200
Sequence CTGTGGGTCTTCAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 1, 2: 8, 3: 70, 4: 476}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903575136_903575152 10 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575152 1:24335211-24335233 AGGGAGACCTGTGTTGGGGGAGG 0: 2
1: 0
2: 4
3: 42
4: 430
903575136_903575156 25 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575156 1:24335226-24335248 GGGGGAGGGAGACCTGTGTTGGG 0: 1
1: 2
2: 5
3: 49
4: 348
903575136_903575153 11 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575153 1:24335212-24335234 GGGAGACCTGTGTTGGGGGAGGG 0: 2
1: 1
2: 3
3: 30
4: 445
903575136_903575144 -9 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575144 1:24335192-24335214 GACCCACAGCCTCTGGGAGAGGG 0: 1
1: 0
2: 6
3: 42
4: 319
903575136_903575143 -10 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575143 1:24335191-24335213 AGACCCACAGCCTCTGGGAGAGG 0: 1
1: 1
2: 3
3: 40
4: 337
903575136_903575149 5 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575149 1:24335206-24335228 GGGAGAGGGAGACCTGTGTTGGG 0: 1
1: 1
2: 3
3: 36
4: 319
903575136_903575151 7 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575151 1:24335208-24335230 GAGAGGGAGACCTGTGTTGGGGG 0: 1
1: 1
2: 3
3: 35
4: 371
903575136_903575155 24 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575155 1:24335225-24335247 TGGGGGAGGGAGACCTGTGTTGG 0: 1
1: 1
2: 4
3: 31
4: 386
903575136_903575157 26 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575157 1:24335227-24335249 GGGGAGGGAGACCTGTGTTGGGG 0: 1
1: 1
2: 3
3: 43
4: 331
903575136_903575159 30 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575159 1:24335231-24335253 AGGGAGACCTGTGTTGGGGGAGG 0: 2
1: 0
2: 4
3: 42
4: 430
903575136_903575158 27 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575158 1:24335228-24335250 GGGAGGGAGACCTGTGTTGGGGG 0: 1
1: 1
2: 4
3: 46
4: 405
903575136_903575150 6 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575150 1:24335207-24335229 GGAGAGGGAGACCTGTGTTGGGG 0: 1
1: 1
2: 1
3: 31
4: 358
903575136_903575148 4 Left 903575136 1:24335178-24335200 CCCTCTCCCCTGAAGACCCACAG 0: 1
1: 1
2: 8
3: 70
4: 476
Right 903575148 1:24335205-24335227 TGGGAGAGGGAGACCTGTGTTGG 0: 1
1: 1
2: 2
3: 27
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903575136 Original CRISPR CTGTGGGTCTTCAGGGGAGA GGG (reversed) Intronic
900630760 1:3633962-3633984 CTGGGGCTCTTCAGGGGCGTAGG - Intronic
900751549 1:4401029-4401051 CTGTGGCTCTTCAGGCTTGAGGG + Intergenic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
902502952 1:16922627-16922649 GAGAGGGTCTTCAGGGGACATGG - Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
903137506 1:21318982-21319004 CTGTGGGTTTTCAGTGGAGCTGG + Intronic
903273194 1:22204916-22204938 CCCTGGGTCTTCGGGGGAGAAGG - Intergenic
903283861 1:22265090-22265112 CAGTGGGACTTCCTGGGAGAAGG + Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
904417552 1:30372556-30372578 CTGGGGGGCTTCAGGGATGAAGG + Intergenic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
905797467 1:40823727-40823749 CTCTGGATTTTAAGGGGAGATGG - Intronic
906075596 1:43049638-43049660 CAGAGGCTCTTCTGGGGAGAAGG + Intergenic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907385479 1:54122752-54122774 CAGAGGGTCTGCAGAGGAGAGGG - Intergenic
907750582 1:57259264-57259286 CTGTGAGTCTTCTGAGGACAAGG - Intronic
907809267 1:57852170-57852192 ATGAGGATCTTCAGGGGAAAAGG - Intronic
909714164 1:78687323-78687345 CAATGGGTTTTCAGGGGTGACGG + Intergenic
910463896 1:87476112-87476134 CTCTGGCTCATCAGGGGACATGG + Intergenic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
910791609 1:91056623-91056645 TTGTGGGTCACCAGGGGTGATGG + Intergenic
910936331 1:92486316-92486338 CTGTGGGTCGGCAGGGGATGGGG + Intronic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
915269908 1:154746685-154746707 CTGTGGGTCCTCACAGGGGAGGG - Intronic
915305349 1:154974120-154974142 AGGTGGGACTTCCGGGGAGAGGG + Intronic
916167782 1:161978811-161978833 CTGTGTGTCTTCAGGCTTGAGGG + Intergenic
916282247 1:163064577-163064599 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
916443346 1:164848830-164848852 CTGTGTGTGCTCAGGGGAGCAGG + Exonic
917478494 1:175389387-175389409 ATGAGGGTCCTCAAGGGAGAAGG - Intronic
917539844 1:175901893-175901915 CTGTGGGTTTTCAGGCTTGAGGG - Intergenic
917899068 1:179523868-179523890 CTTTGGGGATTCAGGGGAAAAGG - Intronic
919906347 1:202081117-202081139 ATGAGGGTCTTTAAGGGAGAAGG - Intergenic
920378460 1:205522108-205522130 CTCTGGGTTTTCAGGGCAGGAGG + Intronic
921257951 1:213359444-213359466 GTGTGTCTCTGCAGGGGAGATGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922076916 1:222254041-222254063 CTCTGGGGCTTCAGGGGTCATGG + Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922790054 1:228306357-228306379 CTGTGGGGCTGCAGGGGGCAGGG - Exonic
923024928 1:230196598-230196620 GTGTGGGTCTTGACAGGAGATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924194316 1:241589447-241589469 CTTTCTGTCTTCAGGAGAGATGG - Intronic
1063361055 10:5459217-5459239 TTGTGGGGCGTCAGGGTAGAGGG + Intergenic
1063374400 10:5545385-5545407 CTGTGTGTGTCCAGTGGAGAAGG + Intergenic
1063440940 10:6072475-6072497 CTGTGGGTCTTTATGGATGAGGG - Intergenic
1063544694 10:6969393-6969415 CTTTGGGGCCTCAGGGGATAGGG + Intergenic
1063688563 10:8261718-8261740 CTGTGGAATTTCAGGGGAGTGGG - Intergenic
1064705552 10:18069431-18069453 CTGTGGGTCTCCAGGCTTGAGGG - Intergenic
1066064125 10:31750108-31750130 CGGCTGGGCTTCAGGGGAGAGGG + Intergenic
1066438446 10:35415199-35415221 TTGTTGGTCCTCAGAGGAGATGG + Intronic
1066746283 10:38605631-38605653 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1068067876 10:52154802-52154824 CTTTGGGGACTCAGGGGAGAAGG - Intronic
1068800166 10:61131704-61131726 TTGTGGGACCTCAGTGGAGAGGG - Intergenic
1069686934 10:70324504-70324526 CTGTGGTTGGCCAGGGGAGAAGG - Intronic
1071033693 10:81216379-81216401 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1071667660 10:87576563-87576585 CTCTGGGACTTCAGGGGTCATGG + Intergenic
1071860593 10:89668830-89668852 CCCTGGGTATTCAGGGGACAGGG - Intergenic
1072628706 10:97131165-97131187 GTGTGGCTCTTTAGGGCAGAAGG - Intronic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073514088 10:104061708-104061730 CTGTAGGAGTTCAGGAGAGAAGG - Intronic
1073618864 10:105026266-105026288 CTGTGGCTGTCCAGGGGAGAGGG - Intronic
1075397984 10:122141499-122141521 CTGTGGGTGTTAAGGGCAGGCGG + Intronic
1076330083 10:129657730-129657752 TTGTGGGTCCTTGGGGGAGAGGG - Intronic
1076599144 10:131645869-131645891 GTGTGTGCCTTGAGGGGAGAGGG + Intergenic
1076859460 10:133133753-133133775 CTGTGGTTGTTCAGGGCAGGCGG + Intergenic
1077299501 11:1840474-1840496 AGGTGGGTCTGCAGGGGAGCTGG + Intronic
1078205963 11:9229637-9229659 CTGAGGGTCTTCAAGGAAAAGGG - Intronic
1078397275 11:10992282-10992304 GTGTGTGTCTTCAGTAGAGACGG + Intergenic
1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG + Intronic
1080339324 11:31241541-31241563 CTTTGGGTCTCTAAGGGAGAAGG - Intronic
1081001797 11:37682634-37682656 CTCTGGGGCTTCAGGGGTCATGG - Intergenic
1082751472 11:57022802-57022824 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1083285116 11:61653680-61653702 ATAGGGGTCTTCAGGGGAGAAGG - Intergenic
1083535706 11:63464896-63464918 CTGTGGCTTTGCAGGGGATAAGG - Intronic
1084219208 11:67667292-67667314 CTGTGAGTGTTCAGGAGTGAAGG + Intronic
1084554117 11:69865599-69865621 TTGTGGGCCAGCAGGGGAGATGG - Intergenic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1085456328 11:76667502-76667524 CTGTGCGCCTTCAAGAGAGATGG - Intronic
1085511630 11:77091113-77091135 CTCTGGTTCTTCCGGGCAGAGGG + Intronic
1085771088 11:79326478-79326500 CTGTGGGTCTTTAGGCGAGGGGG - Intronic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1086516725 11:87622041-87622063 CTGTGTCTCTGCAGGTGAGATGG + Intergenic
1087034713 11:93743651-93743673 CTGTGGGTCTTCAGGGGTCGCGG - Intronic
1087779325 11:102286414-102286436 ATGAGGGTGTTCAAGGGAGAAGG - Intergenic
1087903011 11:103663830-103663852 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1089165474 11:116472799-116472821 GTGAGGGTTTTCAGGGGAGGAGG - Intergenic
1089345258 11:117786914-117786936 TCATGGGTCTTCAGGGGAGCAGG + Intronic
1089895530 11:121926867-121926889 ATGAGGGTCTTCAAAGGAGAAGG + Intergenic
1090540772 11:127700624-127700646 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1091236068 11:134022955-134022977 CTGTGGGTCCTCACAGGAGCTGG + Intergenic
1091440096 12:505869-505891 CTAGGGCTCTTCATGGGAGAGGG - Intronic
1092064093 12:5575153-5575175 TTGTGGGTGCTCAGAGGAGAGGG - Intronic
1092163263 12:6327707-6327729 CTGGGAGTCCTCAGGGGAGGAGG + Exonic
1092230511 12:6773253-6773275 TTGTGGGGCTGCAGGGGAGCTGG - Exonic
1092874555 12:12836773-12836795 CTGTGTGTCTTCAGATAAGAAGG - Intergenic
1094317693 12:29150090-29150112 CTGGGGGTGTGCAGGGGAGCAGG + Intronic
1095389184 12:41685587-41685609 CTTTGGGGCTTCAGGGGGAAGGG + Intergenic
1096961705 12:55585307-55585329 CTATGGGTCATCAAGGTAGAAGG - Intergenic
1097534384 12:60847979-60848001 CTGTGGGACTTCAGGGACAAGGG + Intergenic
1099612265 12:84889000-84889022 ATGAGGATCTTCAAGGGAGAAGG - Intronic
1102254447 12:111407443-111407465 CTGTGGGTCTCCAGGGATGCAGG + Intronic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1103965890 12:124639108-124639130 CTCTGGGACCTCAGGGGAGGAGG + Intergenic
1104035491 12:125094515-125094537 CTGTGGCTCTGCAGCAGAGAGGG - Intronic
1104076106 12:125391553-125391575 CTGCAGGTCTGCAGGGGAGTAGG - Intronic
1104700225 12:130897358-130897380 GTGTGTGTCTTTAGTGGAGACGG - Intergenic
1104914751 12:132258845-132258867 CTGTGGGTCTCCAGCGTGGACGG - Intronic
1105280675 13:18960891-18960913 CTGTGGGCCTCCATTGGAGAGGG + Intergenic
1105602809 13:21902209-21902231 CTCTGGGTCTTTCAGGGAGATGG + Intergenic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1106483526 13:30154363-30154385 TCGTGGCTCTTCTGGGGAGAGGG - Intergenic
1106758525 13:32845719-32845741 CTGTGGGGAATCAGAGGAGATGG - Intergenic
1106800818 13:33254531-33254553 CTGTGGGTCTTCAGGCTTGATGG - Intronic
1108283218 13:48879982-48880004 CTGTGTTCCTTCAGGGGAGTAGG - Intergenic
1108385710 13:49897576-49897598 TTGTTGGTCTCCAGGGAAGAGGG - Intergenic
1109344444 13:61098476-61098498 ATGAGGGTCTTCAAGTGAGAAGG - Intergenic
1109906284 13:68846255-68846277 CTGTGGCTCTTCCAGGGGGATGG - Intergenic
1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG + Intronic
1112471789 13:99695860-99695882 ATGAGGGTCTTCAGGGGAGGAGG + Intronic
1112497729 13:99918112-99918134 TTGTGGGCTTTCTGGGGAGAAGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114497108 14:23140424-23140446 CTGTGGCCCTTCAAGGGAGAGGG + Intronic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1115491269 14:33960439-33960461 GTGTGTGTTTTCAGTGGAGACGG - Intronic
1115523614 14:34257611-34257633 ATGAGAGTCTTCAGGGGAGAAGG - Intronic
1116478320 14:45367037-45367059 ATGAAGGTCTTCAAGGGAGAAGG - Intergenic
1117210926 14:53498873-53498895 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1118682803 14:68260680-68260702 ATGAGGGTCTTCAAGAGAGAAGG + Intronic
1119165884 14:72492426-72492448 ATGAGGGTTTTCAAGGGAGAAGG + Intronic
1119272738 14:73323984-73324006 CTCCTGCTCTTCAGGGGAGAAGG - Intronic
1120215853 14:81679911-81679933 CTGTGGGACTTCAGAGGAAATGG + Intergenic
1120242665 14:81967215-81967237 ATGAGGATCTTCAAGGGAGAAGG - Intergenic
1120687857 14:87559129-87559151 CTCTGAGTGTTCAGAGGAGAAGG + Intergenic
1120862479 14:89267196-89267218 CAGTGGGTTCTCAGGGTAGACGG + Intronic
1120984478 14:90321964-90321986 CTGTTGGTCTATAGGGGAGGAGG - Intronic
1123072056 14:105646768-105646790 CTCTGGGACTTCAGGGGACCAGG - Intergenic
1123947314 15:25245023-25245045 CTGGGGTTTTTCAGGGGAGCCGG + Intergenic
1123948514 15:25250414-25250436 CTGGGGTTGTTCAGGGGAGCTGG + Intergenic
1124992719 15:34691892-34691914 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1126212145 15:46111758-46111780 CTCTGGGGCTTCAGGGGTCACGG + Intergenic
1127145389 15:56018185-56018207 CTCTTGCTCTTCAGGAGAGAAGG - Intergenic
1127211257 15:56777133-56777155 ATGAGGGTTTTCAAGGGAGAGGG - Intronic
1127341545 15:58049996-58050018 GTGTGGGTCTTGAGGGGGAAGGG + Intronic
1127959777 15:63882205-63882227 ATGAGGGTCTTCCAGGGAGATGG + Intergenic
1128075453 15:64822788-64822810 ATGGGGGTCTTCAGGGCACAAGG - Intronic
1128333918 15:66774032-66774054 CTCTGGGTCTTCAGGGGTCTAGG - Intronic
1128377831 15:67089974-67089996 CTGTGTGGCTTCAGAGGTGAGGG - Intronic
1128468600 15:67933268-67933290 CTGAGGGTTTTCAGGAGAGAAGG - Intergenic
1128578299 15:68791067-68791089 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1129792674 15:78351994-78352016 CTGGGGGTTTTGAGGGGAAATGG + Intergenic
1130897818 15:88184292-88184314 CTATGTGTCTGCAGGGGAGGAGG + Exonic
1131901028 15:97088014-97088036 TTGACTGTCTTCAGGGGAGAGGG + Intergenic
1132180615 15:99750140-99750162 ATGAGGGTCTTCACGGGAGAAGG - Intergenic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135004205 16:18803471-18803493 CTGTGGGTCTTTCGGGGAAAGGG + Intergenic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1136736778 16:32474011-32474033 CTGCGGGTCTTGGGGTGAGATGG - Intergenic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137446828 16:48537026-48537048 CTGTCAGTCTTCAGGGCACAGGG - Intergenic
1137808258 16:51328494-51328516 GTGGGGGTAGTCAGGGGAGATGG - Intergenic
1138235550 16:55379517-55379539 ATGTGGGTCTTCAGACGAGCAGG + Intergenic
1139340504 16:66265022-66265044 CCATGGGACTCCAGGGGAGAAGG + Intergenic
1139908654 16:70383087-70383109 CTGAGGTTCTGCAGGGGAAATGG + Intronic
1140116950 16:72050394-72050416 CTGTGGGTCCTCAGGGAAGTGGG - Intronic
1140335133 16:74097942-74097964 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1140657438 16:77155304-77155326 CTGGGGCTCTTCAGGGAAGCTGG + Intergenic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141278218 16:82606966-82606988 CTGTGGGGCTCCAGAGGACAAGG + Intergenic
1141414525 16:83859966-83859988 CTTTGGGGCTTCAGAGGAGGAGG + Intergenic
1142169600 16:88614839-88614861 CAGTGGGGTCTCAGGGGAGAAGG - Intronic
1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1143792385 17:9307912-9307934 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1144161237 17:12560925-12560947 CTTTGGGGCCTCAGGGGAAATGG - Intergenic
1144330037 17:14214710-14214732 CTGAGGGTCTGCAGAGGAGCTGG - Intergenic
1144433384 17:15216910-15216932 TTAAGGGTCTTCAGGAGAGAAGG - Intergenic
1146584264 17:34068811-34068833 CAGTGGGCCCTCAGGGGAGCAGG + Intronic
1147165993 17:38593746-38593768 CTGTGGGCTTTCAGGGGATGGGG - Intronic
1148129917 17:45256451-45256473 CTGTGGGGCTTCAGCGGGAAGGG + Intronic
1148162040 17:45455781-45455803 CTGAGGGACTACAGGGGAGAAGG - Intronic
1148205774 17:45778982-45779004 CTGGGGGGCTGCAGGGGAGGGGG - Intergenic
1149598553 17:57878429-57878451 CTGGGGCTGTTCTGGGGAGAAGG + Intronic
1149600743 17:57891541-57891563 CTCTGGGTATTCTGGGGACATGG - Intronic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1151194023 17:72419207-72419229 TTGTGGGTCTGAATGGGAGATGG + Intergenic
1151514091 17:74580985-74581007 CTGAGGGTATTTGGGGGAGATGG + Intronic
1151875648 17:76866905-76866927 GTGTGGGTCATCTGGGGAGGTGG - Intergenic
1151889613 17:76944427-76944449 CTGGGGGTCTTGCGGGGACAAGG - Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1153026640 18:678905-678927 CTGTGTATCTGCAGAGGAGAAGG + Intronic
1153333319 18:3896860-3896882 ATGAGGGTCTTCAAGGGAGAAGG - Intronic
1154161877 18:11986514-11986536 CTCTGGCTCTTCAGGGCAGAAGG + Intronic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1156245438 18:35293476-35293498 CTGTAGGTCTTCAGGGACCAGGG + Intergenic
1156801426 18:41119377-41119399 GTGTGAGTGTTCTGGGGAGAAGG - Intergenic
1156873973 18:41983402-41983424 CTTTGGGGCTTCAGGGGAAGAGG - Intronic
1157015203 18:43703891-43703913 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
1157226628 18:45871771-45871793 CTGTGGGGTGTCAGGGGAAAAGG + Intronic
1157728728 18:49985738-49985760 CTTAGGGTTTTCAGGGAAGAGGG - Intronic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1158711372 18:59841102-59841124 CTTTGCTTTTTCAGGGGAGATGG + Intergenic
1158978380 18:62734312-62734334 CTCTGGATCTTCATGGAAGAAGG + Intronic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1162087093 19:8255503-8255525 ATGTGGGCCTGCAGTGGAGAGGG + Intronic
1162124128 19:8490255-8490277 CTATTGGGCTTCTGGGGAGAGGG - Intronic
1162753578 19:12843657-12843679 GTGTGGGTCTTCAGGCTGGAGGG - Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163150966 19:15413860-15413882 CTGTGTCTGTTCAGGCGAGAGGG + Intronic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1163581786 19:18143833-18143855 CTGATGGTATTCAGGAGAGATGG - Exonic
1163636568 19:18439663-18439685 ATGAGGGTCTTCAAGGGAGCAGG - Intergenic
1164414241 19:28032979-28033001 CTGTGGATCTTCAAGGCAGCTGG + Intergenic
1164420750 19:28089886-28089908 CTGTGTCTCTGCAGGTGAGATGG - Intergenic
1164518764 19:28960616-28960638 CTGTGGGTCTTCAAGGCAGCAGG + Intergenic
1165331317 19:35142537-35142559 CTGCGGGTATTCTGGGGAGAGGG + Intronic
1166198909 19:41223603-41223625 CTGGGGGTCTCCAGGGTGGAGGG + Intronic
1166915241 19:46190972-46190994 CTGAGGGGCCTGAGGGGAGATGG - Intergenic
1166988469 19:46676651-46676673 CTGTGGGTGTTGACGGGAGCAGG - Intronic
1167495082 19:49812923-49812945 CTCTGGGTCTTCAAGGCAGTAGG - Intronic
1167651563 19:50733137-50733159 CTGGGGGTTTTTTGGGGAGAGGG - Intergenic
1167700134 19:51038522-51038544 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1167707508 19:51090320-51090342 CTGAGGGTCGCCAGGGCAGAGGG + Intergenic
1168628991 19:57942536-57942558 GGGTTGGTCTTCTGGGGAGAAGG + Exonic
925021601 2:574002-574024 CGGTGGGTTTTCAGGGAGGAGGG - Intergenic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925094499 2:1185284-1185306 CTGTGGGTCTTCCAGGAACATGG + Intronic
925348653 2:3187125-3187147 CTGTGGGCCATCAGGTGACATGG - Intergenic
926096897 2:10087221-10087243 GTGTGTGTGTTTAGGGGAGAGGG - Intergenic
926552422 2:14316375-14316397 CTGACGTTCTTCAGAGGAGATGG - Intergenic
926662390 2:15481913-15481935 ATAAGGGTCTTCAAGGGAGAAGG - Intronic
926891064 2:17639125-17639147 CAGTTGCCCTTCAGGGGAGAGGG + Intronic
927392955 2:22616207-22616229 CTGTCGGTCGACAGGAGAGAGGG - Intergenic
928092373 2:28382893-28382915 CTGTGTGTCTTTAGGGGCGTGGG + Intergenic
928103864 2:28455064-28455086 CCGTGGGTCTTCAGGCTTGAGGG - Intergenic
928231832 2:29505180-29505202 CTCTGGGTTCTCAGGTGAGAAGG + Intronic
928315887 2:30245476-30245498 CTGTAGGTCCTCAGAGGGGAGGG + Intronic
928398385 2:30960644-30960666 CTCTGGGTGGTCAGAGGAGAAGG + Intronic
928933016 2:36645085-36645107 CTGTGAGTCTACAAGGGAGATGG + Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
929953953 2:46441017-46441039 CCATGGGTCTTCAAGGGAGCAGG + Intronic
931027864 2:58134247-58134269 ATGAGGGTCTTAAAGGGAGAAGG - Intronic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932143111 2:69296966-69296988 CTGTGGGTGCTCAGAGGAGGGGG - Intergenic
932184192 2:69677879-69677901 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932466179 2:71925781-71925803 CAGTGGCTCTTCAGGGTGGATGG + Intergenic
932556579 2:72830005-72830027 CTCTGGGGCTTCAGGGGTCACGG + Intergenic
932633830 2:73370567-73370589 CCATGGGTGTTCATGGGAGATGG - Intergenic
932827653 2:74956609-74956631 ATGAGGGTCTTCAAGGGAGAAGG - Intergenic
932873273 2:75425229-75425251 CTCTGGGGCTTCAGGGTCGAGGG - Intergenic
933695479 2:85214128-85214150 CTGTGGCTCTTCACGGGAGGGGG - Intronic
933834976 2:86238690-86238712 CTGTGGGTGCACAGGGCAGAAGG + Intronic
934050244 2:88204370-88204392 CTTTGGGGCCTCAGGGGAAAGGG - Intergenic
934308684 2:91844819-91844841 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
935645204 2:105329220-105329242 ATTTGGGTTTTCCGGGGAGAAGG - Intronic
936771898 2:115923744-115923766 CTTTGGGTCCTCAGGAGAAAGGG - Intergenic
937292558 2:120790459-120790481 CTCTGGGTCCTTTGGGGAGATGG - Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937891819 2:126944940-126944962 TTGAGGGTCTTCAGGGCAGAAGG + Intergenic
937914768 2:127093435-127093457 ATGAGGGTCTTCAGGGGTGAAGG - Intronic
938094974 2:128455667-128455689 AGGTGGGTCTGCAGGGTAGATGG + Intergenic
938540647 2:132281228-132281250 CCGTGGGGCTGCAGGGGAGGGGG + Intergenic
938677843 2:133656929-133656951 CTTTGGGTACTCAGGGGAAAGGG - Intergenic
938768797 2:134482383-134482405 GTGTTGGTCTTTAGGGGAAAGGG - Intronic
939750972 2:146045344-146045366 ATTTGGGTCTTCAAGAGAGAAGG + Intergenic
940223813 2:151381596-151381618 ATGAGGGTCTGCAAGGGAGAAGG - Intergenic
940891068 2:159035947-159035969 CTGTGGGTCCTCCGGACAGAGGG + Intronic
941877292 2:170447053-170447075 ATGAGGGTCTTCAGGGGAGAAGG + Intronic
943082007 2:183267052-183267074 ATGAGGGTCTTCCAGGGAGAAGG + Intergenic
944517983 2:200531503-200531525 ATCTGTGTCCTCAGGGGAGAGGG + Intronic
945218473 2:207460457-207460479 ATGAGGGTCTTCAAGGAAGAAGG - Intergenic
945971609 2:216236710-216236732 AGGTGGATCTTCAGAGGAGAAGG + Intergenic
946051919 2:216869931-216869953 CTGTGGGGCTCTAGGGGATAGGG + Intergenic
946434457 2:219642535-219642557 CTGGGGGACTTGAGGGGAGCGGG + Intergenic
946538491 2:220657856-220657878 GTGTGGGTCTTCAGGCTTGAGGG + Intergenic
947330813 2:229027567-229027589 CTGTGAGTGTTCAGTGGAGGAGG + Intronic
947614738 2:231548549-231548571 GTGGGTGTCTCCAGGGGAGACGG + Intergenic
948713962 2:239847017-239847039 ATGTGGGTTTTCAGGGAAGTGGG - Intergenic
948915920 2:241035057-241035079 TTCTGGGTCCTCAGGGGAGGAGG + Intronic
1169048596 20:2558203-2558225 CAGGAGGTCTTCAAGGGAGACGG + Intronic
1169276570 20:4237096-4237118 ATGTGGATCTGAAGGGGAGAGGG + Intronic
1169969718 20:11256380-11256402 CTGTGGGGACTCAGGGGAAAGGG - Intergenic
1170096441 20:12650609-12650631 TAGTGGGTTTCCAGGGGAGATGG + Intergenic
1170795054 20:19539954-19539976 ATGAGAGTCTTCAAGGGAGATGG + Intronic
1170967363 20:21085952-21085974 CTGTGGGTCTTGAGGGTTAAAGG - Intergenic
1171092208 20:22296005-22296027 CTGAATGTCTTTAGGGGAGATGG + Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1172351932 20:34249846-34249868 ATGTGATTTTTCAGGGGAGAGGG - Intronic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173396976 20:42689085-42689107 CTGTGGGTCTTCAGGCTTGAGGG - Intronic
1173709837 20:45145128-45145150 CTCTAGGTCTTCAGTGGAGGAGG + Intergenic
1174848348 20:53966462-53966484 CTTTGGGGACTCAGGGGAGAAGG + Intronic
1175265424 20:57700384-57700406 TTTTGGGGCTTCAGGGGAGGTGG - Intronic
1175590785 20:60190274-60190296 ATGAGGAACTTCAGGGGAGAAGG - Intergenic
1176249387 20:64113026-64113048 CTTTGAGTCTCCAGGGGAGGGGG + Intergenic
1177262067 21:18742616-18742638 TTGTGGATATTCAGGGGAGGGGG + Intergenic
1178822007 21:35983866-35983888 CTGTGGGACTTGAGGGGCAAGGG + Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179468506 21:41594776-41594798 ATGAGAGTCTTCAGGAGAGAAGG + Intergenic
1179874928 21:44262593-44262615 ATGGGGGCCTTCAGGGGAGGTGG + Intergenic
1179875026 21:44262871-44262893 ATGGGGGTGTTCAGGGGAGGTGG + Intergenic
1180127818 21:45804042-45804064 TTGTGGGCCTCCAGGGGAGGTGG + Intronic
1180535770 22:16391906-16391928 CTGCGGGTCTTAGGGAGAGATGG + Intergenic
1180588362 22:16914120-16914142 CTTTGAGTCTGCAGAGGAGAAGG - Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181424075 22:22821807-22821829 CTGTGTGTCTTCAGTGTCGAAGG + Intronic
1181749967 22:24982551-24982573 TTGTGGGTCTGCATGGGTGAGGG + Intronic
1181856965 22:25788791-25788813 CAGTGAGTTTTCAGTGGAGATGG - Intronic
1182049972 22:27305128-27305150 CTGTGAGTTTTCAGGGGCAATGG + Intergenic
1182423069 22:30257872-30257894 CTGTGACTCTTCTGGGGACAGGG - Intergenic
1182440545 22:30361398-30361420 ATGAGGGTCTTCAGGGGAGGAGG + Intronic
1183544531 22:38448538-38448560 CTGGGGATTTTCTGGGGAGAAGG + Intronic
1183650100 22:39148857-39148879 CTGTGGGCATTCTGGGGTGATGG - Intronic
1183953633 22:41366747-41366769 TCTTTGGTCTTCAGGGGAGAGGG - Intergenic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1185236422 22:49716217-49716239 CTGGGGGCCCTCAGGGCAGATGG - Intergenic
1185333269 22:50261021-50261043 CCGTGGGTCCCCAGGGGAGAAGG - Intronic
1185343755 22:50302601-50302623 CTGAGGGACTTCAGGAGAAAAGG - Intronic
1185377080 22:50487581-50487603 CTGTGGGGCTGCCTGGGAGAGGG + Intronic
949266600 3:2164007-2164029 CTTTGGGGATTCAGGGGAAAGGG + Intronic
949808321 3:7978786-7978808 CTGCGGGTCTTCAGGCTTGAGGG + Intergenic
950185742 3:10944519-10944541 CTGAGGGTCTTCAGGGGCCTTGG + Intergenic
951755363 3:26085490-26085512 ATGAGGATCTTCATGGGAGAAGG - Intergenic
951843532 3:27061171-27061193 CTGTGACCCTTCAGGGTAGAAGG + Intergenic
952311121 3:32191302-32191324 CTATGGGTGTTCACGGGAAATGG - Intergenic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
954463987 3:50643973-50643995 CTGAGGTTGCTCAGGGGAGAAGG - Intronic
955319646 3:57965063-57965085 CTGTGGGTCTACAGGTAAGTGGG + Intergenic
955863553 3:63357613-63357635 GTGTGTCTGTTCAGGGGAGAGGG + Intronic
955937508 3:64115454-64115476 GTGTGTGTCTGCATGGGAGATGG - Intronic
955943630 3:64170123-64170145 ATGTGGGTCTCCAGGAGAAAAGG - Intronic
956118414 3:65941611-65941633 CAGTGGTTCTTAAGGGGAGGTGG - Intronic
957219494 3:77363738-77363760 ATGAGGGTCTTCAAGGAAGAAGG + Intronic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
958192942 3:90206081-90206103 TTGAAGGTCTTCATGGGAGATGG + Intergenic
958416242 3:93877033-93877055 TTGAAGGTCTTCATGGGAGATGG + Exonic
958524723 3:95241092-95241114 CTGTGGGTTTTCAGGCTTGAGGG + Intergenic
959574135 3:107916338-107916360 CTGTTGGTCATCCGAGGAGAAGG + Intergenic
960425496 3:117502059-117502081 ATGAGGGTCTTCAAGGGAAAAGG - Intergenic
960507671 3:118513165-118513187 AAGAGGGTCTTCAGGGGAGAAGG - Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961053591 3:123767800-123767822 GTGGGTGTCTTCAGGGGAGTGGG + Intronic
962975034 3:140438880-140438902 CTGAGGGTCTTTAGGGTTGAAGG + Intronic
963005634 3:140724129-140724151 CTGTGGGCTTTCAGGTGAGGAGG - Intergenic
963206512 3:142641764-142641786 CTGGGTTTCTTTAGGGGAGATGG + Intronic
963358072 3:144235694-144235716 CTGTAGGTGTGCAGGGGACAGGG - Intergenic
963637016 3:147810895-147810917 ATAAGGGTCTTCAGGGGAAAGGG + Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964184192 3:153923171-153923193 CAGTGGGTTTTCAGGGTTGATGG + Intergenic
964764905 3:160170266-160170288 ATGAAGGTCTTCAAGGGAGAAGG + Intergenic
964887691 3:161503237-161503259 CTGTGGAGATTCTGGGGAGAGGG + Exonic
965457688 3:168924344-168924366 ATTAGGGTCTTCAGGGGAGAAGG - Intergenic
966229425 3:177634971-177634993 CTTTGGGGATTCAGGGGAAATGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968173673 3:196530064-196530086 CTTTGGGTATTCAGGGGAAAGGG - Intergenic
968677959 4:1895688-1895710 CAGTGGCTCTCCCGGGGAGAGGG + Intronic
968984744 4:3869010-3869032 CAGTGGGTCATCTGGGGAGTGGG - Intergenic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969349055 4:6587563-6587585 CTGTGATTCTTCAGGTGTGAGGG + Intronic
969415195 4:7053381-7053403 CTGTGGCTCTTCAAGGGAGCAGG - Intronic
969690823 4:8703198-8703220 CTGTGTGTCCTCAGAGGAGGGGG + Intergenic
969719456 4:8885274-8885296 CTTTGGGTCTTCTGTGGAGTTGG - Intergenic
970065251 4:12086328-12086350 CTGTGGCTCTACAAGAGAGAAGG - Intergenic
971628798 4:28961595-28961617 ATGAGGGTCTTCAAGGGTGAAGG - Intergenic
975113305 4:70650738-70650760 CTGTGAGCCTTCAGGGAAGCTGG - Intronic
975630507 4:76396992-76397014 CTGGGGGCCTTCTTGGGAGAAGG + Intronic
975683074 4:76896129-76896151 CTGTGGGTCCCCAGTGGGGAGGG - Exonic
976080161 4:81346269-81346291 CTCAGGGTCACCAGGGGAGAGGG + Intergenic
976473455 4:85455709-85455731 CTCTGGGGCTTCAGGGGTCATGG + Intergenic
977154710 4:93557343-93557365 ATGTGTGTCTGCATGGGAGACGG - Intronic
978227342 4:106353061-106353083 ATGAGGGTCATCAAGGGAGAAGG + Intergenic
980515159 4:133847676-133847698 ATGAAGGTCTTCAGGGGAGAAGG + Intergenic
981601706 4:146496505-146496527 ATGAGGGTCTTCAGGGGAGAAGG - Intronic
981621939 4:146710641-146710663 CTGTAGGACTTCAAGGGAGCTGG + Intronic
982678204 4:158400140-158400162 ATGAGGGTCTTCAAGGTAGAAGG - Intronic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
982774392 4:159427263-159427285 CTGGGGGTCTTCAGGTGTGATGG - Intergenic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984519392 4:180784148-180784170 ATGAAGGTCTTCATGGGAGAAGG + Intergenic
984926041 4:184807906-184807928 ATGTGTGTTCTCAGGGGAGAGGG - Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985109397 4:186533717-186533739 TTGTTGGTCATCAGTGGAGACGG + Exonic
985138357 4:186812335-186812357 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
985273214 4:188214174-188214196 CTGTGGGTTTTCTGGGAAGTGGG - Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985652646 5:1114030-1114052 CTGTGGACCTTCAGAGGAGCTGG + Intergenic
985836851 5:2277947-2277969 CTGTGAGTCGTCACGGGAGAGGG + Intergenic
986007794 5:3682841-3682863 CTCTGGGGACTCAGGGGAGAGGG - Intergenic
986212871 5:5690592-5690614 ATGAGGGTCTTCGAGGGAGAAGG + Intergenic
986597196 5:9436311-9436333 CTGTGGTTCTCCATGGGGGAGGG + Intronic
987592607 5:19950355-19950377 CTTTAGGTATTCAGGGGAAAAGG + Intronic
987859791 5:23469557-23469579 CTATGAGTTTTCAGGGGACACGG + Intergenic
988276155 5:29083268-29083290 CTGTTGGTGTGCAGGGGACAAGG + Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
988699148 5:33655804-33655826 CTGTCGGGGTTCAGGGGAAAGGG - Intronic
988846009 5:35129029-35129051 CTGTGGGTCTTCACTGCAAAGGG + Intronic
992637076 5:78735470-78735492 CTGTGGGTTTTCAGGCTTGAGGG - Intronic
992752027 5:79870637-79870659 GTCTAGGTCTTCAGGGGAAATGG + Intergenic
994994233 5:107039191-107039213 ATGAGGGTCTTCAGGGGAGAAGG + Intergenic
995083926 5:108086133-108086155 ATGAGGATCTTCAAGGGAGAAGG - Intronic
995083941 5:108086223-108086245 ATGAGGATCTTCAAGGGAGAAGG - Intronic
995436074 5:112137030-112137052 AAGTGGGTCCTCTGGGGAGAAGG + Intergenic
995531394 5:113095186-113095208 CTGTTGGTCTGCATGGGAGTGGG + Intronic
995912724 5:117207245-117207267 CTGTGTGGCTTCCTGGGAGATGG + Intergenic
997178287 5:131801342-131801364 CTGTGGCTGTTCTGTGGAGAAGG + Intergenic
997259743 5:132456775-132456797 CTGAGGGTCTACAGGCCAGAGGG - Intronic
997529121 5:134571359-134571381 CTGGAGGTTTTAAGGGGAGAAGG + Intronic
997778643 5:136634747-136634769 CTGTGGGTATTCAGGATGGAGGG + Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998052897 5:139051185-139051207 GTGTGTGTGTTCAAGGGAGAGGG - Intronic
998214624 5:140227775-140227797 CTGGGGGTCCTCATGGCAGAAGG - Intronic
999056824 5:148587037-148587059 CAGTGGGGGTTCAGGGGAGCTGG - Intronic
999450883 5:151677298-151677320 CTTTGTGGCTGCAGGGGAGATGG - Intronic
999581968 5:153049023-153049045 TTGTGGGTTTTCAGTGGACAGGG - Intergenic
999811016 5:155127099-155127121 CTGTGGGTCTTCAGGCTTGAGGG + Intergenic
1000233503 5:159336520-159336542 CTGTGGGGCTGCAGGGGTCATGG + Intergenic
1001008392 5:168075093-168075115 CTTTGGGGCCTCAGGGGAAAGGG - Intronic
1001064377 5:168524276-168524298 GTGTGTGTGTTCAGGAGAGACGG - Intergenic
1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG + Intergenic
1001535108 5:172492621-172492643 CAGTGGTTCTTCAGGAGGGAAGG - Intergenic
1001656717 5:173356309-173356331 CTGTGCATCTTCAGGGGACGGGG + Intergenic
1002340657 5:178514690-178514712 CTTTGGGACTTCAGGGGTGTGGG + Intronic
1002395244 5:178947330-178947352 CTGTGGCTCCTCATGAGAGAAGG - Intronic
1002495646 5:179609563-179609585 CTGTGGGTCTCCAGGGGCTTGGG + Exonic
1003489658 6:6610383-6610405 CTGTGGGTCATAAAGGCAGAGGG - Intronic
1004410327 6:15375576-15375598 CTGTGGGTCTCCAGCAGAGAGGG + Intronic
1004469591 6:15917287-15917309 CTGTGGGTATTCAGGCTTGAGGG + Intergenic
1005010302 6:21329349-21329371 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1005673006 6:28125853-28125875 CTGTGAGTGATCAGGGGATATGG + Intronic
1006391816 6:33763089-33763111 TAGTGGGTCTTCAGTGAAGAGGG + Intergenic
1006904124 6:37521617-37521639 CTGTTGTCCTTCAGGGGAGTGGG + Intergenic
1007421766 6:41723948-41723970 CTGTGGGGCTTCTGGCTAGAAGG - Intronic
1007609687 6:43141552-43141574 CTGTGGGTGGTCAGGAGCGATGG + Intronic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1009027361 6:58016047-58016069 ATGAGGGTCTTCAGGAGAGAAGG - Intergenic
1009070131 6:58620751-58620773 CTTTGGGTCTTCATTGGAAACGG + Intergenic
1009117394 6:59278973-59278995 CTTTGGGTCTTCATTGGAAACGG + Intergenic
1009128592 6:59434782-59434804 CTTTGGGTCTTCATTGGAAACGG + Intergenic
1009134330 6:59514643-59514665 CTTTGGGTCTTCATTGGAAACGG + Intergenic
1009524576 6:64728200-64728222 CTCTGGGGCTTCAGGGGTCATGG - Intronic
1013045531 6:106481539-106481561 CAGAGGGTCTCCAGGAGAGAAGG - Intergenic
1013328558 6:109073490-109073512 CTGTGGGTCTTAGGAGAAGACGG - Intronic
1013874167 6:114803796-114803818 GTGTGTGTCTGCAGGTGAGATGG + Intergenic
1013954995 6:115831498-115831520 CTGTGGGCCTGCAGGGCTGATGG - Intergenic
1015380021 6:132556437-132556459 CTTTGGGGACTCAGGGGAGAAGG - Intergenic
1016339111 6:143042096-143042118 CTATGGGTCTTCAAGAGAAAGGG - Intergenic
1016676167 6:146771233-146771255 CTCTGGGTCTTCAGCTGTGAAGG + Intronic
1016853973 6:148648009-148648031 CTATGGGTGTTCACAGGAGATGG + Intergenic
1017017450 6:150113274-150113296 CTCTGAGTCTTCATGGTAGATGG - Intergenic
1018276326 6:162135670-162135692 CTGTGGATCTGCAGATGAGAGGG + Intronic
1018674496 6:166207146-166207168 TGGTGGGTCTTCAGGGAAGCCGG - Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019613768 7:1949614-1949636 CTGTGGGGTTTCAGGGGAGGTGG - Intronic
1019953301 7:4390855-4390877 CTGTGATTCTTCAGGTGACAGGG + Intergenic
1020675362 7:11177800-11177822 TTCTGGGTTTTGAGGGGAGAAGG - Intergenic
1021002672 7:15352519-15352541 GTTTGGGTGTTCAGGGGAGGGGG + Intronic
1021073626 7:16273779-16273801 CTCTGGGGCTTCAGGGGTCATGG + Intronic
1021453061 7:20799247-20799269 TTCTGGCTCTTCAGGGGAAATGG - Intergenic
1021481035 7:21117329-21117351 CTTTTTGTCTTTAGGGGAGAAGG - Intergenic
1021902981 7:25306054-25306076 CTGTGTTTCTTCAGAGGAAAAGG - Intergenic
1022532748 7:31076998-31077020 CTGCGGGTCTTCGGGGGTGTGGG + Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1028078640 7:86547312-86547334 CTGTGATCCTTTAGGGGAGAAGG + Intergenic
1028803326 7:94994291-94994313 CATAGGGTCTTCAGGGGAGAAGG + Intronic
1029298894 7:99562975-99562997 CTGGGGATCTTAAGGGGTGAGGG - Intronic
1031121425 7:117726792-117726814 CTGTGGGGCTTCAGGGATAAAGG + Intronic
1032477927 7:132225024-132225046 TTGTGGGGCTTCTGTGGAGAGGG + Intronic
1032739145 7:134721579-134721601 CTGTGTGTGTTTAGGGGAGGTGG + Intergenic
1033789400 7:144773447-144773469 CTGTGGGTGGTCAAGGTAGAAGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035368059 7:158361354-158361376 CTGTGGGTCATCCTGGGGGAGGG - Intronic
1036690465 8:10941597-10941619 CTGTGGGTCTTCCCAGGAGCAGG - Intronic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1037320338 8:17635295-17635317 CTTTGGGGATTCAGGGGAAAGGG - Intronic
1037353508 8:17991860-17991882 CTTTGGGGTTTCAGGGGAAAGGG - Intronic
1037408019 8:18564738-18564760 CAGTGGGATTTCAGGGGAGGAGG - Intronic
1038424869 8:27458583-27458605 ATGTGGGTCTTCCAGGGGGAAGG + Exonic
1038438583 8:27555973-27555995 ACGAGGGTCTTCAAGGGAGAGGG + Intergenic
1039064686 8:33598469-33598491 GTGTGTGTCTTGAGGGGAGGGGG + Intronic
1039484198 8:37898857-37898879 CTTTGGGTCTTCTTGGAAGAAGG - Intronic
1039552510 8:38453294-38453316 CCCTGGGCCTCCAGGGGAGACGG - Intronic
1039902176 8:41760830-41760852 CTGTGGGTCTTCTGTGGGAATGG - Intronic
1040101514 8:43511140-43511162 CTGTGGGTCTTCTTGGGACAAGG - Intergenic
1041290154 8:56301046-56301068 CTGTGTGTCCTCTGGAGAGAGGG + Intronic
1042487344 8:69361181-69361203 ATGAGGGTATTCAAGGGAGAAGG - Intergenic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1042984323 8:74566404-74566426 CTGTGGGTCTCCAGGCTCGAGGG - Intergenic
1045288663 8:100813177-100813199 ATGAGGGTCTTCAAGGGAAAAGG - Intergenic
1045432214 8:102124394-102124416 CTGCGGGGCTGCAGTGGAGAGGG - Intronic
1046319842 8:112558286-112558308 ATGAGGGTTTTCAAGGGAGAAGG - Intronic
1046906889 8:119583069-119583091 CAGTGGCACTTCAGGGGACAGGG - Intronic
1047021024 8:120775171-120775193 CTTTGTGTTTTGAGGGGAGAAGG + Intronic
1047301012 8:123613413-123613435 TTGAGGATCTTCAAGGGAGAAGG + Intergenic
1047581686 8:126223323-126223345 CTCTGGGGCTTCAGGGTAGTGGG - Intergenic
1047942878 8:129843219-129843241 CTCTGGGTGTCCATGGGAGATGG - Intronic
1048443634 8:134477763-134477785 CTTTGGTTCTTCAGGCGGGATGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049193819 8:141304599-141304621 CTTGGGGACTTCAGGTGAGAGGG - Intronic
1049390684 8:142368760-142368782 CTTTTATTCTTCAGGGGAGAGGG - Intronic
1049702804 8:144022770-144022792 AAGTGGGTCCTCAGGGAAGAGGG - Intronic
1049702917 8:144023194-144023216 GAGAGGGTCCTCAGGGGAGAGGG - Intronic
1049703349 8:144024764-144024786 GGGTAGGTCTTGAGGGGAGAGGG - Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1050330471 9:4540525-4540547 CTCTGGGCCTTCAGGGGTAATGG + Intronic
1053558412 9:39162507-39162529 CTGTGTGTCTTTATGGTAGAAGG - Intronic
1054138702 9:61456435-61456457 CTGTGTGTCTTTATGGTAGAAGG + Intergenic
1055502588 9:76916392-76916414 ATGAGTGTCTTCAGGGGAGAAGG - Intergenic
1055791321 9:79926127-79926149 TTGAGGGCCTTCAGGGGACAAGG + Intergenic
1056132492 9:83600138-83600160 CTGTGGGTCTGCCGTGGGGAAGG - Intergenic
1056577343 9:87866588-87866610 CTTTGGGTCCTCAAGGGACAAGG + Intergenic
1057006793 9:91567973-91567995 CTCTGGGGCTTCAGGGGTCATGG - Intronic
1057124110 9:92602694-92602716 CTGTGTGTGTCCAGGGGCGAGGG + Intronic
1057171702 9:92966753-92966775 CTGGGGGTGTCCAGGGGAGGCGG - Intronic
1058417733 9:104805759-104805781 ATGTGAGTTTTGAGGGGAGAAGG - Intronic
1059057909 9:111003757-111003779 TTGTGGGAGTTAAGGGGAGATGG + Intronic
1059166606 9:112082599-112082621 CTGTGTTTCTTCAGGGGCGGGGG - Intronic
1059634916 9:116160948-116160970 CACTGGGGCCTCAGGGGAGAGGG + Intronic
1060969921 9:127732091-127732113 CTGCTCGTCTTCAGGGAAGAAGG + Exonic
1061532898 9:131228774-131228796 CTGGGGGGCTGCAGGGGAGCAGG - Intronic
1061543880 9:131292574-131292596 CTTTGCGTTTTCAGAGGAGAGGG + Intronic
1061637969 9:131927398-131927420 CTTTGGCTACTCAGGGGAGAAGG - Intronic
1061829444 9:133281592-133281614 CTCTTGGTCTGCACGGGAGAAGG + Intergenic
1061994924 9:134178428-134178450 CTGAGGGATGTCAGGGGAGAAGG + Intergenic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062431511 9:136528701-136528723 CTGTGGCTCTGCTGGGGAGCAGG - Intronic
1185738556 X:2512042-2512064 CTGTGGGTTTCCAGGCGTGAGGG + Intergenic
1186087257 X:6003835-6003857 CTCTGGGTCTTCAGGGGTTGCGG + Intronic
1186748159 X:12592072-12592094 ATGAAGGTCTTCAAGGGAGAAGG - Intronic
1188784756 X:34332066-34332088 CTGTGTGTGTTTAGTGGAGATGG - Intergenic
1189861143 X:45273691-45273713 ATGAGGGTCTTCAAGGGAGAAGG + Intergenic
1190878307 X:54475097-54475119 CTGTGGGCTGTCAGGTGAGATGG - Intronic
1191918604 X:66229435-66229457 CTTTGGGGATTCAGGGGAAAGGG + Intronic
1192231998 X:69271845-69271867 CTGAGAGTCTTGAGAGGAGAAGG - Intergenic
1195289999 X:103423465-103423487 CTGTGGGTCTGCAGTGGTGGTGG - Intergenic
1195858801 X:109358703-109358725 CTCTGGGTCTTCAGGGATCACGG + Intergenic
1197556347 X:127959690-127959712 CTTTGGGAATTCAGGGGATAAGG - Intergenic
1198730412 X:139721985-139722007 ATGTAGGTTTTCAGAGGAGAGGG - Intergenic
1199020084 X:142868740-142868762 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1199559904 X:149151292-149151314 TTGTGGGTCTTCAGGTTTGAGGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200690913 Y:6305983-6306005 CTGTGGGCCTTCCGGGGAGCGGG + Intergenic
1200831314 Y:7690460-7690482 CTGTGGGTCTTTTGGGGAGCGGG + Intergenic
1200840200 Y:7774037-7774059 CTGTGAGTCTCCTGGGGATATGG - Intergenic
1201044359 Y:9868733-9868755 CTGTGGGCCTTCCGGGGAGCGGG - Intergenic