ID: 903588886

View in Genome Browser
Species Human (GRCh38)
Location 1:24439029-24439051
Sequence GGGGGACTCCAAAACGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 18, 3: 65, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903588886 Original CRISPR GGGGGACTCCAAAACGGGGA GGG Intronic
901499168 1:9641009-9641031 GGGGGACTACAGAACTAGGAAGG - Intergenic
901959109 1:12810463-12810485 GGGGGACTCCAGAAAGGGAGTGG - Intergenic
903555644 1:24191204-24191226 GGGGAACTTCAAAAGGTGGATGG - Intergenic
903588886 1:24439029-24439051 GGGGGACTCCAAAACGGGGAGGG + Intronic
904512120 1:31020067-31020089 TGAGGACTCCAAAAAGGGAAAGG - Intronic
906232200 1:44173338-44173360 GGGACAATTCAAAACGGGGAGGG + Intergenic
906446089 1:45899462-45899484 TGGGGACTCCAAAAGGGGAGAGG - Intronic
906961627 1:50422689-50422711 CTGGGACCCCAAGACGGGGAGGG - Intronic
907696977 1:56740952-56740974 TGGGGACTCCAAAAAGCGGGAGG + Intronic
909453833 1:75828646-75828668 TGGGGACTCCAAAAGGGGAGAGG + Intronic
910884640 1:91951759-91951781 GTGAGACTCCAAAGTGGGGAAGG + Intronic
911043030 1:93607084-93607106 TGGGGACTCCAAAAGAGGGGCGG + Intronic
911123567 1:94319700-94319722 GGGGGACACAAAACTGGGGAGGG - Intergenic
912269367 1:108193339-108193361 TAGGGACTCCAAAAGGGGGGAGG - Intronic
913341630 1:117763640-117763662 GGGGGACTCCAAAAGAGGGGAGG - Intergenic
916361493 1:163975200-163975222 TGGGGACTCCAAAAGGTGGGAGG - Intergenic
916706841 1:167359353-167359375 TAGGGATTCCAAAAGGGGGAAGG - Intronic
917061113 1:171041137-171041159 TGGTGACTCCAAAACGTGGGAGG - Intronic
917973092 1:180220832-180220854 GTGGGACTCCAAAAGGCGGTAGG + Intergenic
918813576 1:189152316-189152338 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
919326866 1:196119157-196119179 TGGGGACTCCAAAAGAGGGGAGG + Intergenic
920809847 1:209273396-209273418 TGGGGACTCCAAAAGGGAGGAGG - Intergenic
921585545 1:216942070-216942092 TGGGGACTCCAAAAGAGGGGAGG - Intronic
922456150 1:225775212-225775234 TGGTGACTCCAAAAGGGGGAGGG + Intergenic
922821477 1:228488119-228488141 AGGGGACACCAAGACGGGGAAGG - Intronic
923714071 1:236410249-236410271 TAGGGACTCCAAAAGGGGGGAGG - Intronic
924073345 1:240306427-240306449 TGGGGACTCCAAAAGGAGGGAGG - Intronic
924400452 1:243674975-243674997 TGCGGACTCCAAAAAGGAGAAGG - Intronic
924491508 1:244542483-244542505 TGGGGACTCCAAAAAGGGACAGG - Intronic
1064305888 10:14165841-14165863 TGGGGACTCCAAAAGAGGGGAGG + Intronic
1064714969 10:18167287-18167309 TGGGGCCTCCAAAAGGGGGAAGG + Intronic
1064827426 10:19420835-19420857 GGGCAACTCCAAAGTGGGGAAGG + Intronic
1064963446 10:20991770-20991792 TGGGGATTCCAAAAAGGGGAGGG - Intronic
1065350546 10:24791818-24791840 TGGGGACTCCAAAAGGTGGGAGG - Intergenic
1066175406 10:32898575-32898597 CCGGGACTCCAAAAGGGAGAGGG + Intergenic
1066463322 10:35631698-35631720 TGGGGACTCCAAAAGTGGGAGGG - Intergenic
1066471494 10:35702225-35702247 TGGGGACTCTAGAAGGGGGAGGG - Intergenic
1066688322 10:38002221-38002243 TGTGGACTCCAAAAGGGGGGAGG + Intergenic
1067005537 10:42657351-42657373 TGTGGACTCCAAAAGGGGGGAGG - Intergenic
1067269547 10:44777976-44777998 TGGGGACTCCAAAAGGTGGGAGG - Intergenic
1067292985 10:44958013-44958035 TGGGGACTTCAAAAGTGGGAGGG + Intergenic
1067345520 10:45435421-45435443 TGGGGACTCCAGGAAGGGGAGGG - Intronic
1069592533 10:69650927-69650949 GGGGGTCTCCAGATGGGGGACGG - Intergenic
1071122598 10:82296938-82296960 TGGGGACTCCAAAAGAGGGGAGG - Intronic
1071939082 10:90567952-90567974 TGGGGACTACAAGACTGGGAAGG - Intergenic
1072116427 10:92374478-92374500 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
1072382436 10:94889257-94889279 TGGGGACTCCAAAACTGTGGAGG - Intergenic
1075077135 10:119359101-119359123 AGGGGACTCCAAACAGTGGAGGG - Intronic
1075284688 10:121173098-121173120 TGGGGATTCCAAAAGGTGGAAGG + Intergenic
1078515171 11:12015863-12015885 TGGGGACTCCAAAAGTGGGGAGG + Intergenic
1079280910 11:19086166-19086188 TGGGGATACCAAAAGGGGGAAGG - Intergenic
1080776190 11:35388934-35388956 CGGGGACTCCAAAAGGGGCTGGG + Intronic
1080780761 11:35427829-35427851 CGGGGACTCCAAAAGGGGCTGGG - Intergenic
1082938403 11:58678086-58678108 TGGGGACTCCAAAATGGGGGAGG - Intronic
1086310811 11:85534499-85534521 TGGGGACTCCAAAAGTGGGGAGG - Intronic
1087260934 11:96011555-96011577 TGGGGACTCCAAAAGGGGGAGGG + Intronic
1087351544 11:97039931-97039953 TAGGGACTCCAAAAGGAGGAAGG + Intergenic
1087472190 11:98590139-98590161 CTGGGACTTCAAAAAGGGGAAGG + Intergenic
1087587823 11:100144377-100144399 TTGGGACTCCAAAAAGTGGAAGG - Intronic
1087623530 11:100569413-100569435 TGGGGATTCCAAAAAGGGGAGGG - Intergenic
1087734210 11:101813630-101813652 TGGGGACTCCAAAAGTGGGGAGG + Intronic
1088176618 11:107059833-107059855 TGGAGACCCCAAAAGGGGGAAGG + Intergenic
1090660807 11:128880472-128880494 TGGGGACACCAGAAAGGGGAGGG + Intergenic
1093097524 12:14988872-14988894 CGGGGACTACTAAACGGGGAGGG + Intergenic
1093150143 12:15611186-15611208 TGGGGACTCCAAAAGGGGGGAGG - Intergenic
1093475384 12:19548946-19548968 TGGGGACTCTAAAAGGAGGAAGG - Intronic
1094384661 12:29881117-29881139 TAGGGACTCCAAAAGGGGGAAGG - Intergenic
1094392375 12:29965643-29965665 GGGAGCCTCCACAAAGGGGAGGG + Intergenic
1095211266 12:39497960-39497982 TGGGGAATCCAAAAGGAGGAGGG + Intergenic
1096192551 12:49629895-49629917 GATGGACACCAAAAAGGGGATGG + Intronic
1096807206 12:54148220-54148242 GGGGGACTTCCAAACAGGGCAGG + Intergenic
1097131128 12:56811347-56811369 GGGGGAAGCCAGAAAGGGGATGG + Intergenic
1098354939 12:69603576-69603598 TGGGGACTCCAAAGTGTGGAGGG - Intergenic
1098695668 12:73551306-73551328 TGGTGACTCCAAAATGGGAATGG - Intergenic
1099654428 12:85470556-85470578 TGGGGACTCCAAAAGCGGGGAGG - Intergenic
1100108941 12:91213314-91213336 TGGGGACTCCAAAATGGAGAAGG - Intergenic
1100593378 12:96050531-96050553 AGGGGACTCCAAAAGGGGAAAGG + Intergenic
1100637946 12:96453610-96453632 TGGGGACTCCAAAAGGGGGAGGG + Intergenic
1102961941 12:117098958-117098980 GGGGGACTGCGGACCGGGGAGGG - Intronic
1103172636 12:118834742-118834764 CGGGGACTCCAAAATGGGGGAGG + Intergenic
1103219546 12:119232218-119232240 GTGGGAGTTCCAAACGGGGAAGG - Intergenic
1105496497 13:20935279-20935301 GGGGGACTCCAAAGGGGGAGAGG + Intergenic
1105896015 13:24718075-24718097 TGGAGACTCCAAAAGGGGGGTGG + Intergenic
1105935072 13:25090900-25090922 TGGAGACTCCAAAAGGTGGAAGG + Intergenic
1106045996 13:26142708-26142730 GGGGGACTCCAAGAGGAGGGAGG + Intronic
1108014804 13:46063326-46063348 TGGGGACTCAAAAAAGGGGCAGG - Intronic
1109974662 13:69815541-69815563 TGGGGATTCCAAAACTGGGGAGG + Intronic
1110179374 13:72596924-72596946 TGGGGACTCCAAAATGGAGGAGG + Intergenic
1110270865 13:73588813-73588835 TAGGGACTCCAAAAGGGGGAGGG + Intergenic
1110551389 13:76814641-76814663 TGGGGACTCCAAAATAGGGGAGG - Intergenic
1111472314 13:88699099-88699121 CAGGGACTCCAAAAAGGGGGAGG + Intergenic
1113561489 13:111285173-111285195 TGGGGACTCCAAAAGGCGGAAGG - Intronic
1115628807 14:35222642-35222664 TTGGGAGTCCAAAATGGGGAAGG - Intronic
1115800136 14:36983977-36983999 TGGGGACTCCAAAAGGGTGAAGG + Intronic
1116252130 14:42499581-42499603 TGGGGACTCCAAAAGGGGGAAGG + Intergenic
1117623972 14:57616912-57616934 GGGGGACTTGAGAAAGGGGATGG - Intronic
1118506565 14:66419802-66419824 TGGGGACTCCAAAACAAGGGAGG + Intergenic
1119192867 14:72695684-72695706 TGGGGACTCCAAAAGGGGGAAGG + Intronic
1119482061 14:74964057-74964079 TGGGGACACCAAGACGGTGATGG + Intergenic
1119520327 14:75280011-75280033 CGGGGACTCCGAAAGGGTGAGGG - Exonic
1121217118 14:92256992-92257014 TGGGGGCTCCAAAAAGGGGGAGG - Intergenic
1122008578 14:98727002-98727024 GGTATACTCCAAAGCGGGGATGG - Intergenic
1122170220 14:99867085-99867107 TGGGGACTCCAAAAGGAGGGTGG - Intronic
1124704036 15:31946153-31946175 TGGGGACTCCAAAAAGGGGGAGG - Intergenic
1125882810 15:43208655-43208677 GAGGGACTTCAGAACGGAGAAGG - Exonic
1127065289 15:55230971-55230993 TAGGGACTCCAAAAGGGGGAAGG - Intronic
1127750796 15:62040537-62040559 TGGGGACTCCAAAAAGGGGTAGG + Intronic
1127767426 15:62200509-62200531 TGGAGACTCCAAAAGTGGGAGGG + Intergenic
1130364269 15:83219778-83219800 TGGGGACTGGAAAATGGGGAAGG + Intergenic
1130683580 15:86017704-86017726 TAGGGACTCCAAAATGGGGGAGG - Intergenic
1131016391 15:89061070-89061092 TGGGGACTCCAAAAATGGGGAGG + Intergenic
1131837729 15:96408082-96408104 GGGGGGTTCCAAAACGAGGAGGG - Intergenic
1131998883 15:98160286-98160308 GGGAGACTCTAAAACTGGGCAGG - Intergenic
1132709126 16:1258742-1258764 GAGGGACTCAAGAAAGGGGAGGG - Exonic
1132709138 16:1258779-1258801 GAGGGACTCAAGAAAGGGGAGGG - Exonic
1133440245 16:5815354-5815376 TGGGGTCTCCAAACAGGGGATGG - Intergenic
1135877731 16:26218870-26218892 TGGGGACTCCAAGCGGGGGAGGG + Intergenic
1136400855 16:30017625-30017647 TGGGGACTCCAAAAAAGGGGAGG + Intronic
1136627080 16:31467878-31467900 TGGGGACTCCAAAAGGGGGGCGG - Intergenic
1139054425 16:63164538-63164560 TGGGGACTCCAAAATGGGGAAGG - Intergenic
1139286727 16:65821891-65821913 GGGGAACTCTAGAACTGGGATGG + Intergenic
1139534099 16:67561239-67561261 GGGGCACTCCAATATTGGGAGGG - Intergenic
1139591286 16:67934719-67934741 AGGGGGCTGCAAAAAGGGGATGG - Intronic
1141258799 16:82431630-82431652 TGGGGACTCCAAAAGTGGGAGGG + Intergenic
1142648087 17:1328414-1328436 GAGGGACTGCATAACGGGTATGG - Intergenic
1144185528 17:12791673-12791695 GGGGGAATGCAAAATGGTGAGGG + Intronic
1145203103 17:20964598-20964620 TGGGGACTCCAAAAGGGGTGAGG - Intergenic
1145738201 17:27248528-27248550 TGGGGACTCCAAAAAGAGGGAGG - Intergenic
1146390510 17:32417966-32417988 TGGGGACTCCTACAGGGGGAGGG - Intergenic
1147050150 17:37788251-37788273 TGGGGACTCCAAAAGGGGAGAGG - Intergenic
1147051573 17:37799070-37799092 TGGGGACTCCAAAATGGGGGAGG + Intergenic
1148973148 17:51502101-51502123 TGAGGACTCCAAAACGGGGAGGG - Intergenic
1149188153 17:54026632-54026654 TGGGGACTCCAAAAGGGGGGAGG + Intergenic
1149943052 17:60891806-60891828 TGGGGACTCCAAAAGGGGGAGGG - Intronic
1150068050 17:62128007-62128029 TGGGGACTCCAAATGGGGGGAGG - Intergenic
1150899707 17:69258540-69258562 TGTGGACTCCAAAAGGGGGTGGG + Intronic
1151103679 17:71587242-71587264 TGGAGACTCCAAAACTGGGGAGG + Intergenic
1151105411 17:71610632-71610654 GGGGGACTACAAGAAGGGGGAGG + Intergenic
1151541426 17:74766893-74766915 AGGTGAGTCCAGAACGGGGATGG - Intronic
1152026788 17:77815114-77815136 GGGGGACTCCAGAAGTGGGGAGG - Intergenic
1153542511 18:6170847-6170869 GGGGGACTCCAAGTAGGGAAGGG - Intronic
1156429350 18:37054649-37054671 TGGGGACTCCAAAATGGGAGTGG + Intronic
1156469606 18:37369025-37369047 GGTGGATTCCAGAATGGGGAGGG + Intronic
1157624333 18:49037408-49037430 TAGGGACTCCAAAACGAGGGAGG + Intergenic
1161331266 19:3688833-3688855 TGGGGGCTCAAAAACGGGGTGGG - Intronic
1161681579 19:5682320-5682342 GGGGGAGACCAAATCGGAGATGG + Intronic
1162486325 19:10962515-10962537 GGGGGCCTCAAAATCAGGGAGGG + Intronic
1163640378 19:18458596-18458618 GGCTGGCTCCAAAAAGGGGAGGG + Intronic
1164721839 19:30438252-30438274 TGGGGACTCCAAAAGTGGGGAGG - Intronic
1165366453 19:35370387-35370409 TGGGGACTCCAAAGTGGGGGAGG + Intergenic
1165780957 19:38434068-38434090 TGGGGACTCCAGAATGGGAAAGG + Intronic
1166593727 19:44025977-44025999 GGGGGACGGCAAAACGGTCAGGG + Intronic
925961796 2:9024209-9024231 TGGGGACTCCAAAAGTGGGGAGG + Intergenic
927789814 2:26001414-26001436 GGGGAACTACAAAAAGGGGGTGG - Intergenic
929303013 2:40327744-40327766 TGGGGACTCCAAAAGGAGGGAGG + Intronic
929832437 2:45357965-45357987 GGAGGACTTCAAAATGGAGATGG + Intergenic
930277121 2:49324709-49324731 TGGGGACTCCAAAGGAGGGAGGG + Intergenic
930452599 2:51560810-51560832 TGGGGACTCCAAAAGGGGAGAGG + Intergenic
930815599 2:55594134-55594156 TGGGAACTCCAAAAAGGGGTAGG + Intronic
931476747 2:62595372-62595394 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
931584604 2:63811763-63811785 TGGGGACTCCAAAATGGGGAGGG - Intronic
931795273 2:65702360-65702382 TGGGGACTCCAAAAGGAGGGAGG + Intergenic
933118826 2:78509562-78509584 TGGGGACTCCAAAAAGAGGAAGG + Intergenic
933783222 2:85816386-85816408 TGGGGACCCCAAAACTGGGGAGG + Intergenic
934782253 2:96978448-96978470 TGGGGACTCCAAAAGTGGGGAGG - Intronic
934984228 2:98872447-98872469 TGGGGACTTCAAAAGGGGGAGGG + Intronic
935088527 2:99871716-99871738 TGGGGACTCCAAAACATGGGAGG + Intronic
935555461 2:104505175-104505197 GGTGGACTCAAAAACTGTGAGGG + Intergenic
935726421 2:106027890-106027912 TGGAGACTCCAAAAGTGGGAAGG + Intergenic
936560044 2:113529887-113529909 GGGGGACTCCAAAGGTGGGAGGG - Intergenic
936967687 2:118143059-118143081 TGGGGACTCCAAATTGGGGGAGG - Intergenic
939314105 2:140524782-140524804 TGGGGACTCCAAAAGGGGAGAGG + Intronic
940965962 2:159837479-159837501 TGGGGACTCCAAAAGTGGGGAGG + Intronic
941050611 2:160728791-160728813 TGGGGACTCCAAAAGGGGGAAGG + Intergenic
942140124 2:172968927-172968949 GGAGGACAGCAAAAAGGGGATGG - Intronic
942421713 2:175814622-175814644 TGGGGACTCCAAAAGGAGGGAGG + Intergenic
942931842 2:181502985-181503007 GGGGCACACCAAGACGGTGAGGG + Intronic
943057474 2:182999986-183000008 TGGGGACTCCAGAAGTGGGAAGG + Intronic
943638384 2:190331885-190331907 TGGGGACTCCAAAAAGGGGGAGG + Intronic
943900822 2:193433396-193433418 TGGGGACTACAAAATGGGGAAGG + Intergenic
946019788 2:216633337-216633359 AGTGGTCTCCAAAAGGGGGAGGG + Intronic
946441541 2:219701141-219701163 TGGGGACTCCAAAAAGGGGTAGG - Intergenic
946784980 2:223234410-223234432 TAGGGACTCCAAAAGGAGGAAGG + Intergenic
946822986 2:223649059-223649081 GGAGGCCTCCAAAAAGGGGTGGG - Intergenic
947718450 2:232353202-232353224 GGGGGACCCCAAAAGAGTGAGGG - Intergenic
1169423182 20:5475635-5475657 GGGGGACCCCAACACGGACAGGG + Intergenic
1169663368 20:8005863-8005885 TGGGGAGGCCAGAACGGGGATGG - Intronic
1170147288 20:13190138-13190160 TGGGGACTCCAAAAGAGGGTAGG + Intergenic
1170151789 20:13234121-13234143 TGGGGACTCCAAAAGGTGGGAGG - Intronic
1170282065 20:14660704-14660726 TGGGGATTCCAAAAAGAGGAGGG - Intronic
1170383418 20:15787466-15787488 GGGGGACTCCTACTGGGGGATGG - Intronic
1172771752 20:37386214-37386236 GTGGGACTTCAAAGCGGGCAGGG + Intronic
1174515437 20:51088653-51088675 TGGGGACTCCAAAAGGGGGAAGG - Intergenic
1175429649 20:58892048-58892070 CGGGGGCTCAAAAACGGGGCGGG + Intronic
1176685562 21:9845713-9845735 GGGTGACTCAAATACGGGGTGGG - Intergenic
1178071625 21:28974685-28974707 GGGGGACTCTAGAAAGGAGAGGG + Intronic
1178832307 21:36066321-36066343 CGGGGATTCCAAAAGGGGGAGGG - Intronic
1179171275 21:38974851-38974873 GGAGGAGTCCAAAAGAGGGAAGG + Intergenic
1179371427 21:40809356-40809378 GTGGGACTTCAAAGCAGGGATGG + Intronic
1179901604 21:44396965-44396987 GGGCGTCTCCAACACTGGGAAGG + Intronic
1182283422 22:29231080-29231102 GGGGGACCCCAGAGCGGGGCAGG - Exonic
1183568129 22:38631374-38631396 GGGGGACTCTCAAAAGGGGGAGG + Intronic
1183796883 22:40126401-40126423 TGGGGACTCCAAAAGGGAGAGGG - Intronic
1185409222 22:50673879-50673901 GGGGACCTCCAGACCGGGGAGGG - Intergenic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
951008408 3:17646899-17646921 TGGGGACTCAAAAAGTGGGAGGG - Intronic
952685239 3:36140326-36140348 TGCGGACTCCAAAAAGTGGAAGG - Intergenic
954065457 3:48102411-48102433 TGGGGACTCTAAAACAGGGTAGG - Intergenic
954749082 3:52803733-52803755 GGGGGACCCCACAATGGGGAAGG + Intronic
955767556 3:62360771-62360793 TGGGGACTCCAAAAAGTGGGAGG + Intergenic
956344434 3:68262436-68262458 GGTGGACTACTAAAGGGGGAAGG - Intronic
956685221 3:71820574-71820596 TGGAGACTCCAAAAGGGGGGAGG + Intergenic
956956811 3:74350911-74350933 TGGGGACTCCAAAAGCGGGGAGG + Intronic
959291721 3:104483760-104483782 TGGGGACTCCAAAAGAGGGAAGG + Intergenic
960080252 3:113533298-113533320 AGGGGACTCCAAAGCAGCGACGG - Intronic
961670664 3:128526547-128526569 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
963026107 3:140920788-140920810 TGGGGACTCCAAAAGGGGAGAGG + Intergenic
963089361 3:141467864-141467886 TGGGGACTCCAAAAAGGGGAAGG - Intergenic
963717330 3:148818799-148818821 TGAGGACTCCAAAAAGGGAAAGG - Intronic
964419390 3:156485748-156485770 TGGGGACTCCAAAAGAGGGGAGG - Intronic
965651923 3:170943143-170943165 TGGGGACTCCAAAAGCGGGCAGG - Intergenic
966331051 3:178814153-178814175 TGGGGACTCCAAAAGGGGGCAGG - Intronic
966562287 3:181336275-181336297 TGGGGACTCCAAAAGCGGGGAGG + Intergenic
966577149 3:181515017-181515039 TGGGGACTACTAAAGGGGGAAGG - Intergenic
967197025 3:187036739-187036761 TGGGGACTACAAGACGGGGAAGG + Intronic
968566381 4:1315794-1315816 GGGGGACACGCACACGGGGAGGG - Intronic
969498577 4:7539998-7540020 CGGGGCCTCCATAACAGGGAGGG - Intronic
969780257 4:9395894-9395916 TGGGGACTACTAGACGGGGAAGG + Intergenic
972680239 4:41299164-41299186 TGGGAACTCCAAAAGAGGGAAGG - Intergenic
974507848 4:62800012-62800034 TGGGGACTCCAAAAGAGGGTAGG - Intergenic
975276990 4:72513843-72513865 TGGGGACTCTAAAAAGAGGAAGG - Intronic
976980924 4:91227674-91227696 TGTGGACTCCAAAAGGGGAAGGG - Intronic
977491798 4:97723315-97723337 TGAGGACTCCAAAAGGGGGGAGG + Intronic
978025732 4:103871699-103871721 TGGGGACTCCAAAAATGGAAAGG - Intergenic
979318048 4:119289804-119289826 GGGGGAATCAAAAACTGAGATGG + Intronic
979553804 4:122021735-122021757 TAGGGACTCTAAAAGGGGGAAGG + Intergenic
980610347 4:135152370-135152392 TGGGGACTCCAAAACAGGGAAGG - Intergenic
980622261 4:135323062-135323084 TGGGGACTACAAGAGGGGGAGGG + Intergenic
980717067 4:136640277-136640299 GGGGGAAACCAAAAGGGGGATGG - Intergenic
981793642 4:148569414-148569436 TGGGGACTCCAAAATGAGGGAGG + Intergenic
982643916 4:157998177-157998199 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
982954762 4:161749846-161749868 TGGGGACTCCAAAAAAGGGAGGG + Intronic
983018663 4:162647134-162647156 CGGGGACTCCAAAAAAGGGGAGG - Intergenic
983263510 4:165483150-165483172 TGGGGACTCCAAAAGCGGGGAGG - Intronic
983596487 4:169473338-169473360 TGGGGACTCCAAAAGGGGAGAGG + Intronic
986909712 5:12540136-12540158 TGGGGACTCCAAAAATGGGGAGG + Intergenic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
987868145 5:23573451-23573473 GGGAGACTCCAAAAGGTGGGAGG - Intergenic
988405256 5:30816120-30816142 TGGGGACTACTAAAGGGGGAAGG - Intergenic
989369953 5:40695911-40695933 TGGGGACTCCAAAAGTGGGGAGG + Intergenic
989728407 5:44617468-44617490 TGGGGACTCCAAAAGTGGGGAGG - Intergenic
989957340 5:50372850-50372872 GGGGGGCTCCATACTGGGGATGG - Intergenic
990537663 5:56738797-56738819 TGGGGACTCCAAAAGGGGAGAGG - Intergenic
990904680 5:60791352-60791374 TGGGGACTTCAAAATGGGGGAGG + Intronic
991041461 5:62180199-62180221 CTGGGACTCCAAAAGGGGGGAGG + Intergenic
991212493 5:64122028-64122050 TGGGGATTCCAAAACAGGGGAGG - Intergenic
992890328 5:81198269-81198291 TGGGGACTCCAAAAGGAGGGAGG - Intronic
993173789 5:84455580-84455602 TGGGGACTCCAAAAGGTGGGAGG - Intergenic
993555041 5:89325926-89325948 TGGGGACTCCAAAAGCGGGGAGG - Intergenic
993919366 5:93781167-93781189 TGGAGACTCCAAAAGGTGGAAGG - Intronic
994047456 5:95325924-95325946 TGGGGACTCCAAAAGGGGGTAGG - Intergenic
994166314 5:96612415-96612437 TAAGGACTCCAAAACAGGGAGGG + Intronic
994846476 5:104994797-104994819 TGGGGACTACAAGAGGGGGAAGG - Intergenic
996939303 5:128984607-128984629 TGGGGACTCCAAAATGGGGGAGG - Intronic
1000011470 5:157237366-157237388 TGGGGACTCCAAAAGTTGGAAGG + Intronic
1000100928 5:158015480-158015502 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
1001305616 5:170570447-170570469 GGGGCACTCAAAAAAGGGGGTGG - Intronic
1001632961 5:173190221-173190243 TGGGGATTCCAAAAGTGGGAGGG - Intergenic
1001673248 5:173491651-173491673 TGGGGACTCCAAAAGGAGGGAGG - Intergenic
1003667633 6:8126621-8126643 TGGAGATTCCAAAAAGGGGAAGG + Intergenic
1003745405 6:8995962-8995984 TGGGGACTCCAAAAGGGAGGAGG - Intergenic
1009285490 6:61811110-61811132 TGGAGACTCCAAAAAAGGGAAGG - Intronic
1009773114 6:68169954-68169976 TGGGTACTCCAAAAGGAGGAAGG - Intergenic
1010310827 6:74383760-74383782 TGGGGACTCCAAAAGGGGAGAGG - Intergenic
1011612790 6:89169511-89169533 TGGGAACTCCAAAAGGGGGTGGG - Intergenic
1011769437 6:90659776-90659798 TGGGAACTCCAAAACAGGGGAGG + Intergenic
1011995901 6:93588054-93588076 TAGGGACTCCAAAAGGGGGAAGG + Intergenic
1012200356 6:96398718-96398740 TGGAGACTCCAAAATGGGAAAGG + Intergenic
1013946466 6:115728447-115728469 GGGGGAAGCCAAAAGGGGGATGG - Intergenic
1014318976 6:119902319-119902341 TGGGGATTCCAAAAGAGGGAAGG - Intergenic
1014650768 6:124034286-124034308 GGAGGACTCCATAAGAGGGAGGG - Intronic
1014902860 6:126988987-126989009 TGGGGACTCCAAAAAGGGGAAGG + Intergenic
1015100083 6:129467343-129467365 TGGGGACTCCAAAAGGGGGGAGG + Intronic
1015281506 6:131439792-131439814 TGGGGACTCCAAAAGGGGGAAGG + Intergenic
1015477156 6:133666855-133666877 TGGGGACTCCAAAAGTGGGGAGG + Intergenic
1016173264 6:141046292-141046314 AGGGGACTACAAGAAGGGGAAGG - Intergenic
1017001176 6:149998961-149998983 GAGAGGCTCCAAAATGGGGAGGG - Intergenic
1018041708 6:159930065-159930087 GGGAAAATCCAGAACGGGGATGG - Intergenic
1018461880 6:164006340-164006362 TGGGAACTCCAAAAGGGGGGAGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019983741 7:4640484-4640506 GGGGGACTAGGAAAAGGGGATGG + Intergenic
1020257708 7:6511090-6511112 AGGGACCTCCAAAACAGGGAGGG + Intronic
1020632094 7:10651738-10651760 TGGGGACTCCAAAAGGTGGAGGG + Intergenic
1021133046 7:16934269-16934291 AGCGGACTCCATAATGGGGAGGG - Intergenic
1022783944 7:33616864-33616886 TGGAGACTCCAAAAGGTGGAAGG - Intergenic
1024765243 7:52650024-52650046 TGGGGACTCCAAAAATGGGGAGG - Intergenic
1024815294 7:53261789-53261811 TGGGGACTCCAAAATAGGGGAGG + Intergenic
1025101406 7:56138360-56138382 TGGGGACTCCAAAAGAGGGGAGG + Intergenic
1026227653 7:68456854-68456876 TGGAGACTCCAAAATGGGGGAGG + Intergenic
1026583098 7:71634133-71634155 TGGAGACTCCAAAAAGGGGGAGG - Intronic
1026622036 7:71958250-71958272 TGGGGACTCCATAAAGGGGGAGG - Intronic
1026693176 7:72567748-72567770 TGGGGACTACAAAACTGGGGAGG - Intronic
1027139288 7:75645927-75645949 TGGGGACTCCAAAAGGGAGGAGG + Intronic
1028644965 7:93085837-93085859 TGGGGACTCCAAAAGGGAGAGGG + Intergenic
1029447231 7:100620578-100620600 GGAGGACCCCAGAAAGGGGAAGG + Exonic
1031661309 7:124428546-124428568 TGGGAACTCCAAAAGGGGAAAGG + Intergenic
1032019281 7:128397889-128397911 TGGGGACTCCAAAATGGGAGAGG - Intronic
1032770736 7:135052577-135052599 TGGGGACTCCAAGATGGGGGAGG - Intronic
1033990199 7:147273513-147273535 CGGGGACTCCAAAGTGGGGTGGG - Intronic
1034560522 7:151876858-151876880 GGGAGACACCAGAACCGGGACGG - Exonic
1035090333 7:156305190-156305212 CAGGGACTCCAAGGCGGGGATGG - Intergenic
1037166083 8:15830745-15830767 GGGGGACTCCAAAGGGAGGAAGG + Intergenic
1038072275 8:24030331-24030353 TGGGGACTCCAATAGGGGGATGG + Intergenic
1039836402 8:41259605-41259627 TGGGGACTCCAAAAGGAGGAAGG + Intergenic
1041110799 8:54480653-54480675 TGGGGACTCCAAAATGGAGAAGG + Intergenic
1041283287 8:56233387-56233409 TGGGGACTCCAAAAGTGGGGAGG - Intergenic
1041288708 8:56287250-56287272 TGGGGATTCCAAAAAGGGGGAGG + Intergenic
1043841120 8:85106030-85106052 TGGGGACTCCAAAAGGGGGAAGG + Intergenic
1043871144 8:85434419-85434441 TGGGGACTCCAAAAGAGGGGAGG + Intronic
1044493733 8:92851164-92851186 TGGGGACTCCAAAAGGGGAAAGG - Intergenic
1044695128 8:94915075-94915097 TGGGGACTCCAAAAGCGGGGAGG - Intronic
1044970053 8:97610636-97610658 TGGGGACTCCAAAATGGGGGAGG - Intergenic
1047827249 8:128590572-128590594 TGGGGACTCCAAAAGAGAGAAGG + Intergenic
1047907186 8:129484718-129484740 GGGAGAGTCCAAAAATGGGAAGG - Intergenic
1048142992 8:131813280-131813302 TGGGAACTCCAAAAGGGGGAAGG - Intergenic
1048724461 8:137366714-137366736 TGGGGACTCCAAAAGAGGGGAGG - Intergenic
1049892823 9:86481-86503 GGGGGACTCCAAAGGTGGGAGGG + Intergenic
1051567624 9:18518304-18518326 TGGGGACTCCAAAAGAGGAAAGG - Intronic
1053734048 9:41086540-41086562 GGGGGACTCCAAAGGTGGGAGGG + Intergenic
1054694357 9:68345013-68345035 GGGGGACTCCAAAGGTGGGAGGG - Intronic
1056187469 9:84149939-84149961 TGGGGACTACAAAATGTGGAAGG + Intergenic
1057311946 9:93948449-93948471 AGGGGAATCCAGAACAGGGAAGG + Intergenic
1057466591 9:95319422-95319444 TGGGGACTCCAAAAAGGGAGAGG - Intergenic
1058200972 9:102040081-102040103 TGGGGACTTCAAAACAAGGAAGG - Intergenic
1058326449 9:103704503-103704525 TGGGGACTCCAAAATGGGGGAGG + Intergenic
1058405297 9:104666774-104666796 TGGGGACTCCAAAAGGGGGAAGG + Intergenic
1059344018 9:113616190-113616212 GGGGGACTCCAGACTGGGGAAGG + Intergenic
1059603357 9:115805928-115805950 TGGGGATTCCAGAAGGGGGAAGG + Intergenic
1062183243 9:135202457-135202479 GTGGGATTCCAGAACCGGGAAGG - Intergenic
1185871000 X:3664798-3664820 CGGGGACTCCCAAAAGGGGAAGG + Intronic
1185872883 X:3679217-3679239 TGGGGATTCCAAAAAGAGGAAGG - Intronic
1185912499 X:3998011-3998033 TGGGGACTCCAAAAAGGGGTAGG - Intergenic
1185931098 X:4204321-4204343 TGGGGACTCCAAAAAAGGGGAGG + Intergenic
1186173714 X:6903776-6903798 TGGGGACTCAAAAAGAGGGAAGG + Intergenic
1186372594 X:8962555-8962577 TGGGAACTCCAAAAGGGAGAAGG + Intergenic
1186798412 X:13068572-13068594 GGGAGACTACCACACGGGGATGG - Intergenic
1187133195 X:16522418-16522440 TGGGGACTCCAAAAGGAGGGAGG + Intergenic
1187637224 X:21242966-21242988 TGGAGACTCTAAAACGAGGAAGG - Intergenic
1187671520 X:21670856-21670878 TGGGGACTCCAAAAGAGGGGAGG - Intergenic
1188026250 X:25212755-25212777 TGGGGACTCCAAAAGCGGGGTGG - Intergenic
1188081222 X:25843252-25843274 TGGGGACTCCAAAAGGAGGGAGG + Intergenic
1188208633 X:27392099-27392121 TGGGGACTCCAAAAGTGGGGAGG + Intergenic
1189778899 X:44495111-44495133 AGGGGACTCCAAAAGGGGGAAGG - Intergenic
1191204927 X:57823540-57823562 TGGGGACTCCAAAATGGGGAAGG + Intergenic
1192363690 X:70454593-70454615 GGGCGACTGGAAAAAGGGGAGGG + Intronic
1192724294 X:73731510-73731532 TAGGGACTCCAAAAGGGGCAAGG - Intergenic
1193261088 X:79406986-79407008 TGGGGACTCCAAAAGTGGGGAGG + Intergenic
1193272750 X:79547938-79547960 GGGAGACTCCAAAAAGGTGGAGG + Intergenic
1193889333 X:87024371-87024393 TGGAGACTCCAAAAGTGGGATGG - Intergenic
1194183860 X:90747210-90747232 TGGGGACTACAAAATGGGGGAGG - Intergenic
1194289885 X:92058238-92058260 TGCAGACTCCAAAAAGGGGAAGG + Intronic
1195824332 X:108981512-108981534 TGGGGAATCCAAAACAGGGTGGG + Intergenic
1195950998 X:110272667-110272689 TGGAGACTCCAAAAGTGGGAAGG - Intronic
1195987805 X:110649836-110649858 AGGGGACTCCAAAACAGGGTAGG - Intergenic
1197323981 X:125069160-125069182 TGGGGACTCCAAAATTGGGGAGG - Intergenic
1197324994 X:125081976-125081998 TGGGGACTCCAAAAGGGGCAAGG + Intergenic
1197584390 X:128327373-128327395 TGGGGACTCCAAAGTGGGGAAGG - Intergenic
1197704770 X:129626730-129626752 TGGGGACTCCAAAAGGTGGGAGG + Intergenic
1197841684 X:130754724-130754746 GGGGGATTACAAAAGGGGGAGGG + Intronic
1197907156 X:131437767-131437789 TGGTGACTCCAAAATGGGGGAGG - Intergenic
1198497329 X:137205528-137205550 CGGGGACTCCAAAAGGGGAGAGG - Intergenic
1199790139 X:151146082-151146104 TGGGGACTCCAAAAGGGGAGAGG + Intergenic
1199891102 X:152083026-152083048 TGGGGACTACAAGAAGGGGAAGG + Intergenic
1200530454 Y:4329142-4329164 TGGGGACTACAAAATGGGGGAGG - Intergenic
1200607398 Y:5282816-5282838 TGCAGACTCCAAAAAGGGGAAGG + Intronic
1200793088 Y:7316714-7316736 CGGGGACTCCCAAAAGGGGAAGG - Intergenic