ID: 903590529

View in Genome Browser
Species Human (GRCh38)
Location 1:24452520-24452542
Sequence TAGTTAACCCTCTGTGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903590529_903590532 9 Left 903590529 1:24452520-24452542 CCTACTCCACAGAGGGTTAACTA 0: 1
1: 0
2: 0
3: 3
4: 75
Right 903590532 1:24452552-24452574 GAAGTTAAGTGACTTACCCAAGG 0: 2
1: 63
2: 428
3: 1811
4: 4919
903590529_903590535 29 Left 903590529 1:24452520-24452542 CCTACTCCACAGAGGGTTAACTA 0: 1
1: 0
2: 0
3: 3
4: 75
Right 903590535 1:24452572-24452594 AGGCCACACGACTAGTTTAGAGG 0: 1
1: 0
2: 1
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903590529 Original CRISPR TAGTTAACCCTCTGTGGAGT AGG (reversed) Intronic
901436788 1:9251409-9251431 TAGTTTCCCCTCTGTGTAGAAGG + Intronic
903590529 1:24452520-24452542 TAGTTAACCCTCTGTGGAGTAGG - Intronic
906254822 1:44340214-44340236 TAGTTAGGCCTCTGAGGAGCAGG - Intronic
907751531 1:57267950-57267972 TAATAAACCCTGTGGGGAGTTGG - Intronic
921770825 1:219037947-219037969 TTGTTAATCCTCTGTGGCATTGG + Intergenic
1063720664 10:8577903-8577925 TAGTGAAACCTTTGTCGAGTTGG - Intergenic
1075921869 10:126220195-126220217 TAGTTAACTCTCTGAAGAGCTGG + Intronic
1077039040 11:509902-509924 CAGTTCACCCACTGTGGAATTGG + Intergenic
1080101001 11:28459286-28459308 TTCATAAGCCTCTGTGGAGTGGG + Intergenic
1085281703 11:75335229-75335251 TACTTAACCCTCCCTGCAGTAGG + Intronic
1087368531 11:97251878-97251900 TAGTTAACCATGTGTAGACTTGG + Intergenic
1091318993 11:134636434-134636456 TAGTTGGCCCTATGGGGAGTGGG - Intergenic
1098192541 12:67965702-67965724 TAGTTAACCCTTTGTAAAGGGGG - Intergenic
1101629911 12:106483150-106483172 AAGTTGTCCCTCTGTGGAGAAGG + Intronic
1103410824 12:120710430-120710452 TAGTTACCGCGCTGTGGAGGCGG + Exonic
1103693999 12:122799447-122799469 CAGATCACCCTCGGTGGAGTGGG - Intronic
1103981865 12:124741977-124741999 CAGTTTCCCCTCTGTGGAATAGG + Intergenic
1106382329 13:29252406-29252428 TAGTTAACCTTTTCTGGAGTAGG + Intronic
1108466351 13:50719943-50719965 TAGTTCTCACTTTGTGGAGTAGG + Intronic
1110149634 13:72235188-72235210 TAGTTAAGCCACTGTAGAATAGG - Intergenic
1120720127 14:87881495-87881517 TATTTAATCCTCTATGAAGTGGG - Intronic
1125332610 15:38597060-38597082 TAATTAATACTCTGTGGGGTAGG - Intergenic
1126883518 15:53124715-53124737 TACTTTATCCTCTGTGGAGTGGG + Intergenic
1127820953 15:62655618-62655640 CAGTACACCCTCTGTGGAGCAGG - Intronic
1127821192 15:62657670-62657692 CAGTACACCCTCTGTGGAGCAGG - Intronic
1129790584 15:78338292-78338314 CACTCAACCCTCTGTGAAGTGGG + Intergenic
1133147572 16:3801190-3801212 TGGTCAGCCCTCTGTGGAGGAGG - Intronic
1135199881 16:20428258-20428280 TTGTTAGCCACCTGTGGAGTGGG + Intronic
1141353211 16:83318044-83318066 CAGTTTTCCCTCTGTGAAGTAGG + Intronic
1142144287 16:88486360-88486382 CAGTAGACCCTCTGTGAAGTGGG + Intronic
1144844625 17:18210172-18210194 AAGTTCACCCTCCTTGGAGTGGG - Intergenic
1153870800 18:9318131-9318153 TTGTTAACCCCCTCTGGATTAGG - Intergenic
1156007683 18:32462999-32463021 TAGTCACCCCACTGTGCAGTAGG - Intronic
1162530664 19:11234524-11234546 TAGTGAACCCTCAATAGAGTTGG - Intronic
1163110693 19:15159623-15159645 TAGTTAACACTCAGTGTTGTTGG - Exonic
1165531884 19:36409848-36409870 TAGATCAGCCTCTGTGGACTCGG - Exonic
1166352253 19:42204947-42204969 TGCTTATCCCTCTCTGGAGTTGG - Intronic
930900415 2:56500160-56500182 TACTTACCTCTCTGGGGAGTGGG + Intergenic
933621754 2:84551118-84551140 TAATTAGCTTTCTGTGGAGTGGG - Intronic
935380388 2:102445997-102446019 TAGTAAACGCTCTGTGAAGGGGG + Intronic
936655763 2:114485060-114485082 TAGACAAAGCTCTGTGGAGTGGG + Intronic
940857713 2:158742457-158742479 TAGTTAGCCCTGTGTGGTGGTGG - Intergenic
943127401 2:183811765-183811787 TAGTGAACACGATGTGGAGTAGG + Intergenic
1172514983 20:35527231-35527253 TAGGTCACCCTCTTTGGATTTGG - Exonic
1173236782 20:41253549-41253571 TAGATATTCCTCTGGGGAGTAGG + Intronic
1173335092 20:42106261-42106283 TAGGCAACTCTCTGTGCAGTTGG - Intronic
1176692774 21:9936930-9936952 TAGTAAACCATTTGTGGGGTGGG + Intergenic
1178911898 21:36681470-36681492 TAATTTATCCTCTTTGGAGTTGG - Intergenic
1182650121 22:31844935-31844957 CAGTAAACTCTCTGTGGAGTTGG - Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183342242 22:37287820-37287842 CATTTAACCCTCTTTGAAGTAGG - Intronic
1183677694 22:39309043-39309065 TACGGAACCCTCTGTGGATTAGG - Intergenic
959728245 3:109570112-109570134 TATTTAGCCCACTGGGGAGTTGG + Intergenic
962592629 3:136906623-136906645 TTTTTAAACCTCTGTGCAGTGGG + Intronic
964569451 3:158095554-158095576 TCGTTGACCCTCTCTGGAGCGGG - Intergenic
970192683 4:13530565-13530587 TAGTTAAAGCCCTTTGGAGTGGG - Intergenic
971368057 4:25993469-25993491 TATTTAACACACTGTGTAGTGGG - Intergenic
975652906 4:76612260-76612282 TAGTTAAACCTCTGGCTAGTTGG + Intronic
975745043 4:77466963-77466985 TAGTTAATCCTTTGGGGACTTGG + Intergenic
977238462 4:94537745-94537767 TACTTAACTCTCTGTAAAGTAGG - Intronic
985232183 4:187831327-187831349 TAGTCATCCCTCAGTGTAGTTGG + Intergenic
996789978 5:127282070-127282092 TAGTTAGACTTCTGTGAAGTGGG - Intergenic
1004478916 6:16000448-16000470 TGGGGAAGCCTCTGTGGAGTTGG + Intergenic
1011991698 6:93528307-93528329 TATTTAATCCTCTGTGAAATGGG - Intergenic
1015193800 6:130502904-130502926 TTGTTCACCCTCTATGTAGTGGG + Intergenic
1019792033 7:3021198-3021220 TAGTTCACCCATTGTGGAGATGG + Intronic
1021389702 7:20076792-20076814 TAGTTATCCCTGTGTGAATTAGG - Intergenic
1022044349 7:26611369-26611391 TCTGTAACTCTCTGTGGAGTTGG - Intergenic
1030755333 7:113281072-113281094 CAATTAACCCTCTGTGGCCTTGG - Intergenic
1031224892 7:119023490-119023512 TAGTTACCCCACTGTGCATTAGG - Intergenic
1034151064 7:148915692-148915714 CATTTTCCCCTCTGTGGAGTGGG - Intergenic
1035481545 7:159191225-159191247 CTGTTAACCCTCTGTGGATCAGG + Intergenic
1043523304 8:81069805-81069827 TTGTAAAGCCTCTGTGAAGTTGG - Intronic
1043919747 8:85967740-85967762 TAGTGATCCCTCTGAGGAGAGGG + Intergenic
1045656028 8:104387445-104387467 AAGTGAACCCTCTGTGCAGAGGG + Intronic
1059304463 9:113342774-113342796 TAGTTAACCCAGTCTGGAGAAGG - Intergenic
1061990087 9:134154118-134154140 GAGTTGTCCCTCTGTTGAGTTGG + Intronic
1185630629 X:1514058-1514080 TTGTTAACGCTATGTGTAGTGGG - Intronic
1198375533 X:136035337-136035359 TGGTTACCCCTTTGTGGAGGGGG - Intronic