ID: 903575541

View in Genome Browser
Species Human (GRCh38)
Location 1:24337568-24337590
Sequence GAAGTCTCCTAGAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903575541 Original CRISPR GAAGTCTCCTAGAGGGCAGT GGG (reversed) Intronic
900158463 1:1212676-1212698 GAAGTGCCCTGGAGGGCAGGGGG + Exonic
900479985 1:2893307-2893329 GCAGTCTCCTGTGGGGCAGTGGG + Intergenic
903049496 1:20590062-20590084 GCATTCTCCTTCAGGGCAGTAGG + Intronic
903169259 1:21541958-21541980 GGACTTCCCTAGAGGGCAGTGGG - Intronic
903575541 1:24337568-24337590 GAAGTCTCCTAGAGGGCAGTGGG - Intronic
910678130 1:89835234-89835256 GAAGGGTTCTAGAGGGCATTGGG + Intronic
910910114 1:92224466-92224488 TAAGTCTCCTAGAGGAAAATAGG - Intronic
911016602 1:93339567-93339589 GAAGCCACCCAAAGGGCAGTGGG - Intergenic
915016124 1:152735833-152735855 AATGGCCCCTAGAGGGCAGTGGG - Intergenic
915608088 1:156967515-156967537 GAAGTGCCCTTGAGGGCAGGGGG + Intronic
916761355 1:167820407-167820429 AAAATCACCTGGAGGGCAGTCGG - Intronic
918597277 1:186307547-186307569 GCAGTCTCCTTGGGGGTAGTTGG - Exonic
918918929 1:190679840-190679862 GAGATTTCCTAGAGAGCAGTGGG - Intergenic
920004506 1:202823169-202823191 GAAGCCTTCCAGAGGGCAGAAGG + Intronic
920222924 1:204417237-204417259 CAAGCCTGCTAGAGGGCAGAGGG + Intergenic
921553432 1:216567881-216567903 GAAGTCTCCTTGGAGTCAGTAGG + Intronic
924037546 1:239952918-239952940 GAAGTCTTCCAGACTGCAGTCGG + Intergenic
924582493 1:245334546-245334568 GAAGGCTCCTGCAGGGCAGCTGG - Intronic
924607102 1:245544348-245544370 GGAGTCTCCTAGAGTGGAGGAGG + Intronic
1065733893 10:28733993-28734015 GAATTCTCCCTGAGGGCAGAAGG - Intergenic
1068773740 10:60849993-60850015 GCAGTGTCCAGGAGGGCAGTAGG + Intergenic
1070173995 10:73954953-73954975 GAACTCTCGTACAGGGCTGTTGG + Intergenic
1070475455 10:76824908-76824930 GAAGTCCCCTAGAGCACAGGGGG - Intergenic
1071588452 10:86847829-86847851 GAGGTCCCCAAGATGGCAGTGGG - Intronic
1073310135 10:102534476-102534498 GAAGTCCCCTAGGGGACAGGCGG + Intronic
1074691280 10:116006897-116006919 GAAGTCTGCTGTAGGGCACTGGG + Intergenic
1077295764 11:1825577-1825599 CAAGCCTGCTCGAGGGCAGTGGG + Intergenic
1077575882 11:3382944-3382966 AAAGTCTCCATGAGGGCACTGGG + Intergenic
1080400744 11:31933447-31933469 GGAGTCACCTTAAGGGCAGTGGG - Intronic
1080854156 11:36097315-36097337 GAAGTATCCTACACGGCTGTGGG + Intronic
1087795146 11:102448649-102448671 GATGTCTACTATAGGGCACTAGG + Intronic
1088449810 11:109969033-109969055 GGAGTCTCCTAGGGGGCAAGAGG - Intergenic
1092021203 12:5203739-5203761 AATGTCTCCTTGAGGGCATTTGG + Intergenic
1093916345 12:24806298-24806320 ATAGTCTCCTAGATGGCTGTGGG + Intergenic
1095606479 12:44073518-44073540 AAAGTCTCCTTGAGAGCAGTTGG - Intronic
1096520319 12:52181236-52181258 GAGGCCTCCTGGAGGGGAGTGGG - Intronic
1096694552 12:53340315-53340337 GTGGTCTCCTAAAGGGCATTTGG + Intronic
1100303091 12:93325866-93325888 GTAGTCTCTTAGCGGGAAGTGGG - Intergenic
1101379427 12:104201641-104201663 GAAGGACCCTTGAGGGCAGTTGG - Intergenic
1105795090 13:23843745-23843767 GAACTCTGACAGAGGGCAGTGGG + Intronic
1110411335 13:75206526-75206548 GAGCTCTCCAAGAGGGCAGTTGG + Intergenic
1113932699 13:113976681-113976703 GGAGAGTCCTACAGGGCAGTGGG - Intergenic
1119703647 14:76771085-76771107 CAAGTCTCCTGGAGGGGAGATGG - Intronic
1120980028 14:90281027-90281049 GCAGTCTCCCAGAGGGAAGCAGG + Intronic
1121327169 14:93027933-93027955 CAAGTCACCCAGAGAGCAGTGGG + Intronic
1123649879 15:22469523-22469545 AAAGTCTTCTTGAGGGCTGTAGG + Intergenic
1125355817 15:38816490-38816512 GAAGTCTCCTAAAGGGAACGAGG + Intergenic
1128154454 15:65384048-65384070 GCTGGCTCCTAGAGGGCAGGGGG + Exonic
1128243940 15:66120140-66120162 GAAACCTGGTAGAGGGCAGTAGG - Intronic
1128846599 15:70902854-70902876 AAACTCCCCTTGAGGGCAGTGGG + Intronic
1129332572 15:74835403-74835425 GCAGTGTCCCAGAGGGCAGGAGG - Intergenic
1131432098 15:92395207-92395229 GAGGTCTCAAAGAGGGCAGAAGG + Intronic
1131721703 15:95176036-95176058 GAAGATTCCTTGAGGCCAGTAGG - Intergenic
1136495093 16:30638053-30638075 GACTGCTCCTAGAGGGCATTTGG + Intergenic
1136869647 16:33794163-33794185 GTAGTGTCCTACAGTGCAGTAGG + Intergenic
1138118624 16:54380283-54380305 GAAGTTAACTAGAGGGAAGTGGG + Intergenic
1203102525 16_KI270728v1_random:1321892-1321914 GTAGTGTCCTACAGTGCAGTAGG - Intergenic
1146626201 17:34437355-34437377 GAAGTCTGCTGAAGGGCAATGGG + Intergenic
1147366569 17:39963162-39963184 GAACTCCCCTAGAGTCCAGTGGG + Intronic
1148765510 17:50036421-50036443 GAAGTCTTCTAGGAGGCAGCAGG - Intergenic
1148925407 17:51080552-51080574 GAAGTTTTCTAGTAGGCAGTTGG - Intronic
1149080251 17:52647689-52647711 GAAGTCTCCAAGAGAGCTTTAGG + Intergenic
1149163315 17:53720823-53720845 GAAGCCTGCCAGAGGGCAGCTGG - Intergenic
1150696660 17:67411417-67411439 AAAGTCTCCTAGAAGGTGGTTGG + Intronic
1150939730 17:69678298-69678320 TCAGACTCCTAGAGGACAGTTGG + Intergenic
1160876286 19:1297693-1297715 GAAGCATCCTGGAGTGCAGTGGG - Intronic
1161064706 19:2231916-2231938 GAAGTCTCCTTGAGCCCACTGGG + Exonic
1161882525 19:6966306-6966328 GAAGGCTCCTAAAGAGGAGTAGG + Intergenic
1163817120 19:19473515-19473537 GCAGTCACCAAGAGGGCGGTGGG + Intronic
1167697980 19:51026135-51026157 GAGGTCTGCTGGAGGGGAGTAGG + Intronic
926733022 2:16051442-16051464 GAAGCCTCCTGGTGGGGAGTAGG + Intergenic
930215845 2:48696371-48696393 CAAGTTTCCCTGAGGGCAGTAGG + Intronic
936400195 2:112158930-112158952 GATGTCTTCTAGATGGCAGATGG - Intronic
937829791 2:126406980-126407002 GGAGTAACCTAGAGGACAGTAGG - Intergenic
942597808 2:177608831-177608853 GAAGTCTCCTGGAAGGCTGCTGG - Intergenic
943182970 2:184567327-184567349 AAAGTTTTCTAGAAGGCAGTAGG - Intergenic
946330047 2:219003884-219003906 GAAGGTTCCTAGGAGGCAGTGGG - Intronic
948703442 2:239775073-239775095 GAAACCTCCCAGAGGGCAGGAGG + Intronic
949075925 2:242057852-242057874 GAGGCTTCCTAGAGGGCAGGGGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171135101 20:22688527-22688549 GGAGTCCCCTGGAGGGCTGTGGG - Intergenic
1171375552 20:24691934-24691956 GAAGTTTCCTAGAGGGCTAGTGG - Intergenic
1174142349 20:48424688-48424710 GGAGTGTGCTAGGGGGCAGTGGG - Intergenic
1174193157 20:48754595-48754617 GAGGTGTCCTTGGGGGCAGTCGG - Intronic
1179092653 21:38281422-38281444 GCAGACTACTAGAGGGCTGTGGG - Intronic
949278900 3:2323209-2323231 GAAGTCTCCTATAGGAAAGCCGG + Intronic
949948301 3:9207774-9207796 CAATTCTCCAAGAGGGCAGGCGG + Intronic
951102339 3:18703515-18703537 GAATTATCCTTCAGGGCAGTGGG - Intergenic
952236219 3:31482683-31482705 GAAGTCTCCAAGAGAGAACTAGG - Intergenic
952320836 3:32276314-32276336 GCAGCTCCCTAGAGGGCAGTGGG + Intronic
954995204 3:54875013-54875035 GTAGTTGCCTAGAGGGTAGTAGG - Intronic
960869850 3:122237812-122237834 GAACTCTCATAGAGTGCAGTGGG + Intronic
962105457 3:132384061-132384083 GAAGACTACTAGTTGGCAGTGGG + Intergenic
964886897 3:161493822-161493844 GAAGACTACTAGAGGGCATAGGG - Intergenic
968434780 4:578843-578865 GAAGCCTCTGTGAGGGCAGTGGG - Intergenic
969221220 4:5759981-5760003 GAAGACTCCAAGCGGGAAGTGGG + Intronic
969843605 4:9901817-9901839 GAAGCCGCCTAGAGGTCAGAGGG - Intronic
971761060 4:30765875-30765897 GAGGTTTACTAGAAGGCAGTCGG + Intronic
975123151 4:70751217-70751239 GAAGACTACTAGAGGGTGGTGGG - Intronic
977325675 4:95572194-95572216 GAACTCACCTTCAGGGCAGTGGG + Intergenic
986535781 5:8785494-8785516 GAAGTTTCCTAGAGTGGAGGTGG - Intergenic
989604022 5:43226911-43226933 GAAGGCCTCTAGAAGGCAGTGGG + Intronic
990206071 5:53430829-53430851 GAATTCCACTAGAGGGCAGTTGG - Intergenic
991075407 5:62531028-62531050 GCAGACTACTAGAGGGCAGAGGG - Intronic
994183826 5:96797084-96797106 GAAGTCTGCCTGAGCGCAGTGGG - Intronic
995257618 5:110065239-110065261 GTAGTCTCCCAGAGGAGAGTGGG - Intergenic
998363202 5:141609240-141609262 GGATTCTCCTAGAGTTCAGTTGG - Intronic
1000883104 5:166719758-166719780 GAATTCTCCCAGAGAGCAGGAGG + Intergenic
1001876809 5:175208742-175208764 TTAGTCTCCTAGAGTGCAGCGGG + Intergenic
1005322508 6:24668604-24668626 GAAGTCTCCTATTGGCCACTTGG + Intronic
1006449268 6:34096594-34096616 GATGTCTCCCAGAACGCAGTGGG - Intronic
1006913047 6:37576550-37576572 GACATCTCCCAGAGGGCAATAGG - Intergenic
1007818282 6:44540565-44540587 GATGTCTCCTAGATGTCTGTAGG - Intergenic
1008015993 6:46520292-46520314 GAAAACTCCTACAGGGGAGTGGG - Intergenic
1008767338 6:54934767-54934789 AAAGTCTCATATAGAGCAGTTGG - Intronic
1010385187 6:75271793-75271815 GTAGTCTGCTAGAGGGCAAAGGG - Intronic
1011635310 6:89366835-89366857 GAAGACCCCTAAAGGTCAGTGGG - Exonic
1013415713 6:109922674-109922696 AAAGTCCCTGAGAGGGCAGTGGG + Intergenic
1015809319 6:137145975-137145997 GACTTCTCCTTGAGGGCTGTTGG + Intronic
1019118591 6:169785362-169785384 GAAGTCCCCATGAGGCCAGTAGG + Intergenic
1023223702 7:37947549-37947571 GAAGTCTCCTCTAGTGCATTGGG + Intronic
1024702161 7:51915824-51915846 GAAGACTACTAGAGAGCAGAGGG + Intergenic
1026431081 7:70347810-70347832 CAAGTCTCCCAGAGGGTAGAAGG - Intronic
1032874512 7:136023295-136023317 TAAGTCAACTAGAGGGCAGCTGG + Intergenic
1033552002 7:142455852-142455874 GAGGACTCCCAGAGCGCAGTGGG - Intergenic
1033554273 7:142474785-142474807 AAGCACTCCTAGAGGGCAGTGGG - Intergenic
1033556542 7:142492890-142492912 GAGCCCTCCTAGAGGGCAGTGGG - Intergenic
1033558906 7:142512344-142512366 GAGCCCTCCTAGAGTGCAGTGGG - Intergenic
1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG + Intronic
1034445038 7:151109705-151109727 GAGGTCTCTTAGAGGGGAGATGG + Intronic
1034850056 7:154485100-154485122 AAAGTCCCCTCGAGGGCACTTGG + Intronic
1038566306 8:28622632-28622654 GGAGCCTCCCAGGGGGCAGTGGG + Intronic
1039202916 8:35116594-35116616 GAGGGCTACTAGAGGGCAGAGGG - Intergenic
1044946034 8:97391044-97391066 GAGGTCTGCTAGAGGGAAATGGG - Intergenic
1045164283 8:99586019-99586041 GAAGGCTCACAGAGGGCAGCAGG - Intronic
1047742276 8:127816142-127816164 GATGTCACCTACAGGCCAGTTGG + Intergenic
1048442995 8:134473760-134473782 GCAGATACCTAGAGGGCAGTTGG - Intergenic
1049214469 8:141401469-141401491 GGAGGCTCCGAGAGGGCAGCGGG + Intronic
1050108533 9:2191006-2191028 GAGGTCTCATGGAGGACAGTGGG - Intronic
1050513420 9:6417149-6417171 GAAGTGGCTGAGAGGGCAGTGGG - Intronic
1056102381 9:83312197-83312219 GGAGGTTCCTAGAGGGCAGAAGG - Intronic
1057585257 9:96323164-96323186 GAGGTCTCCTAGAATGCACTGGG - Intronic
1060224269 9:121781815-121781837 GAAGCCACCAGGAGGGCAGTGGG + Intronic
1060553638 9:124497472-124497494 GAAGACCCCAAGAGGGCATTTGG + Intronic
1061864498 9:133485395-133485417 GAGGTCTCCGAGGGGACAGTAGG + Intergenic
1188233512 X:27696849-27696871 GAAGACACTTAGAGGGAAGTTGG + Intronic
1189884225 X:45523792-45523814 GAAATATCCTTGTGGGCAGTGGG + Intergenic
1195679662 X:107534996-107535018 GCAGTTGCCTAGTGGGCAGTAGG + Intronic
1199935275 X:152567323-152567345 GAAGTCACTTAGAGGGCATGTGG + Intergenic