ID: 903578235

View in Genome Browser
Species Human (GRCh38)
Location 1:24352411-24352433
Sequence GACTGAAGACAGCTAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903578232_903578235 -1 Left 903578232 1:24352389-24352411 CCAGGGGTTTAATGTGACTCAGG 0: 1
1: 0
2: 0
3: 18
4: 109
Right 903578235 1:24352411-24352433 GACTGAAGACAGCTAGAAGGTGG 0: 1
1: 0
2: 3
3: 15
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903578235 Original CRISPR GACTGAAGACAGCTAGAAGG TGG Intronic
900460607 1:2800723-2800745 GAATGCAGCCAGGTAGAAGGCGG + Intronic
901751041 1:11408865-11408887 GCCTGAAGAGAGAGAGAAGGGGG - Intergenic
903578235 1:24352411-24352433 GACTGAAGACAGCTAGAAGGTGG + Intronic
905008784 1:34732651-34732673 GACTGAAGTCAGAAAGATGGAGG - Intronic
908577734 1:65478718-65478740 GAAAGAAGTAAGCTAGAAGGTGG + Intronic
910277880 1:85467259-85467281 GAATGAAGATTGCTAGATGGTGG - Intronic
912582686 1:110734709-110734731 CGCTAAAGACAGCTGGAAGGAGG - Intergenic
913444808 1:118939531-118939553 CACTGAAGACTGCTAGATGGTGG + Intronic
913690220 1:121272541-121272563 GAGTTAAGACAGCGAGAATGAGG + Intronic
914926349 1:151891876-151891898 GACAGATGACAGCAACAAGGAGG + Intronic
919024931 1:192156022-192156044 GAGTGAAGAGAGCTAGAAAAGGG + Intergenic
920190143 1:204188530-204188552 TTCAGCAGACAGCTAGAAGGGGG - Intergenic
920477540 1:206291028-206291050 GAGTTAAGACAGCGAGAATGAGG + Intronic
1063443775 10:6095157-6095179 CACTGAAGACATCTATCAGGAGG + Intronic
1063482120 10:6385210-6385232 GGGTGAAGACAGCCTGAAGGAGG + Intergenic
1065343989 10:24731199-24731221 CACAGAAGAAAGCTGGAAGGAGG - Intergenic
1065743868 10:28821054-28821076 CACTGCAGACAACTAGAGGGAGG - Intergenic
1065784368 10:29199670-29199692 GAATCAAGGCAGCCAGAAGGTGG - Intergenic
1068937616 10:62651249-62651271 GAGTGAAGACAAAGAGAAGGAGG - Intronic
1069258900 10:66369298-66369320 GACTTTAGACAGCTGGAAAGCGG - Intronic
1069441493 10:68432864-68432886 GATAGAAGACAGGGAGAAGGTGG - Intronic
1069828126 10:71266580-71266602 GGCTGATGCAAGCTAGAAGGAGG - Intronic
1069957822 10:72062444-72062466 GAAAGAAAACAGCTACAAGGAGG + Exonic
1070337821 10:75470699-75470721 GACTGAGGGCACCTACAAGGAGG - Intronic
1070714824 10:78711817-78711839 GATGGAGGACAGCTAGAAGGTGG - Intergenic
1071025365 10:81106902-81106924 CACTGTGGACTGCTAGAAGGGGG + Intergenic
1074335641 10:112571967-112571989 CACTGGAGACAACTAGAAGGGGG + Intronic
1075622330 10:123937028-123937050 GGCCAACGACAGCTAGAAGGTGG + Intronic
1076783874 10:132739413-132739435 GACAGAAGGCAGCGGGAAGGTGG + Intronic
1077559974 11:3254063-3254085 AAGTGTTGACAGCTAGAAGGAGG - Intergenic
1077565867 11:3299866-3299888 AAGTGTTGACAGCTAGAAGGAGG - Intergenic
1080193736 11:29582701-29582723 CACTGCAGACTACTAGAAGGGGG + Intergenic
1080310856 11:30890054-30890076 GTGTGAACACAGCAAGAAGGTGG + Intronic
1086875058 11:92085843-92085865 GACTGAAAACACCTAGATGGTGG + Intergenic
1088708831 11:112487873-112487895 GAATGAAGCCAGGTAGAAGTTGG + Intergenic
1090219794 11:125009660-125009682 CACTGAAGACTACTAGAGGGAGG - Intronic
1090929891 11:131287803-131287825 GAATGAAGACAGTTCGAGGGAGG + Intergenic
1091301284 11:134509754-134509776 CACAGGAGACAGCTAGGAGGTGG - Intergenic
1092031940 12:5293763-5293785 TATGGAAGACAGCTAGAAGGAGG + Intergenic
1092276624 12:7066326-7066348 GACTGCAGACAGCTTGCGGGTGG + Intronic
1093351451 12:18107733-18107755 GTGTGCAGACAGCAAGAAGGTGG + Intronic
1093722602 12:22462306-22462328 GACTGTTTGCAGCTAGAAGGGGG - Intronic
1095161420 12:38921083-38921105 GATAGAAGACAGATAGAAGATGG + Intergenic
1095526472 12:43131689-43131711 GAAAGAAGACAGATAGAAGAAGG - Intergenic
1095698222 12:45164696-45164718 GCCTGAAGACAGCCAGAGTGAGG + Intergenic
1095846420 12:46750258-46750280 CACTGGGGACAACTAGAAGGGGG + Intergenic
1098013330 12:66077810-66077832 ATCTGAAGACAGAAAGAAGGGGG - Intergenic
1102473118 12:113171156-113171178 GACAGCAGACAGCAACAAGGGGG + Intronic
1102716470 12:114977743-114977765 CACTGGGGACTGCTAGAAGGGGG - Intergenic
1103518175 12:121520846-121520868 GACTGAAGCCAGCTTGAGAGAGG + Intronic
1103740872 12:123090796-123090818 GACTGAAGCCAGCCTGGAGGTGG + Intronic
1109759112 13:66803580-66803602 TACTGAAGACAGCCAAAAGAAGG - Intronic
1112756049 13:102634801-102634823 GGCTGAAGAGAACTAGAAAGAGG - Intronic
1114567346 14:23642515-23642537 GACTGAAGACAGCCTGATGGAGG - Intronic
1115915830 14:38312889-38312911 CCCTGGAGACTGCTAGAAGGGGG - Intergenic
1116943816 14:50817089-50817111 GAGAAAAGACAGCTAGGAGGAGG - Intronic
1120445071 14:84585265-84585287 TACTGAAAACTACTAGAAGGAGG + Intergenic
1121572470 14:94957304-94957326 GAATGAAGACAGTTGAAAGGTGG + Intergenic
1122717804 14:103705960-103705982 GCCTGGAGACAGCCAGAAGCCGG - Intronic
1122944306 14:104998959-104998981 GACTGCAGACAGCTGGGAAGCGG - Intronic
1123982156 15:25614055-25614077 GAGGGAAGACAGCCAGTAGGAGG - Intergenic
1125567934 15:40692016-40692038 GACTACAGTCAGCTAGGAGGAGG + Intergenic
1127941896 15:63706990-63707012 CACTGAACATAGCTATAAGGAGG + Intronic
1129189529 15:73929235-73929257 AACTGACGACAGCTTGAAAGAGG - Intronic
1129560460 15:76560974-76560996 AACTGAAGACAGCTAGCATCAGG + Intronic
1130384677 15:83400811-83400833 GACAGAAGACAGCACAAAGGAGG + Intergenic
1132810735 16:1795403-1795425 GCCTGAAGACAGGCAGAATGCGG - Intergenic
1133314546 16:4874589-4874611 GACTGCAGAGAGCTAGCTGGTGG - Exonic
1134466422 16:14482708-14482730 GACTGAAGATAGCTGGAAGGAGG - Exonic
1136189532 16:28607384-28607406 GACCTAAGAAAGCTAGAGGGTGG - Intronic
1138438679 16:57021197-57021219 GAGTGAAGCCAGGTAGAAGGAGG - Intronic
1139080004 16:63506018-63506040 ATCTGAGGACAGCTAGAAGTAGG + Intergenic
1139266587 16:65645548-65645570 GACAGAAGACAGGTACAGGGAGG + Intergenic
1140859312 16:79005412-79005434 GACTGAAGCCACCTAGTACGTGG - Intronic
1141845635 16:86606824-86606846 GACAGAAGACAGATACAAAGGGG - Intergenic
1142273797 16:89105144-89105166 GACTGAAGCCAACAAGAATGTGG - Intronic
1143313990 17:6017498-6017520 GAGTGGAGACACCTAGAAGATGG - Intronic
1144128429 17:12223378-12223400 GAAAGGACACAGCTAGAAGGAGG - Intergenic
1144664921 17:17095850-17095872 TCCTGAGGACAGCTAGGAGGAGG - Intronic
1145106620 17:20123141-20123163 GACAGCAGTCGGCTAGAAGGAGG + Intronic
1147794658 17:43033850-43033872 GACAGAAGACAGAAAGCAGGAGG + Intergenic
1148329597 17:46805825-46805847 GACTGAAGTCAGATCTAAGGAGG + Intronic
1148391977 17:47279309-47279331 GCAGGAAGAAAGCTAGAAGGGGG - Intronic
1149300368 17:55299893-55299915 GGCTGCAGTCAGCTAGATGGTGG - Intronic
1149513976 17:57266142-57266164 GACTGAAGGCAACTAGAAATAGG - Intronic
1150197210 17:63312559-63312581 CACTGGGGACTGCTAGAAGGGGG + Intronic
1154203536 18:12317768-12317790 GACTCCAGACAGTTAGCAGGAGG - Intronic
1154943654 18:21138463-21138485 GACTGAAGAAAGAAAGAAGAGGG + Intergenic
1155550423 18:26959300-26959322 CACTGAAGACCACTAGAGGGAGG + Intronic
1155555249 18:27011539-27011561 GAATGAAGGCTGCTAGAATGAGG + Intronic
1156306659 18:35884181-35884203 GTCTGAAGACAGCATGGAGGAGG - Intergenic
1156989695 18:43394158-43394180 GACTGATGAAAGCTTGAAGAGGG + Intergenic
1157638329 18:49184945-49184967 GAATGAGGAGTGCTAGAAGGAGG + Intronic
1158201544 18:54947242-54947264 GATTGAAGACAGCTTACAGGTGG + Intronic
1159291690 18:66431484-66431506 TACTGAGTACAGCTAAAAGGTGG + Intergenic
1160564227 18:79777070-79777092 GGATGAAGACAGCTCTAAGGTGG + Intergenic
1166617840 19:44267099-44267121 GACTGGAGGGAGGTAGAAGGAGG - Intronic
1167692409 19:50994502-50994524 GATTGAAGACAGCTGGAACAGGG + Intergenic
926637022 2:15191858-15191880 GGCTGGAGACAGGTTGAAGGTGG - Intronic
926773260 2:16397087-16397109 GAGGGAATGCAGCTAGAAGGAGG + Intergenic
928455835 2:31420683-31420705 GACTGATGTCAGCAAGATGGTGG - Intergenic
928605839 2:32944765-32944787 CACTGAAGACAGGTAGAGGCTGG + Intergenic
929011045 2:37445254-37445276 GACAGAAGACAGCTACTATGAGG - Intergenic
930605831 2:53492330-53492352 TACTGCAGACTACTAGAAGGGGG + Intergenic
931840881 2:66146770-66146792 GACAGAACCCAGCTAGAAGCGGG + Intergenic
935156262 2:100486197-100486219 GAGTGAAGACAGCTAGCCTGTGG + Intergenic
935538535 2:104322830-104322852 CATGGAAGAGAGCTAGAAGGTGG + Intergenic
935673894 2:105577792-105577814 CACTGAGGACTGCTAGAGGGGGG - Intergenic
937422752 2:121772116-121772138 GATTGAAGACATCAAGAAGATGG + Intergenic
939142528 2:138371996-138372018 GACTGAAGAAAGCAAGAAGGAGG - Intergenic
939412693 2:141851096-141851118 GACTGAAAACAACTAGAACAAGG - Intronic
939855262 2:147351651-147351673 GAGTGAAGACATCTAGGAGAAGG + Intergenic
941963622 2:171278252-171278274 GAAAGGAGACAGCAAGAAGGTGG - Intergenic
942941051 2:181618110-181618132 GACTCAAGAGAGTGAGAAGGGGG + Intronic
943734265 2:191336699-191336721 GACTCCAGACTGCTAAAAGGTGG + Intronic
945092426 2:206187867-206187889 AAATGAAGACAGATAGTAGGTGG + Intronic
945746805 2:213728322-213728344 GACTGCAGAAAGGTAGAAGGAGG - Intronic
1168863216 20:1061128-1061150 CACAGAAGACAGCTGGAAGCAGG + Intergenic
1169679273 20:8192358-8192380 AACTGCAGACTGCTAAAAGGTGG + Intronic
1169773965 20:9231446-9231468 TAGTGAATACAGCAAGAAGGTGG - Intronic
1170326987 20:15167447-15167469 GACTGAATACAGCGAGGAGGAGG - Intronic
1172067624 20:32232980-32233002 GACTGCAGAGAGCTATAACGTGG + Intronic
1174502561 20:50996460-50996482 GACTGGAGACAGCCAGTGGGAGG - Intergenic
1176127903 20:63484156-63484178 GCCTGAGGACAGCTGGAGGGCGG - Intergenic
1177047331 21:16186657-16186679 GCCTGAAGACAGTCATAAGGAGG + Intergenic
1177488714 21:21793274-21793296 GTTTTAAGATAGCTAGAAGGAGG + Intergenic
1178472206 21:32903849-32903871 GACTGGAGACAACCAGAAGTTGG + Intergenic
1179987197 21:44928453-44928475 GACTGAAAGCAGCTCGAATGTGG + Intronic
1181169451 22:21000107-21000129 GAATGAACACAGCTACCAGGTGG - Exonic
1181761308 22:25060522-25060544 AACCGAAGGCAGCTAGAATGTGG - Intronic
1181782293 22:25201911-25201933 GAGTGAAGCCAGCTAGCAGAGGG + Intronic
1182711673 22:32327189-32327211 TACTGATGACGGTTAGAAGGTGG + Intergenic
1182852874 22:33491350-33491372 AACTGCATACAGCTAGAAAGAGG + Intronic
949272595 3:2236980-2237002 GACTGCAGAGAGCAAGATGGAGG + Intronic
950335621 3:12190531-12190553 GGCTGAAGACCGGAAGAAGGAGG - Exonic
950527581 3:13533364-13533386 GACTGAAGGCACCTGCAAGGTGG - Intergenic
950924212 3:16723949-16723971 GACTGAAAATAGCAAGAAGCCGG - Intergenic
951062368 3:18224050-18224072 GTCTGAAGTCAGCCTGAAGGTGG + Intronic
953597974 3:44336199-44336221 GTGTTAATACAGCTAGAAGGTGG + Intergenic
954684510 3:52363107-52363129 CTCAGAAGACAGCTTGAAGGTGG - Exonic
954695089 3:52419892-52419914 GCCTGAAGACATCAAAAAGGAGG + Exonic
956908446 3:73791368-73791390 GCCTGAATAGAGCAAGAAGGTGG + Intergenic
958779914 3:98528537-98528559 GACTGAGGACATCTAGAATAGGG + Intronic
959052276 3:101535790-101535812 GAGTTAATACAGCCAGAAGGTGG + Intergenic
959083832 3:101830482-101830504 CACTGAGGACTGCTAGATGGGGG - Intronic
959102948 3:102034188-102034210 GATTGAAAACAGCAACAAGGAGG + Intergenic
959143784 3:102519399-102519421 GACTGAATATTGCTAGAAGACGG - Intergenic
959166746 3:102789526-102789548 GAATGAGGATAGCTAGAATGTGG + Intergenic
959926037 3:111922930-111922952 GACTGAAGACCTCAAGAAGGTGG - Intronic
960055726 3:113275014-113275036 GACAGAGGAAAGCAAGAAGGAGG - Intronic
960371761 3:116849521-116849543 GAGTGGAGACAGCTGGAAGTGGG - Intronic
960722575 3:120639209-120639231 CACTGGAGACTACTAGAAGGGGG - Intronic
962082377 3:132154132-132154154 GCCTGCAGACAGGGAGAAGGGGG + Intronic
965625543 3:170680895-170680917 GACTGATGAAAGCTAAAATGAGG - Intronic
965784530 3:172321934-172321956 CACTGTAAACAGCTAGAAGGTGG - Intronic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
966850428 3:184161470-184161492 GAGGGAAGACAGCAAGGAGGAGG - Intronic
968565931 4:1312825-1312847 CACTGAAGACACCCAGAAAGTGG + Intronic
973158390 4:46986860-46986882 AACTGACGACAGCTAGAACGTGG - Intronic
973241530 4:47961222-47961244 TGCTGAAGACAGCTTCAAGGAGG - Intronic
974212070 4:58791107-58791129 GACTGAAAACAGCTGGTTGGTGG - Intergenic
975123153 4:70751221-70751243 CACTGAAGACTACTAGAGGGTGG - Intronic
975434703 4:74337856-74337878 GAAAGAACAGAGCTAGAAGGCGG - Intergenic
978097286 4:104793421-104793443 CACTAAGGACAGCTAGGAGGTGG + Intergenic
979183890 4:117763520-117763542 CACTGCAGACTACTAGAAGGAGG - Intergenic
979418670 4:120476302-120476324 GAAGGAAGACAGATAGAAGAAGG + Intergenic
980517016 4:133877258-133877280 GCCTGGAGACAGCAAGAAAGAGG + Intergenic
980712469 4:136588781-136588803 AACTGCAGCCACCTAGAAGGAGG + Intergenic
981136416 4:141215394-141215416 GAGTTAAGACAGCAAGAAAGAGG + Intergenic
981875728 4:149542921-149542943 GTCCAAAGACAGCTAGAAAGTGG + Intergenic
982315899 4:154031578-154031600 CACTGAAGACTACTAGATGGGGG - Intergenic
983016030 4:162613776-162613798 GACTAAAGACAACTAGAAACTGG + Intergenic
983308715 4:166027223-166027245 CACTGAAGACTACTAGATGGGGG + Intronic
985219107 4:187683604-187683626 GACGTCAGACAGCTAGAAAGTGG - Intergenic
988553155 5:32215167-32215189 GACTCAAGACAGGCAGCAGGTGG + Intergenic
988624513 5:32858734-32858756 CACTGAGGACTACTAGAAGGAGG - Intergenic
988804982 5:34731994-34732016 GACTGAAAACAGACAGCAGGAGG - Intronic
991302139 5:65139209-65139231 CACTGAGGACAACTGGAAGGGGG - Intergenic
993861810 5:93145430-93145452 GCCTGAGCACAGCTGGAAGGGGG - Intergenic
994653271 5:102556705-102556727 CACTGCAGACTACTAGAAGGTGG + Intergenic
996031117 5:118704732-118704754 GTCTTCAGGCAGCTAGAAGGAGG + Intergenic
997233905 5:132261654-132261676 AACTGAAGAAGGCTAGAATGGGG - Intronic
997539383 5:134648953-134648975 GACTGAAGACTGGGAGAAGAGGG - Exonic
998097526 5:139404707-139404729 GACTGAAGAGGGCTTGAAGGAGG + Intergenic
1000398386 5:160799447-160799469 AACTGAAGAGGGCTAGAAGGAGG - Intronic
1000644477 5:163744327-163744349 GACTGGAGACTGATAGAAGCGGG - Intergenic
1001482181 5:172096006-172096028 CACTGAGGGCAGCTAGAGGGGGG + Intronic
1002652067 5:180705789-180705811 CACTGAGGACTACTAGAAGGGGG - Intergenic
1004155928 6:13168287-13168309 AAATTAAGACAGCTAGAAAGTGG + Intronic
1004461028 6:15836218-15836240 GCATGAAGAAAGCTAGAAAGGGG - Intergenic
1004769689 6:18768186-18768208 GAGTGAAGAAAACTTGAAGGAGG + Intergenic
1005873267 6:29993410-29993432 GAGGGAAGACAGCCAGAGGGAGG - Intergenic
1007514803 6:42402510-42402532 GACTGAAGGCAGGGGGAAGGGGG + Intronic
1008019149 6:46556242-46556264 GCCTGAAGACTGCCAGAAGCAGG - Intronic
1008499662 6:52168688-52168710 CACTGAAGACTGCTAGAGGGAGG + Intergenic
1009406154 6:63315087-63315109 GACTGAAGATTCTTAGAAGGTGG + Intronic
1010810015 6:80290206-80290228 CACTCAAGTCAGGTAGAAGGGGG + Intronic
1012130271 6:95482117-95482139 CACTGAGGACTACTAGAAGGGGG + Intergenic
1014727264 6:124986461-124986483 GGCTGAAGACAGCTGGAGGAAGG - Intronic
1015003131 6:128244729-128244751 GACTGAAAACCTCTAGTAGGAGG + Intronic
1015076329 6:129162875-129162897 GAATGAAGAGAACTAGGAGGGGG + Intronic
1016352200 6:143180039-143180061 GACTGAGGACAGAAAGACGGTGG - Intronic
1017665107 6:156712474-156712496 GATTGAAGACAGGTACAAAGGGG + Intergenic
1017854200 6:158334872-158334894 GTGTGAGGACACCTAGAAGGTGG + Intronic
1020716980 7:11686816-11686838 AACTGAAGACCACTAGATGGGGG + Intronic
1020760434 7:12262072-12262094 GAGTGGAGACAGCTAGAGGCAGG + Intergenic
1022124435 7:27341854-27341876 CAGTGAAGACAGCTCGTAGGAGG - Intergenic
1023098135 7:36684217-36684239 GACTTGAGTCAGCTTGAAGGAGG + Intronic
1023703734 7:42917971-42917993 ATCTGGAGACAGCTACAAGGAGG - Intronic
1024221759 7:47294241-47294263 CACTGAAAAGAGCTGGAAGGAGG + Intronic
1026837980 7:73650705-73650727 GACTGAAGCCTACTAGTAGGAGG - Intergenic
1027783637 7:82551707-82551729 CACTGGAGACTACTAGAAGGAGG - Intergenic
1027865513 7:83640906-83640928 AACACAAGACAGATAGAAGGAGG + Intronic
1028299045 7:89173695-89173717 GACAGAAGACAGATAACAGGTGG - Intronic
1028587060 7:92462803-92462825 GTAAGAAGACAGCCAGAAGGTGG + Intergenic
1028933382 7:96439428-96439450 CACTGAAGACTACTAGAGGGAGG + Intergenic
1032834104 7:135657799-135657821 GACTGAAGCCTTCCAGAAGGGGG + Intergenic
1033952926 7:146807686-146807708 GACTAAAGACAAGTAGAGGGAGG - Intronic
1034289880 7:149921483-149921505 GATTAAAGAAAGCTAAAAGGAGG - Intergenic
1034661185 7:152771344-152771366 GATTAAAGAAAGCTAAAAGGAGG + Intronic
1034948112 7:155277181-155277203 AACTGCAGAAAGCTAGCAGGAGG + Intergenic
1037588785 8:20295925-20295947 GAGGGAAGACAGCGTGAAGGAGG - Intronic
1040802873 8:51363146-51363168 GACGGAAGACAGCTGTGAGGAGG - Intronic
1040834380 8:51717329-51717351 GAATGAAGAAAGCTGGAAAGGGG + Intronic
1044390391 8:91643368-91643390 AACAGAAGCCAGCTTGAAGGAGG - Intergenic
1044476063 8:92627885-92627907 GACTGAAGGAAGCTTTAAGGCGG + Intergenic
1045134486 8:99199544-99199566 GAATTAAGACAGCAAGTAGGAGG - Intronic
1045750771 8:105481408-105481430 GTGTGCACACAGCTAGAAGGTGG - Intronic
1046313380 8:112468045-112468067 GACTGAAGAGAGATAGAGGTGGG + Intronic
1046958741 8:120087544-120087566 GACAGAAGCCCTCTAGAAGGAGG - Intronic
1052793030 9:32894935-32894957 CACTGGAGACTACTAGAAGGGGG + Intergenic
1052871497 9:33511781-33511803 AAATGGAGACTGCTAGAAGGAGG - Intergenic
1055723830 9:79206127-79206149 GACTGCAGGCATCTAGGAGGAGG - Intergenic
1056904876 9:90637319-90637341 GACTGAAAATAGCAAGAAAGTGG - Intronic
1057201570 9:93143233-93143255 GACTGCAGACGGCAAGCAGGGGG + Intergenic
1060682965 9:125581899-125581921 AACTGAAGACAGATAGGAGTGGG - Intronic
1062205219 9:135332761-135332783 GGCTGCAGACTCCTAGAAGGAGG + Intergenic
1062526984 9:136981880-136981902 GAGTCAGGACAGCTAGGAGGGGG + Intronic
1188204242 X:27333060-27333082 CACTGAAGACTACTAGCAGGTGG + Intergenic
1191047025 X:56149416-56149438 CACTGAAGACTACTAGAAAGTGG + Intergenic
1191095116 X:56665514-56665536 AAGTGAAAGCAGCTAGAAGGGGG + Intergenic
1199799460 X:151235238-151235260 GAATGGAGAAAGCCAGAAGGGGG + Intergenic
1199932335 X:152536204-152536226 GACTGAAGACAGCTAGTACGGGG + Intergenic