ID: 903577286

View in Genome Browser
Species Human (GRCh38)
Location 1:24346743-24346765
Sequence AAACCTAGCTCCAAGGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903577286_903577294 -6 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577294 1:24346760-24346782 AGGTTTAGGTTAAGACTTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 137
903577286_903577303 26 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577303 1:24346792-24346814 GGAGGGAACCTCAGGCTGCTTGG 0: 1
1: 0
2: 1
3: 40
4: 252
903577286_903577302 18 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577302 1:24346784-24346806 GGGGGTAAGGAGGGAACCTCAGG 0: 1
1: 0
2: 4
3: 25
4: 256
903577286_903577301 9 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577301 1:24346775-24346797 CTTGGGGGTGGGGGTAAGGAGGG 0: 1
1: 1
2: 12
3: 156
4: 1162
903577286_903577291 -9 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577291 1:24346757-24346779 GCTAGGTTTAGGTTAAGACTTGG 0: 1
1: 0
2: 0
3: 3
4: 60
903577286_903577299 5 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577299 1:24346771-24346793 AAGACTTGGGGGTGGGGGTAAGG 0: 1
1: 1
2: 14
3: 130
4: 832
903577286_903577300 8 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577300 1:24346774-24346796 ACTTGGGGGTGGGGGTAAGGAGG 0: 1
1: 0
2: 6
3: 158
4: 1113
903577286_903577295 -3 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577295 1:24346763-24346785 TTTAGGTTAAGACTTGGGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 301
903577286_903577297 -1 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577297 1:24346765-24346787 TAGGTTAAGACTTGGGGGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 245
903577286_903577298 0 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577298 1:24346766-24346788 AGGTTAAGACTTGGGGGTGGGGG 0: 1
1: 0
2: 1
3: 36
4: 421
903577286_903577292 -8 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577292 1:24346758-24346780 CTAGGTTTAGGTTAAGACTTGGG 0: 1
1: 0
2: 1
3: 8
4: 129
903577286_903577293 -7 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577293 1:24346759-24346781 TAGGTTTAGGTTAAGACTTGGGG 0: 1
1: 0
2: 0
3: 20
4: 210
903577286_903577296 -2 Left 903577286 1:24346743-24346765 CCTTACCCCTTGGAGCTAGGTTT 0: 1
1: 0
2: 0
3: 9
4: 130
Right 903577296 1:24346764-24346786 TTAGGTTAAGACTTGGGGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903577286 Original CRISPR AAACCTAGCTCCAAGGGGTA AGG (reversed) Intronic
900540342 1:3199585-3199607 AAACCTAGCTCCAGGAGCCAGGG - Intronic
902813243 1:18901523-18901545 AAACCTAGCTCCGAGCTGGAGGG + Intronic
903366939 1:22810969-22810991 ACACCTCACTCCAAGGGGCAGGG - Intronic
903577286 1:24346743-24346765 AAACCTAGCTCCAAGGGGTAAGG - Intronic
904978088 1:34473696-34473718 AAGCCTGGCTCCAATGGGTGTGG - Intergenic
905521029 1:38600149-38600171 AATCCTAGCTGCAAAGGATATGG + Intergenic
911593923 1:99779607-99779629 AAACCTAACTCCCAGTGGGATGG + Intergenic
911733659 1:101314759-101314781 ATACCTAGCTGCAAGGTGTATGG - Intergenic
913103114 1:115587751-115587773 GAACATTGCTCCCAGGGGTAGGG + Intergenic
914847531 1:151291235-151291257 AAACCAGGCTCCAAGAGGAAGGG - Exonic
916180699 1:162081163-162081185 AAACCTATCCCCATGGGATAGGG - Intronic
918547473 1:185701100-185701122 AAAACTGGGTCCAAGGGGCAGGG + Intergenic
919337448 1:196255491-196255513 ACATCTAGCTCCAAGGGATTGGG - Intronic
923423294 1:233842739-233842761 AATACAAGCTCCATGGGGTAAGG + Intergenic
924851225 1:247833342-247833364 AGAGCTTGCTCAAAGGGGTAAGG - Intergenic
1064377548 10:14810520-14810542 ACATCTAGCTCCAAGGATTATGG + Intergenic
1069578701 10:69549546-69549568 AAACCTACCTCCAAAGGCCAAGG - Intergenic
1073597160 10:104812648-104812670 AAACCTGGTTCCAATGGGAAAGG - Intronic
1078584799 11:12574149-12574171 ACACCTACCTCCAAAGGCTAGGG - Intergenic
1080441684 11:32300197-32300219 AAACCTCTTTCCAAGTGGTAGGG + Intergenic
1080578403 11:33621287-33621309 ACCCTTAGCTCCAAGGGGTTTGG + Intronic
1080904940 11:36534431-36534453 ACACCTAACTCCAAGGGGGCAGG - Intronic
1081179804 11:39971251-39971273 AAAGATATCACCAAGGGGTAGGG - Intergenic
1081603120 11:44509088-44509110 GAACATAGCTCCCTGGGGTAGGG + Intergenic
1085118603 11:73952070-73952092 AAATCTAGCTGCATGAGGTAAGG - Intronic
1088756039 11:112886161-112886183 AAACCTACCTTCAAGTTGTAGGG - Intergenic
1090792188 11:130100322-130100344 AAACTTATTTCCAGGGGGTATGG - Intronic
1090963979 11:131582108-131582130 AAAGCTGGCTCCCAGGGGCAGGG - Intronic
1092154305 12:6272502-6272524 AAAGGTAGCTGCAAGGGGTTTGG + Intergenic
1092275786 12:7060157-7060179 ACACCTGGCTTCAAGGGTTATGG + Intronic
1094505532 12:31057735-31057757 ACACCTAGCTGCAAGGGGGGTGG - Intergenic
1100106012 12:91173245-91173267 ATCCCTAGCTCCAGGGGATATGG - Intronic
1102443065 12:112978322-112978344 AAACCTTGCTGCAAGGGGCGGGG + Intergenic
1106424420 13:29612081-29612103 AAGGCTAGCACCAAGGGGGAAGG - Intergenic
1107225409 13:38043399-38043421 AGACCTAGTTCCTAGGAGTAAGG + Intergenic
1107225414 13:38043425-38043447 AGACCTAGTTCCTAGGAGTAAGG + Intergenic
1114179912 14:20357462-20357484 AAACATAGCACCAAGGGGCTGGG + Exonic
1114854030 14:26415900-26415922 AAATCAAGATCCAAGGGGGATGG - Intergenic
1115467744 14:33734689-33734711 AAAACCAGCTCCGAGGGGTGAGG + Intronic
1115539251 14:34403437-34403459 ACACCAAGCTCCAAGGTGCAAGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1122392429 14:101399385-101399407 AACCCTACCTCAAAGGGGGAGGG + Intergenic
1125826779 15:42683120-42683142 AACCCTTGCTCCAAGGAGTCTGG - Intronic
1128727270 15:69997543-69997565 AAACCTAGCCCCAAAGCCTAAGG + Intergenic
1129169669 15:73799904-73799926 AGAACTAGCTCCAAGGGCTCTGG + Intergenic
1130001767 15:80054059-80054081 TGACCTAGATTCAAGGGGTAGGG - Intergenic
1133489321 16:6251570-6251592 CCCCCTACCTCCAAGGGGTAGGG - Intronic
1133864698 16:9631819-9631841 AAACTTAGCTCACAGGGGAAAGG - Intergenic
1134146717 16:11770886-11770908 ATACCTCGCACCAATGGGTAAGG + Exonic
1134783752 16:16922441-16922463 AAACATTGCTCCAAGTGGAACGG + Intergenic
1136635813 16:31522175-31522197 AAACCAAGCTTCAAGGGATGTGG - Intergenic
1136638194 16:31539320-31539342 AAACCAAGCTTCAAGGGATGTGG + Intergenic
1138417728 16:56880690-56880712 AAACCTAGTTCCAAGGGCCTAGG + Intronic
1138761010 16:59544119-59544141 AAACCTGGCTACAATGGATATGG - Intergenic
1142386079 16:89765536-89765558 AAAACTGCCTCCCAGGGGTAGGG + Intronic
1146755606 17:35429468-35429490 AAACCTAGACCCAAGGTTTAAGG - Intronic
1146761913 17:35486668-35486690 AAACCTAGACCCAAGGTTTAAGG - Intronic
1147059073 17:37859658-37859680 CAACCCAGGACCAAGGGGTAAGG + Intergenic
1149355922 17:55839473-55839495 AAACCAGGCTCCATGGGGTTGGG - Intronic
1149644374 17:58229001-58229023 AAACATAGCTCACAGGGCTAGGG - Intronic
1150720429 17:67609801-67609823 AAACCTGGATCCAAGGGATGTGG - Intronic
1153838323 18:8983960-8983982 AAACAAAGCTGCAAGGGGAAGGG + Intergenic
1153955504 18:10092615-10092637 CAACCTGGATCCAAGGGGAACGG - Intergenic
1156340119 18:36203094-36203116 AAACCTATAACCACGGGGTAAGG - Exonic
1156530027 18:37806149-37806171 ACACCAAGCTCCCAGGGGCAGGG - Intergenic
1158714030 18:59862251-59862273 AAACCTAACCCCAAGGGCTTAGG + Intergenic
1160330134 18:77983576-77983598 AAACCCAGCTCCCAGAGGAAGGG - Intergenic
1161476306 19:4487660-4487682 AAAACCAGCTCCCAGGGGCAAGG + Intronic
1164463240 19:28465945-28465967 AAAAGTGGCTCCCAGGGGTAGGG + Intergenic
926977097 2:18526011-18526033 ATACTTATCTCCAAGGGATATGG - Intergenic
931851903 2:66260096-66260118 AAACCGATCTCCAGGGGTTATGG + Intergenic
932281797 2:70499234-70499256 ATACCTAGCTCCAAGGAGACCGG - Intronic
933529002 2:83481850-83481872 AAATCTAGCTCAAAGAGTTAGGG - Intergenic
935782927 2:106523798-106523820 AGACGTAGCTGCAAGGGGGAAGG + Intergenic
936117954 2:109717289-109717311 AAACCCAGTTCCACGGGGTGCGG + Intergenic
937861898 2:126717983-126718005 AGACCTGGCTCCCAGGGGTCAGG + Intergenic
945615873 2:212065807-212065829 AATCCTAGCTCTATGGGGTTGGG - Intronic
946904904 2:224406645-224406667 AAACCAAGATCCAAGGAGTAGGG + Intergenic
947113945 2:226749302-226749324 AAAACTATCTCTAAAGGGTAAGG - Intronic
948078669 2:235187730-235187752 AGACCTAGAGCCAAGGGGTAGGG - Intergenic
1170042376 20:12052259-12052281 AAACTTAGCTCCAAGTGGGGGGG + Intergenic
1172095102 20:32456690-32456712 AGACCGAGCTCCAAGGGTTTGGG + Intronic
1173311683 20:41901949-41901971 ATACCTACCTCAAAGGGATATGG - Intergenic
1173851549 20:46221632-46221654 GAACCCAGGTTCAAGGGGTAGGG + Intronic
1176088371 20:63308173-63308195 AAATCGAGCTCCAAGTGGTGTGG + Intronic
1183309565 22:37102050-37102072 AGGCCTAGATCCAAGGGGTCAGG - Intronic
950109581 3:10410489-10410511 AAACCGAGGTCCAAGGGGCAGGG - Intronic
950556147 3:13697251-13697273 AAACCTAGACCCAATGGGAACGG + Intergenic
953796431 3:45989561-45989583 AATCATAGGTCCAAGGGGTTGGG - Intronic
959829790 3:110847017-110847039 ATACCTAACTTCAAGGGATAGGG - Intergenic
961734261 3:128991448-128991470 AAGCCTAGTCCCAAGGCGTAAGG + Intronic
963715512 3:148798458-148798480 AATTCTAGCTCTAAGGGGTATGG - Intronic
964181437 3:153892229-153892251 AGAACTATCTCCAAGGAGTAAGG + Intergenic
967042682 3:185708077-185708099 ACACCTAGTTCAAAAGGGTAAGG - Intronic
968016352 3:195337848-195337870 AAAACTAGGTCGAAGAGGTAAGG - Intronic
970594700 4:17589493-17589515 ATACCTAGCCCACAGGGGTATGG - Intronic
971385170 4:26135490-26135512 AAACCGAGCTCCAGTGGGTTGGG + Intergenic
976249870 4:83039419-83039441 AACCCCAGATTCAAGGGGTAGGG + Intronic
976336582 4:83894857-83894879 AAGCCTAGCTACAAGGAGTCTGG - Intergenic
976868619 4:89762613-89762635 AAACCTGGCACCCAGGAGTAAGG + Intronic
977105085 4:92872754-92872776 AGCCCTGGGTCCAAGGGGTAAGG - Intronic
977940374 4:102851217-102851239 ATAGCTAGATTCAAGGGGTAAGG - Intronic
980898117 4:138879095-138879117 AAAACTACCTCCTAGGGGTCGGG + Intergenic
986728372 5:10617144-10617166 AATCCTAGCTCCCAGTGGAATGG - Intronic
987253129 5:16120688-16120710 AACCCTAGATTCAAGGGGTGGGG - Intronic
987257493 5:16171259-16171281 CAACTTAGCTCCATGGGGTTGGG - Intronic
987423203 5:17745175-17745197 AAACCTGGCTCTAAGTAGTATGG + Intergenic
989397821 5:40977486-40977508 ATACCCAGGTCCAAGGAGTAAGG + Intronic
992063476 5:73081622-73081644 AGACCTATCTCAAAGGAGTAAGG - Intronic
992739010 5:79754405-79754427 AAACCTACCTCCTTGGGTTATGG - Intronic
993141123 5:84034831-84034853 AAACGTATCTCCCAGGGGTGAGG - Intronic
1004817663 6:19330192-19330214 AAACAGATCTCCAAGGGGGATGG + Intergenic
1005468202 6:26136093-26136115 AAACCTAGCTCCACAAAGTAGGG + Intronic
1007847821 6:44775267-44775289 AAGCTTGGCTCCAAGGGGCAGGG - Intergenic
1018727050 6:166620997-166621019 AATCCTACCTCCACGGGGCAAGG + Intronic
1019270044 7:141882-141904 AAACCCACCTCCAACGGGGAAGG - Intergenic
1022068712 7:26888033-26888055 AACACTAGCTCAAAGGGGTCTGG + Intronic
1023642536 7:42274650-42274672 AAAAATAGCTCTAAGTGGTAAGG + Intergenic
1030158997 7:106488400-106488422 AAACCTAGCTTCACTGGGTTTGG + Intergenic
1032713186 7:134480742-134480764 AAGACTAACTCCAAGGGGTCAGG - Intergenic
1033349092 7:140547182-140547204 AACCCTAGGTCAAAGGGGCAAGG - Intronic
1034463278 7:151210344-151210366 AAAAGTAGCTCCAAGGGGGTGGG - Intronic
1044179431 8:89170181-89170203 AAACATAGCTCTGAGAGGTAAGG + Intergenic
1045773127 8:105768886-105768908 AAATCAAGCTCCAAGGAGTTGGG - Intronic
1047232502 8:123009416-123009438 AAATCTAGGTGCAAGGCGTAAGG - Intergenic
1049199114 8:141331289-141331311 AAACCCAGCTCCCAGGGGCTGGG - Intergenic
1050107406 9:2179605-2179627 CAACAAAGCTCTAAGGGGTAAGG - Intronic
1050593316 9:7182004-7182026 AAACCTAGCTCCAAGTGTTTTGG + Intergenic
1054879116 9:70126401-70126423 ACACCTACCTCCATGGGGTAAGG - Exonic
1056408399 9:86299174-86299196 AAACCTAGCTCAAACGGAGAAGG - Intronic
1057583881 9:96312524-96312546 AAACCAAGCTCCAGGGAGAAGGG - Intergenic
1186655638 X:11609081-11609103 AAACCTGGCTCCATTGGTTAGGG + Intronic
1187475880 X:19610422-19610444 AAACCTAATTCCAAGAGTTAGGG - Intronic
1189072350 X:37877064-37877086 ACACCTAACTGCAAGGGGTCTGG + Intronic
1189205532 X:39235260-39235282 CAACCCAGATTCAAGGGGTAGGG + Intergenic
1189256003 X:39639846-39639868 AAACCTAAAGCCAAGGGGGAAGG - Intergenic
1196249261 X:113440150-113440172 ACACTGAGCTCCAAGGGGAATGG - Intergenic
1196735885 X:118980774-118980796 AAGCCTAGATCCTAGGGCTAAGG + Intronic
1200253291 X:154565125-154565147 AAACCAAGCTCCAAGGAGGAAGG - Intergenic
1200264476 X:154639290-154639312 AAACCAAGCTCCAAGGAGGAAGG + Intergenic