ID: 903578552

View in Genome Browser
Species Human (GRCh38)
Location 1:24354129-24354151
Sequence CTGTGAGTGTGGGGGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903578542_903578552 20 Left 903578542 1:24354086-24354108 CCATCCTCGGGTGTACCAGGAGA 0: 1
1: 0
2: 2
3: 5
4: 88
Right 903578552 1:24354129-24354151 CTGTGAGTGTGGGGGCCAGCAGG 0: 1
1: 0
2: 0
3: 40
4: 360
903578543_903578552 16 Left 903578543 1:24354090-24354112 CCTCGGGTGTACCAGGAGAGAGG 0: 1
1: 1
2: 0
3: 6
4: 137
Right 903578552 1:24354129-24354151 CTGTGAGTGTGGGGGCCAGCAGG 0: 1
1: 0
2: 0
3: 40
4: 360
903578546_903578552 5 Left 903578546 1:24354101-24354123 CCAGGAGAGAGGCAATCCGGCGC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 903578552 1:24354129-24354151 CTGTGAGTGTGGGGGCCAGCAGG 0: 1
1: 0
2: 0
3: 40
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903578552 Original CRISPR CTGTGAGTGTGGGGGCCAGC AGG Intronic
901886842 1:12229724-12229746 CTGTGGGTGAGTGGGCCAGACGG + Intergenic
902332077 1:15735598-15735620 CAGTGGGGGTGGGGGCGAGCAGG + Intergenic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
902771833 1:18649610-18649632 CTGGGAGTGTGGGTGATAGCGGG - Intronic
902777780 1:18685650-18685672 CTGTGAGTGAGTGAGCCAGGTGG - Intronic
902987884 1:20166471-20166493 CTGAGAGAGTGGGGGCTACCTGG - Intronic
903233810 1:21937134-21937156 CGGTGAGTGTGCGGGGCAGAGGG - Exonic
903248943 1:22038193-22038215 CAGTGGGTGTGGGGGCCACGAGG + Intergenic
903578552 1:24354129-24354151 CTGTGAGTGTGGGGGCCAGCAGG + Intronic
903795710 1:25927548-25927570 CTGTGAGTCTGGGAGTCAGGGGG + Intergenic
903798182 1:25946103-25946125 CAGTGAGTCTGGGGGCTGGCAGG + Intergenic
904006128 1:27364211-27364233 CTGTGGGTGTGGCCTCCAGCAGG + Exonic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904702570 1:32366609-32366631 CTGGGAGTGAGGGAGCCAGAGGG - Exonic
904839391 1:33362307-33362329 CTGTGAGTCTGGGGTGCAGGAGG + Intronic
905402840 1:37716048-37716070 CTGGGAGGGAGGGGGCCAGTCGG - Exonic
905544784 1:38788988-38789010 CCGTGAGTGTGTGACCCAGCTGG - Intergenic
905930455 1:41783232-41783254 GTGTGGGTGTTGGGGCCAGGAGG + Intronic
906164803 1:43678254-43678276 CTGTGGGTGTGGGAGTCACCAGG + Intronic
907165164 1:52404225-52404247 GGGTGAGTGTGGCGTCCAGCGGG - Exonic
907744202 1:57196427-57196449 CAGTGAGTGTGGGAGGCAGGTGG + Intronic
908329020 1:63052196-63052218 CTGCGAGTGTGGTGGCAAGGAGG - Intergenic
908888902 1:68820313-68820335 CTTTGAGTGTGAGGGCTAGAAGG + Intergenic
912395001 1:109335603-109335625 ATGTGAGCTTGGGGGACAGCTGG - Intronic
912453536 1:109783059-109783081 CAGCGGGGGTGGGGGCCAGCTGG - Intergenic
913229997 1:116733921-116733943 CTGGGAGGGTGGGGGCAAGGAGG - Intergenic
913247118 1:116879602-116879624 GTGTGACTGTGGGCACCAGCAGG + Intergenic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
916840685 1:168597475-168597497 CTGTTGCTGTGGGAGCCAGCTGG + Intergenic
919754648 1:201059168-201059190 GGGTGAGTGTGGGGGCCACCGGG - Exonic
919962461 1:202485405-202485427 ATGTGAGGGTGGGGGGCAGGGGG + Intronic
920627067 1:207612739-207612761 GAGTGAGTGTGGGGTCCAGCTGG + Intronic
921122208 1:212147057-212147079 CTGTGGGTGTGGGGTACAGTAGG - Intergenic
922480693 1:225938594-225938616 CTTTGGGAGTGGAGGCCAGCGGG - Intronic
922784154 1:228274840-228274862 AGGTGAGTGTGGGGGGCAGCAGG + Exonic
923391110 1:233515224-233515246 CGGGGAGTGTGGGGGCCGGCGGG + Intergenic
924301159 1:242639033-242639055 CTGTGAGTGTGGGGGAGTGCTGG - Intergenic
1063174670 10:3540592-3540614 CTGTGTGTGTGGGGGAGAGTGGG - Intergenic
1063602739 10:7497089-7497111 CTATGACTGCGTGGGCCAGCTGG + Intergenic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1064449338 10:15426971-15426993 CTGTGAGGGAAGGAGCCAGCAGG - Intergenic
1067090323 10:43263061-43263083 CTGTCAGTGTGTGAGCCTGCTGG - Intronic
1067735007 10:48844029-48844051 CTGTGAGTGGGGGGCCTAGCGGG - Intronic
1067741173 10:48897081-48897103 GGGTGAGAGTGGGGGCCAGCAGG - Intronic
1068143178 10:53030642-53030664 ATGTGAGAGGAGGGGCCAGCTGG - Intergenic
1068665817 10:59674848-59674870 CTGGGAGTGTGGGGGCAAGATGG + Intronic
1069615724 10:69805033-69805055 CTTTGAGGCTGGGGGCCAGAGGG + Intronic
1070404880 10:76085821-76085843 GTGTGAGTGTGAGGGAGAGCGGG - Intronic
1070900337 10:80022806-80022828 CTGTCAGTGTGGATGCCAGAGGG + Intergenic
1070945352 10:80386807-80386829 ATGAAAGTGTGGGGGCCAGCCGG + Intergenic
1071571021 10:86697085-86697107 CTGTGAGTGTGGGGACATGGGGG + Intronic
1072930709 10:99659587-99659609 CCGTGAGTGTGGGCGCGAGAGGG + Exonic
1073453177 10:103621535-103621557 CTGTGAGGGTGGGGGTCACTGGG + Intronic
1074087428 10:110218909-110218931 CCGTGACAGTGTGGGCCAGCTGG + Intronic
1074870087 10:117569458-117569480 GCATGAGTGTGGGAGCCAGCTGG + Intergenic
1075076845 10:119357660-119357682 CTGTCAATGGTGGGGCCAGCAGG - Intronic
1075646385 10:124099567-124099589 CTGTGGGTGTGGGTGAGAGCTGG + Intergenic
1075813324 10:125244830-125244852 CTGTGGGTGTGGGTGACAGTTGG + Intergenic
1076417866 10:130304449-130304471 CTGAGAGTGCAGGGGCCACCTGG - Intergenic
1076729282 10:132430145-132430167 CTGTGTGTGTGAGGGAGAGCAGG + Intergenic
1076776335 10:132700012-132700034 CTGTGATGCTGGGGGCCTGCTGG + Intronic
1076874913 10:133211206-133211228 CTGGGCGTGTGGGGGCAAGGGGG - Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077375428 11:2203268-2203290 CTGTGCCTGTGGGGCCCTGCAGG - Intergenic
1078087387 11:8242458-8242480 CTGTGTCTCTGGGGGCCAGTGGG + Intronic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1078931376 11:15914356-15914378 CGGTTAAGGTGGGGGCCAGCTGG - Intergenic
1078967999 11:16370029-16370051 CTGAGAGGATGGTGGCCAGCTGG - Intronic
1081412528 11:42776580-42776602 CTGTGACTGTGGGGTCCTGAAGG + Intergenic
1082004574 11:47412464-47412486 CCTTGAGTGTGGGGCCCACCTGG - Exonic
1083048984 11:59760181-59760203 CTGTGAGTGTGGGGGAAGTCGGG + Intronic
1083726651 11:64631933-64631955 CTGAGAGTGTGTGAGCCAGGGGG - Intronic
1084411093 11:69006294-69006316 GTCTGTGGGTGGGGGCCAGCCGG - Intronic
1084422002 11:69065176-69065198 CTGTGGGTGGTGGGGGCAGCTGG + Intronic
1084665376 11:70573534-70573556 CTGTGTGTGTGGGGGCGGGGGGG + Intronic
1084783872 11:71430333-71430355 ATGTGAGTGTGGGATCCGGCCGG + Intronic
1084795417 11:71501816-71501838 CTGGGAGTCTGGGGACCAGTCGG + Exonic
1085607140 11:77911327-77911349 GTGTGAGTTTGGTGGCCAGATGG + Intronic
1086181479 11:83956527-83956549 GAGTGAGTGTGGGATCCAGCTGG - Intronic
1086634150 11:89062801-89062823 CCGTGAGTGCGGAGGCTAGCCGG - Intronic
1087653482 11:100895985-100896007 CAGGGAGTGTGGGGGCCTGGTGG - Intronic
1088360663 11:108985750-108985772 CTGTGAGTGCTGGGACCAGGTGG + Intergenic
1088834945 11:113569598-113569620 CTGTGAGTATAGGGAACAGCAGG + Intergenic
1089043812 11:115481214-115481236 CAGTGAGTGTGGGAACCAGATGG - Intronic
1089079019 11:115760799-115760821 CAGAGAGTGGGGTGGCCAGCGGG - Intergenic
1089140687 11:116281586-116281608 CTCTGACTGTGGGGCCCAGGAGG - Intergenic
1090068727 11:123525758-123525780 AGGTGAGGGTGGGGGGCAGCCGG + Exonic
1091477915 12:795389-795411 GTGTCAGTGGCGGGGCCAGCTGG + Intronic
1091825838 12:3512007-3512029 TTGGGAGTGTGGGGGGCAGTGGG + Intronic
1092036943 12:5344333-5344355 ATGGGAGTGTGGGCGGCAGCAGG + Intergenic
1093005189 12:14043740-14043762 CTGTGAGGGTGGGGCACAGTGGG - Intergenic
1095683246 12:45003089-45003111 CTGTGAGTGAGAGGGAGAGCAGG - Intergenic
1096153607 12:49329938-49329960 CTGTTAGAGTGGGGTCCAGAAGG - Exonic
1096408277 12:51359308-51359330 GTGGCAGTGTGGGGGCCAGCTGG - Exonic
1097185736 12:57195398-57195420 CTGTGAGTGGCGGGGCCACGTGG + Exonic
1098170744 12:67744512-67744534 CTTTGAGTGTGGGGGCACTCAGG - Intergenic
1102644671 12:114396305-114396327 CGGGGACTGTGGCGGCCAGCGGG - Intronic
1103140491 12:118543780-118543802 CTGTGGCTGTTGGGGACAGCAGG + Intergenic
1103323022 12:120102641-120102663 CTGGGAGTATGGGGGAGAGCAGG - Intronic
1103802286 12:123546456-123546478 CTGTGTGTGTGTGAGTCAGCAGG + Intergenic
1103952313 12:124557928-124557950 CTGTCAGCATGGGGGCCTGCAGG - Intronic
1104849153 12:131863107-131863129 CGGTGAGTGGGTGGGTCAGCGGG - Intergenic
1104872735 12:132011951-132011973 CTGTGCCTGTGGAAGCCAGCAGG - Intronic
1108797024 13:54044175-54044197 CTGTGGGTGTGGGACCCACCAGG - Intergenic
1109423054 13:62138227-62138249 GAATGAGTGTGGGGTCCAGCTGG - Intergenic
1111137305 13:84064735-84064757 CAGTGAGCTTGGGGGCCACCAGG + Intergenic
1111407608 13:87829610-87829632 CTGCTAGTGTGGAGGTCAGCTGG + Intergenic
1111558300 13:89910391-89910413 ATGTGAGTGTGGGATCTAGCCGG + Intergenic
1112620294 13:101047718-101047740 CTGTGGGTGGAGGGGCCACCTGG - Intergenic
1117195450 14:53335813-53335835 CTGTGTGTGTAGGGGCCAGGTGG + Intergenic
1117284968 14:54278277-54278299 CTCTCAGTGTGCAGGCCAGCTGG - Intergenic
1117582148 14:57162290-57162312 CTGAGTGTGTGGGGGCCAGGAGG - Intergenic
1117895813 14:60485702-60485724 CTGTGAGGGTGGGAGTCGGCCGG - Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119759311 14:77140060-77140082 TTGTGAGGGTGGGGGGCACCGGG + Intronic
1121781491 14:96625025-96625047 CTGTGAGCTTGCGGGCCTGCGGG - Intergenic
1122100594 14:99406536-99406558 CTGTGAGTGTGTGGCTCTGCAGG - Exonic
1122206352 14:100149868-100149890 CGGCCAGGGTGGGGGCCAGCGGG - Intronic
1122239169 14:100350693-100350715 CTGTGTCTGTGGGGCCCAGGAGG + Intronic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122919217 14:104873201-104873223 CTGGGAGTGGGCGGGGCAGCTGG + Intronic
1123476130 15:20593523-20593545 CTGTGGTGGTGGGGACCAGCTGG + Intergenic
1123641882 15:22406841-22406863 CTGTGGTGGTGGGGACCAGCTGG - Intergenic
1124615279 15:31237072-31237094 CTTTGAGTCAGGGGGCAAGCAGG - Intergenic
1127674937 15:61229511-61229533 ATGTGGGTGTGGGGGCCGGCTGG - Intergenic
1127898276 15:63321717-63321739 CTGTGTGTGTAGGGGCGAGGGGG + Exonic
1128780798 15:70357490-70357512 GGGTCAGTGTGGGGGCCATCAGG + Intergenic
1129228732 15:74184749-74184771 CTGTGAGTGTGAGGGACATAGGG - Intronic
1129392665 15:75228370-75228392 CTGTGTGTCTCTGGGCCAGCAGG - Intergenic
1129775252 15:78232548-78232570 CTGTGAGTGAGGGGCCAAGTGGG - Intronic
1130878458 15:88034071-88034093 CTGGGAGTCTGGTGGCCAGCTGG - Intronic
1130991563 15:88878919-88878941 CTGTGGGTTTGGTGGCCACCTGG - Intronic
1132500678 16:283367-283389 CTGTGAGTGCTGGGGCCAGTGGG + Exonic
1132991923 16:2799780-2799802 CAGGGACTGTGGGGGCCAGCAGG + Intergenic
1135539848 16:23321414-23321436 CTGTGAGTGGGGGTGTGAGCAGG + Intronic
1137664889 16:50244463-50244485 CACTGAGTGTGGGTCCCAGCAGG + Intergenic
1138287402 16:55820821-55820843 TTGTGACTGTGGGGTCCAGTGGG - Intronic
1138504273 16:57469777-57469799 CTGTCACCGTGTGGGCCAGCGGG + Intronic
1140046687 16:71444209-71444231 CTGTGGATGTGGGGGTCCGCAGG + Intergenic
1141287442 16:82685675-82685697 CAGTCTGTGAGGGGGCCAGCAGG + Intronic
1141473787 16:84258219-84258241 CTGTGAGAGGGGAAGCCAGCTGG + Intergenic
1141626470 16:85264149-85264171 GTGGGAGGGTGGGGGGCAGCTGG + Intergenic
1141635537 16:85312111-85312133 CGGTGGGCGAGGGGGCCAGCAGG - Intergenic
1142356039 16:89602515-89602537 CGGTGGGTGGGGGGGGCAGCTGG + Intergenic
1142469594 17:155927-155949 CTGTGACTGAGGGGCCCAGGAGG - Intronic
1142495223 17:302645-302667 GGGTGAGTGTGGGTGGCAGCCGG - Intronic
1142806145 17:2372253-2372275 CTGTGAGTGTGGGGCGCGCCGGG + Exonic
1142885724 17:2911171-2911193 CAGTGAGGGTGGGGGCCCGGGGG - Intronic
1143256660 17:5562551-5562573 CTGTGTGTGTTGGGGACAGGGGG - Intronic
1144021589 17:11243132-11243154 GGGTCAGTGTGGGGGCCTGCAGG - Intronic
1144427481 17:15157436-15157458 CTTTGAGTGTGGGTGAAAGCTGG - Intergenic
1144658608 17:17053688-17053710 CTGTGATTTTGTGGGCAAGCTGG + Intronic
1145026451 17:19471321-19471343 CTTTGAGTGTGGCAGACAGCGGG + Intergenic
1145065279 17:19757669-19757691 CGGAGAGTATGGGGGGCAGCAGG - Intergenic
1146184979 17:30718909-30718931 GTAGGAGTGCGGGGGCCAGCAGG + Intergenic
1146489573 17:33270604-33270626 CTGGGTGTGTGTGGTCCAGCCGG + Intronic
1146848990 17:36205762-36205784 CTCTGAGTGTTGGGGCCAAGAGG - Intronic
1147332904 17:39709409-39709431 CTATCAGTGTGAGAGCCAGCTGG - Exonic
1147567805 17:41548315-41548337 GTGTCAGTGTGGGGGCCATGGGG - Intergenic
1147613143 17:41813041-41813063 CTGTGGCTGGGGGGGCCCGCGGG - Exonic
1148554345 17:48569342-48569364 ATGTGAGTGTGGGAGACAGACGG - Intronic
1148670606 17:49407280-49407302 CTGAGAGTGAGGGAGGCAGCTGG + Intronic
1148783976 17:50136219-50136241 CTGGGTTGGTGGGGGCCAGCAGG + Intronic
1148804399 17:50257111-50257133 CTCTGAGCCTGGGGGACAGCAGG + Intergenic
1149995280 17:61403035-61403057 CGGGGAGGGTGGGGGTCAGCCGG - Intronic
1150626944 17:66847964-66847986 CTGTGAGTGATGGGGTCAGGTGG + Intronic
1150833622 17:68544358-68544380 CTGAGAGTGGTGGGGCCTGCTGG + Intronic
1150915220 17:69429832-69429854 CTTCAAGTGTGGGGGCCAGGTGG + Intronic
1151470734 17:74316162-74316184 CTTTGAGTACGGGGGGCAGCTGG - Intergenic
1152044796 17:77928925-77928947 CTGGGAATGTGGGCTCCAGCAGG + Intergenic
1152293150 17:79452210-79452232 GTGAGAGTGTAGGGGCTAGCTGG + Intronic
1152489364 17:80619254-80619276 CTCTCAGTGTGGGGGACAGAAGG + Intronic
1152519324 17:80846091-80846113 CCGTGAGTGTGTGGATCAGCAGG - Intronic
1152740571 17:82016692-82016714 CTGGGAGGGGGGTGGCCAGCAGG - Intronic
1152744473 17:82032457-82032479 GTGTGAGTGTGGGGGCTTCCCGG + Exonic
1152759616 17:82101116-82101138 CTGGCAGGGTGGGGGCCAACCGG - Intergenic
1153668483 18:7387643-7387665 CTGTGAGAGGTGAGGCCAGCTGG + Intergenic
1157200172 18:45653236-45653258 CTTGGAATGTGGGGGCCTGCTGG + Intronic
1158359136 18:56651752-56651774 CCAAGAGCGTGGGGGCCAGCCGG + Intronic
1159310888 18:66707435-66707457 CTGCCAGTGTGCAGGCCAGCTGG - Intergenic
1160375647 18:78409835-78409857 CAGTGTGTGTGGGGGCCTCCCGG - Intergenic
1160620017 18:80164122-80164144 CTCTGTGTGTGGGGTGCAGCAGG - Intronic
1160709966 19:547007-547029 CTGTGGCTGTGGGGCCCAGTGGG + Intronic
1160738776 19:676525-676547 CGGTGAGTGGGGCGGCCAGAGGG + Exonic
1160748051 19:720630-720652 CCGTGACTGCGGGGGCCAGGGGG + Intronic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161295843 19:3519870-3519892 CTGTGGGTGTGGGGCCCCCCGGG - Intronic
1161295862 19:3519945-3519967 CTGTGGGTGTGGGGCCCCCCGGG - Intronic
1161370499 19:3908521-3908543 CTGTGAGCCTCAGGGCCAGCAGG - Intronic
1161752863 19:6110336-6110358 CGGGGAGTGTGGGGGGCGGCGGG - Intronic
1162523646 19:11195530-11195552 CTTTGAGTGCTGGGGCCGGCAGG + Intronic
1162875286 19:13616841-13616863 GAGTGAGTGAGGGGGCCAGAAGG + Intronic
1162973796 19:14196780-14196802 GTAGGAGTGTGGGGGCCAGCAGG - Intronic
1163804073 19:19385636-19385658 CAGTGAGTGCGCGGGCCGGCTGG - Intergenic
1165306085 19:35003774-35003796 GTGTGAGTGAGGTGGCCAGTGGG - Intronic
1165350216 19:35271167-35271189 CTGTGAGGGTGGTGGTCAGGGGG - Intronic
1166111716 19:40626920-40626942 TGGTGGGTGTGGGGGCCAGCAGG + Intronic
1167638964 19:50669802-50669824 CACTGAGTGTGGGGTCCACCTGG - Intronic
1167909370 19:52689768-52689790 CTGTGATTGTGTGGGCCAAAGGG - Intronic
1167934208 19:52893134-52893156 CTGTGATTGTGTGGGCCAAAGGG - Intronic
1167937889 19:52922707-52922729 CTGTGATTGTGTGGGCCAAAGGG - Intergenic
1167952249 19:53037188-53037210 CTGTGAATGTGTGGGCCAAGGGG - Intergenic
1167955046 19:53057844-53057866 CTGTGAATGTGTGGGCCAAAGGG - Intergenic
1167964450 19:53132239-53132261 CTGTGAATGTGTGGGCCAAAGGG - Intronic
1167971809 19:53192657-53192679 CTGTGAATGTGTGGGCCAAGGGG - Intronic
1167991786 19:53366401-53366423 CTGTGATTGTGTGGGCCAAAGGG + Intronic
1167999436 19:53432648-53432670 CTGTGACTGTGTGGGCCAAAGGG + Intronic
926012200 2:9417236-9417258 CTGTGTGTTTGGGGGACAGCAGG - Intronic
926265021 2:11308087-11308109 CTGCGACTCTTGGGGCCAGCTGG + Intronic
927780913 2:25938792-25938814 CTGTGGTTGTGGGGCCCTGCTGG - Intronic
928020604 2:27701858-27701880 CTGAGAGAGTGGGAGCCAGAGGG + Intergenic
929460173 2:42097576-42097598 CTGAGAGTGTGGGGTGCAGGTGG - Intergenic
929815145 2:45224642-45224664 CTGTGATTGTGGGGGCTGGAGGG + Intergenic
931366854 2:61626733-61626755 TTCTGGGTGTGGGGGACAGCAGG - Intergenic
932685243 2:73863632-73863654 GGGTGGGTCTGGGGGCCAGCTGG + Exonic
933748860 2:85590424-85590446 CTGGGAGTTTGTGGTCCAGCTGG + Intronic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
935556486 2:104515394-104515416 CGGGGAGTGTGGGGAACAGCAGG + Intergenic
936085389 2:109464066-109464088 CTGGCAGTGTGGGGGCTGGCAGG - Intronic
936287441 2:111191608-111191630 CTGTGACTGTCAGGGCCATCAGG + Intergenic
940115563 2:150204561-150204583 CTGTGTGTGTGGGTGGCAGTAGG - Intergenic
940790418 2:158025403-158025425 CCTGGAGTGTGGAGGCCAGCAGG + Intronic
942245573 2:174004798-174004820 ATGTGAGTGTGGGGAACTGCAGG - Intergenic
945040266 2:205738255-205738277 CTGTGTGTGTGGTCGCCATCAGG - Intronic
946370583 2:219279310-219279332 CTGGGGGGGTGGGGGCCTGCAGG - Exonic
946626004 2:221613028-221613050 CAGTGAGAGAGGAGGCCAGCAGG + Intergenic
948455388 2:238102256-238102278 CTGTCACTGTGGGGGTGAGCTGG + Intronic
948860058 2:240748468-240748490 CTGTCAGGGTGGGGGCCAGTGGG + Intronic
1168904552 20:1392813-1392835 CGGTGAGTCGGGGGCCCAGCGGG - Exonic
1171975900 20:31594462-31594484 CTGTGGGAGTGGGTGCCTGCAGG + Intergenic
1172126253 20:32626936-32626958 CGGGGTGTGTGGGGGCCACCAGG + Intergenic
1172641650 20:36443736-36443758 CTGTCGGTGGGGAGGCCAGCTGG - Intronic
1172883477 20:38216545-38216567 CTGGGAGAGTGTGGTCCAGCTGG - Intronic
1173904916 20:46619555-46619577 CTGTGAGTCTGGGGGCCATGGGG - Intronic
1173923346 20:46762233-46762255 CTTTGAGTGTTGAGGCCAGAAGG + Intergenic
1175485672 20:59344254-59344276 TTGTGAGTCTGGGGGTAAGCAGG - Intergenic
1175709307 20:61206360-61206382 CTGTGAGGATCGGGGCCAGCAGG + Intergenic
1175749223 20:61483688-61483710 GTGTGTGTGTTGGGGGCAGCGGG - Intronic
1175958195 20:62622043-62622065 CTGAGAGTGGGGAGGACAGCTGG + Intergenic
1176144452 20:63559371-63559393 CTGTGAGGGTGGGAGTCAGATGG + Intronic
1179044067 21:37829515-37829537 CTGGGTGTGTGGGGGCCAGGGGG + Intronic
1179884121 21:44306212-44306234 CTGTGAGTGTGGGGGCTCCGTGG + Intronic
1180138572 21:45876983-45877005 CTGTGAGTGCGGCTGGCAGCAGG - Intronic
1180171031 21:46058320-46058342 CTGTGACTGTGTGGGCCTGTGGG - Intergenic
1180171040 21:46058368-46058390 CTGTGAGTGTGTGGACCTGTGGG - Intergenic
1180171048 21:46058408-46058430 CTGTGACTGTGTGGGCCTGTGGG - Intergenic
1180171089 21:46058640-46058662 CTGTGACTGTGTGGGCCTGTGGG - Intergenic
1180594815 22:16966184-16966206 CTGTGAGTGGGGAGCCAAGCAGG + Exonic
1180972860 22:19824681-19824703 CTCTGGGTGTGGGGACCAGCGGG + Intronic
1181999223 22:26906586-26906608 ATGCGAGTGTGAGGGCCAGCAGG + Intergenic
1182023017 22:27097071-27097093 GAATGAGTGTGGGGGCCAGGTGG + Intergenic
1183522072 22:38301258-38301280 CTGTGAGTGTGGGGCCGGGCAGG - Intronic
1184271558 22:43387380-43387402 CGGTGACTGTGGAGGCCAGCAGG - Intergenic
1184351096 22:43944809-43944831 CTGTGGGTGTGTGGGCCGGACGG + Intronic
1184376592 22:44117359-44117381 CAGTGAGTGTGGGGGTCTGTGGG + Intronic
1184874365 22:47263925-47263947 CTGTTAGAGAGGGAGCCAGCCGG + Intergenic
1185078447 22:48695930-48695952 CTGTCTGTGTGGTGGTCAGCAGG - Intronic
1185418370 22:50721784-50721806 CAGCGAGTGGGGTGGCCAGCAGG - Intergenic
1203244110 22_KI270733v1_random:48161-48183 CTGTGGCTGGCGGGGCCAGCTGG + Intergenic
950218196 3:11174777-11174799 CCGAGGCTGTGGGGGCCAGCTGG - Intronic
950566772 3:13773974-13773996 CTGTGAGTGTGTGGCTCAACTGG + Intergenic
950691124 3:14658799-14658821 CAGGGAGTGTGGGGGCAACCAGG + Intronic
952882671 3:37994465-37994487 ATGTGAGTGCGGGGGCGACCGGG + Exonic
953357223 3:42265647-42265669 GTGTGAGTGTGTGGGCCCTCAGG - Intronic
954761161 3:52875450-52875472 CACTGTGTGAGGGGGCCAGCAGG - Intronic
955525553 3:59816150-59816172 CTGTGAGACTGTGGGCAAGCTGG + Intronic
955555590 3:60133605-60133627 CTGAGAGTGTGGGGACCAGGGGG + Intronic
956740803 3:72274274-72274296 CTATGAGTGGGGCGACCAGCAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
962191172 3:133312516-133312538 CTGTGGGTGTGGGACCCACCAGG + Intronic
962388115 3:134949269-134949291 CTGGGAGTCTGGGGTCCAGGAGG + Intronic
964553655 3:157912125-157912147 CTCTGAGTGTGGTGACCTGCTGG + Intergenic
964980488 3:162671276-162671298 CTATGAGAGTTGGTGCCAGCAGG - Intergenic
966370985 3:179250576-179250598 CTGTCAGTGCTGGGGGCAGCTGG - Intronic
966902981 3:184500378-184500400 GTGTGTGTGTTGGGGCCAACGGG + Intronic
967983328 3:195078329-195078351 CTGTCAGTGTGAGGGACAGGTGG - Intronic
968226466 3:196975507-196975529 CTCTGTGTCTGAGGGCCAGCAGG + Intergenic
968443200 4:634828-634850 ATGTGAGTGTGGGGGGCACCTGG + Exonic
968521781 4:1037480-1037502 CTGTGAGTGTGTGGCCCTGGAGG + Intergenic
968521801 4:1037560-1037582 CTGTGAGTGTGTGGCCCTGGAGG + Intergenic
968593744 4:1472233-1472255 GGGTGAGTGTCGGGGCCGGCCGG + Intergenic
968632858 4:1661208-1661230 CTGTGAGGGTGGGAGCCTGGGGG - Intronic
968687568 4:1971677-1971699 CTGTGAGGGTGTGTGCCAGCCGG + Intronic
968909927 4:3472564-3472586 CTGTGAATGGCGGGGGCAGCAGG - Intronic
969219688 4:5751746-5751768 CAGTGAGGGTGGGGACAAGCAGG + Intronic
969518373 4:7661423-7661445 CAGGGAGTGTGGGGAGCAGCTGG + Intronic
969533586 4:7742252-7742274 GTGTGGGTGGGGTGGCCAGCAGG - Exonic
971215947 4:24662266-24662288 CTGTGTGTGTGGGGGCGGGGGGG - Intergenic
976404393 4:84645891-84645913 CTGTGTGTGTAGGGGCTGGCTGG + Intronic
976539914 4:86262438-86262460 CTCTGAAGGTGGGGGCCAGGGGG - Intronic
976608685 4:87007059-87007081 CTTCGAGCGTGGGGGCCCGCTGG + Intronic
981546470 4:145899264-145899286 CTGTTGGTTTGGGGGCCACCTGG - Intronic
981748511 4:148072630-148072652 CAGTGAGTGTGGGGTCCTGCAGG - Exonic
984313242 4:178091121-178091143 AAGTGAGTGTGGGGTCCAGCTGG - Intergenic
984947733 4:184983093-184983115 CTATGGGTTTGGGGACCAGCTGG - Intergenic
984950287 4:185002936-185002958 CTGTGAAGGTCGGAGCCAGCCGG - Intergenic
985500828 5:243953-243975 CAGTGAGTGAGGGTGCCAGATGG + Intronic
985622532 5:963014-963036 CCGTGGGTGTGGGGGCCATGTGG - Intergenic
985786288 5:1896991-1897013 CTGCGAGGGTGGGAGGCAGCTGG + Intergenic
985986458 5:3520674-3520696 CTGTGTGTGGAGGGACCAGCAGG + Intergenic
986637290 5:9835738-9835760 CTGTGGGAGAGGGGCCCAGCAGG - Intergenic
986686337 5:10278387-10278409 ATGTGGGTGTGGGGGTCAGTGGG - Intronic
990680190 5:58233950-58233972 CTGTGATTGGGGTTGCCAGCAGG - Intergenic
994813565 5:104555270-104555292 ATGAATGTGTGGGGGCCAGCAGG + Intergenic
998401993 5:141852993-141853015 CTGAGGCTGTGGGGGGCAGCTGG - Intergenic
998478983 5:142445522-142445544 CTGTGTGGGTGGGGACCACCAGG - Intergenic
998529247 5:142869936-142869958 CTCTGAGTGAGGGGACCAGATGG - Intronic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
1001064780 5:168527922-168527944 ATGTGATTGTGGAGACCAGCAGG + Intergenic
1001181948 5:169528775-169528797 CTGTGAGTTGTGGGGCAAGCTGG - Intergenic
1001571772 5:172735053-172735075 TTGTGTGTATGGGGGCCAGTTGG + Intergenic
1001717704 5:173830029-173830051 GTGAGAGTGTGGGCTCCAGCGGG + Intergenic
1001952179 5:175824025-175824047 CTGTGGGTGTTGGGGACAGGAGG - Intronic
1001977969 5:176015877-176015899 CTGTGAGTGTGTGGGACAAGGGG + Intronic
1002051704 5:176575208-176575230 GTGTGAGTGGGGGTGCCGGCAGG + Exonic
1002140193 5:177133436-177133458 CTTGGAGTGTCGGGGCCTGCGGG - Intronic
1002239450 5:177827885-177827907 CTGTGAGTGTGTGGGACAAGGGG - Intergenic
1003168679 6:3703312-3703334 TTGTGGATGTGGGGGCCAGGTGG - Intergenic
1006380174 6:33692677-33692699 CAGTGAATGTGGGGACCACCGGG + Intronic
1006939414 6:37742128-37742150 CTGGGACTGTCGGGACCAGCAGG - Intergenic
1007598994 6:43070257-43070279 CAGTGAGTGTTGGGCCCTGCTGG + Intronic
1007871876 6:45049576-45049598 CTGTGAGTTTGGTTGCCAGCGGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1012593714 6:101015713-101015735 CTGTGAGTTTGGTGTCCAGATGG - Intergenic
1014321243 6:119930531-119930553 GTCTGAGCGTGGGGGCCAACAGG + Intergenic
1014647335 6:123990580-123990602 CTGTCAGTGTCAGAGCCAGCTGG - Intronic
1015024745 6:128520005-128520027 CGGAGAGTGTGGGGACCTGCTGG - Intronic
1017064863 6:150519230-150519252 CTATGAGTGTGGGGGCACTCAGG + Intergenic
1018706944 6:166470245-166470267 CTGTGAGTGTGAGCACCAGGTGG + Intronic
1018908815 6:168090216-168090238 CTGAGAGCGTGGGGGGCAGAGGG - Intergenic
1019405841 7:883701-883723 CGGGGAGAGTGGGGGGCAGCTGG - Intronic
1019499959 7:1359916-1359938 CTGTGGGTGTGGGGCCCACCAGG + Intergenic
1019512661 7:1425866-1425888 CTGTGGGTGTGAGGTCCAGGGGG - Intergenic
1019517148 7:1445073-1445095 CCGTGGGAGTGGGGGCCAGGCGG + Exonic
1019847023 7:3513740-3513762 TAGTGAGTGTGGTGCCCAGCAGG + Intronic
1019898630 7:4002231-4002253 CTCTGAGTCTGGGCTCCAGCCGG + Intronic
1020005869 7:4783534-4783556 TTGGGAGTGTGGGGGGCAGGTGG + Intronic
1020244000 7:6416682-6416704 CTCTGAGCATGGTGGCCAGCAGG + Exonic
1021822142 7:24508819-24508841 CTGTGCTTGGGGGGCCCAGCAGG + Intergenic
1023632459 7:42177933-42177955 CGCTAAGTGTGGGGACCAGCTGG + Intronic
1023907164 7:44531181-44531203 CAGTAAGTGTGCGGGCCAACAGG - Intronic
1024226247 7:47328517-47328539 CTGTGAGTGTGGGGTCCCAGGGG - Intronic
1024558324 7:50622670-50622692 CTGGGAATGTGGGGGGCACCTGG - Intronic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1026934934 7:74249046-74249068 CTTTGAGTGCTGGGCCCAGCAGG + Exonic
1029096045 7:98085864-98085886 CAGTGGGAGTGGGGGCCTGCTGG + Intergenic
1029414950 7:100436586-100436608 CTGTGAGTGCGGAAGCCTGCCGG - Intergenic
1029441714 7:100590429-100590451 TTGGGAGTGTGGGGGTCATCAGG - Intronic
1032792138 7:135250188-135250210 CTGTGAGTGTGGTGGCACTCTGG + Intronic
1034179448 7:149126290-149126312 CTCTGCCTTTGGGGGCCAGCAGG - Exonic
1034987033 7:155522620-155522642 CTCTGAGTGTCAGGGCCAGAGGG + Intronic
1035404101 7:158587347-158587369 CTCTGAGTGAGGGGGCATGCAGG - Intronic
1037608736 8:20458875-20458897 GAGTGGGTGTGGGGCCCAGCAGG - Intergenic
1037619636 8:20552042-20552064 CTCTGGGTGGGTGGGCCAGCAGG - Intergenic
1039165437 8:34674396-34674418 ATGTGTGTGTGGGGGCGAGGGGG + Intergenic
1040060676 8:43100515-43100537 GTGTGTCTGTGGGGGCCTGCAGG + Intronic
1040629892 8:49198145-49198167 CAGTCAGGGTGGGGGCCAGTTGG + Intergenic
1041447535 8:57969267-57969289 CTGTGGGTGGCGGGGTCAGCAGG + Intergenic
1041457245 8:58074348-58074370 CTGTGAGTGTGGGGGATTGGTGG - Intronic
1043171499 8:76972344-76972366 CGGTGTGGGTGGGGGGCAGCAGG + Intergenic
1043382652 8:79720067-79720089 CTGTGAGTTTAGGGGACAGTAGG - Intergenic
1047906032 8:129474159-129474181 CTGCAGGTGTGGGGGGCAGCAGG + Intergenic
1048177412 8:132165114-132165136 CAGTGAGTGTAGGTGACAGCTGG - Intronic
1049403282 8:142440400-142440422 CTGTAAGTGCCGGAGCCAGCTGG - Intergenic
1049583729 8:143423677-143423699 CTGTGAGGGTGGGGCCAGGCTGG + Intronic
1049957555 9:707385-707407 ATGTGTGTGTGGGAGCCGGCGGG - Intronic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1053040105 9:34863003-34863025 CTGGGAGTGTGGTGGCCATGGGG + Intergenic
1056332598 9:85534259-85534281 CTGTGAGTAGGGGGGCGAGGAGG - Intergenic
1056581152 9:87888721-87888743 CTGTGGTGGTGGGGACCAGCTGG - Exonic
1057287399 9:93769243-93769265 CTGTGTGTGTTGGGGCAAGCGGG + Intergenic
1057317576 9:93979608-93979630 GAGTGAGTATGGGGGCCAGGAGG - Intergenic
1057448731 9:95137748-95137770 CTCTGAGTGTGGAGGCAGGCAGG + Intronic
1059396079 9:114034967-114034989 CTGTGGGTGCTGGGGCCACCAGG - Intronic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1060231344 9:121827592-121827614 CAGTGAGTGTGGGGGGACGCGGG + Intronic
1061001356 9:127904710-127904732 CTGTGAGAGTGGCGGGCAGGTGG + Intronic
1061790173 9:133054993-133055015 CTGTGTGTGTTGGGGACATCTGG + Intronic
1061882387 9:133574842-133574864 CTAGGAGTGGGGGGGCCTGCAGG - Exonic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1062399569 9:136366484-136366506 CTGAGAGTGTGGGGCCCCTCTGG - Intronic
1062436619 9:136549254-136549276 CTGTGAGTGTGGGGGAGGGGAGG - Intergenic
1062464565 9:136675391-136675413 CAGGGAGGGAGGGGGCCAGCAGG + Intronic
1062464606 9:136675514-136675536 CAGGGAGGGAGGGGGCCAGCAGG + Intronic
1062464621 9:136675555-136675577 CAGGGAGGGAGGGGGCCAGCAGG + Intronic
1186820838 X:13285836-13285858 GAGTGAGTGTGGGGTCCAGCTGG - Intergenic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187553410 X:20328215-20328237 CCGTGACTGTTGGGGCCAGCTGG + Intergenic
1190136955 X:47806589-47806611 CTGAGCCTGTAGGGGCCAGCAGG + Intergenic
1190379885 X:49829366-49829388 GTGTGAGTGAGTGGGCCGGCGGG + Intronic
1196520193 X:116663194-116663216 CTCTCAGTGTGCAGGCCAGCTGG + Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1199332824 X:146582020-146582042 CTGTGAGTGTTGGGGGCATAGGG + Intergenic
1200425458 Y:3015611-3015633 ATGTGTGTGTGGGGGACAGGGGG + Intergenic
1202297592 Y:23376344-23376366 ATGTGAGGGTGGGGGGCAGGGGG + Intergenic
1202573217 Y:26294253-26294275 ATGTGAGGGTGGGGGGCAGGGGG - Intergenic