ID: 903590992

View in Genome Browser
Species Human (GRCh38)
Location 1:24455882-24455904
Sequence TAGGATTACCTTCAGGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903590983_903590992 28 Left 903590983 1:24455831-24455853 CCTCAGAGAACTGAACTTACTGC 0: 1
1: 0
2: 3
3: 10
4: 152
Right 903590992 1:24455882-24455904 TAGGATTACCTTCAGGGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 90
903590985_903590992 6 Left 903590985 1:24455853-24455875 CCCATGCTTGGCAGTTTAGAAGT 0: 1
1: 0
2: 2
3: 11
4: 126
Right 903590992 1:24455882-24455904 TAGGATTACCTTCAGGGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 90
903590986_903590992 5 Left 903590986 1:24455854-24455876 CCATGCTTGGCAGTTTAGAAGTG 0: 1
1: 0
2: 0
3: 14
4: 170
Right 903590992 1:24455882-24455904 TAGGATTACCTTCAGGGGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903590992 Original CRISPR TAGGATTACCTTCAGGGGGT TGG Intronic
902134462 1:14292824-14292846 CAGTATCAGCTTCAGGGGGTTGG - Intergenic
903590992 1:24455882-24455904 TAGGATTACCTTCAGGGGGTTGG + Intronic
905076299 1:35273783-35273805 ACTGATTACCTTCAGTGGGTAGG + Intronic
907158612 1:52355762-52355784 TAGGGTTACCTGGAGGGGCTGGG + Exonic
908758056 1:67487084-67487106 TAGTAGTAGCTTCACGGGGTTGG - Intergenic
915632550 1:157163491-157163513 CAGGATCACCTGCAGGGGGCAGG - Intergenic
916237061 1:162600605-162600627 TAGGATGTCATTCATGGGGTGGG + Intergenic
919596532 1:199570727-199570749 AAGGAGTCCATTCAGGGGGTTGG - Intergenic
921863240 1:220061615-220061637 TAGGATGACTTTCAGGTGTTTGG + Intronic
1063267862 10:4474240-4474262 TAGGACTATCCTCAGGGGGTCGG + Intergenic
1078897879 11:15613959-15613981 TAGTATTTACTTCATGGGGTTGG + Intergenic
1080008068 11:27430405-27430427 GAGGTTTACCTTCAGGGGAATGG + Intronic
1080034675 11:27699744-27699766 TAGGAATCCTTCCAGGGGGTGGG - Intronic
1084910021 11:72381133-72381155 AAAGATTACCTACAGAGGGTAGG + Intronic
1092121920 12:6050422-6050444 CAAGAGTAACTTCAGGGGGTGGG - Intronic
1092907052 12:13110732-13110754 TAGGAATCCCTTCAGGGGGCTGG - Intronic
1096872668 12:54603805-54603827 TAAGTTTGCCTTCAGAGGGTGGG - Intergenic
1097201696 12:57284365-57284387 TGGGATTACCCTCAGAGGGTGGG - Intronic
1098132101 12:67361677-67361699 TTGGAGTACCATCAGGGGCTGGG + Intergenic
1101421670 12:104555953-104555975 AGGGATTACCATCAGGTGGTGGG + Intronic
1101574381 12:105983932-105983954 TAGGATGACTTTGAGGGAGTGGG + Intergenic
1106703486 13:32255309-32255331 TAGGATTTCCTGCAGTAGGTAGG + Intronic
1106735232 13:32582585-32582607 AAGGATCAACTTCAGGGGCTTGG + Intergenic
1107086818 13:36433852-36433874 TAAGATCACCTTGAGGGGTTCGG + Intronic
1108640458 13:52378395-52378417 TGGGATTATCTTCTGGGCGTTGG + Exonic
1109453585 13:62551845-62551867 TAGGATTCCCATAATGGGGTGGG + Intergenic
1112891154 13:104233326-104233348 GATGACTACCTTCGGGGGGTCGG + Intergenic
1113089323 13:106600396-106600418 CAGGATGACCTTCATGGGCTTGG - Intergenic
1113734790 13:112670866-112670888 TAAGACTACATTCAGGGGGCTGG - Intronic
1114793183 14:25682038-25682060 GATGATTTCCTTCATGGGGTGGG - Intergenic
1118641550 14:67797531-67797553 AAGGGTTACCTTGAGGGAGTGGG + Intronic
1121086168 14:91147845-91147867 TAAAATTACCTTCAGTTGGTTGG - Exonic
1124818212 15:33018100-33018122 TACCATCACCTTAAGGGGGTAGG - Intronic
1126257667 15:46646832-46646854 TAGGAATTTCCTCAGGGGGTAGG + Intergenic
1126677041 15:51169158-51169180 TTGGATTTGCTTCAGGGAGTGGG + Intergenic
1129970242 15:79772076-79772098 TAGGATTTCCCTCACGGGGAAGG - Intergenic
1132022412 15:98373994-98374016 GATGATTGCCTTCATGGGGTTGG - Intergenic
1132651609 16:1023706-1023728 TAGGATTAGCTCCAGGGACTTGG - Intergenic
1133497098 16:6329067-6329089 AAAGATTAACTTCAGGGGGAAGG - Intronic
1137372410 16:47919959-47919981 TAGGATTCCATTCAGGAGGAAGG + Intergenic
1143617520 17:8062423-8062445 TAGGGTTACCTTCAGGTTTTTGG - Intergenic
1144965469 17:19074807-19074829 TTGGATTTCATTCTGGGGGTTGG - Intergenic
1144982498 17:19177376-19177398 TTGGATTTCATTCTGGGGGTTGG + Intergenic
1144985725 17:19200863-19200885 TTGGATTTCATTCTGGGGGTTGG - Intergenic
1149205096 17:54234751-54234773 TACCATCACCTTGAGGGGGTAGG - Intergenic
1149206095 17:54250298-54250320 TAAGATTAACTTCAAGGGTTCGG + Intergenic
1149782677 17:59410365-59410387 CAGGAATCCCTTCAGGGGGCTGG + Intergenic
1150268593 17:63847821-63847843 ATGGATGTCCTTCAGGGGGTTGG + Intergenic
1153365600 18:4252107-4252129 TTGAATGACCTTCAGGGAGTTGG + Intronic
1155964117 18:32019722-32019744 AAGGAGTACATTCAGGGGCTTGG - Intronic
1157046374 18:44105709-44105731 CAAGATTCCCTTGAGGGGGTGGG + Intergenic
1157801852 18:50627298-50627320 AAGGATTCCCCTCAGGGGGAAGG + Intronic
1159339748 18:67119506-67119528 TAGTGTTACCTGCTGGGGGTGGG - Intergenic
928786193 2:34888523-34888545 TTGGTGTACCTGCAGGGGGTGGG + Intergenic
939995277 2:148914208-148914230 TACCCTTACCTACAGGGGGTAGG - Intronic
940257882 2:151750405-151750427 TAGGCTTTCCTGCAGGGTGTGGG + Intergenic
946949069 2:224852368-224852390 TTGGCTCACCTTCAGGGGCTTGG + Exonic
947332210 2:229041771-229041793 TAAGATTGGGTTCAGGGGGTTGG - Intronic
1169073042 20:2745419-2745441 TAGCATTACCTGCAGAGTGTGGG - Intronic
1173139139 20:40467075-40467097 GAGTATTACCTTCTGAGGGTTGG - Intergenic
1173534823 20:43801419-43801441 TTGCATTACCTTCAGGTGTTGGG + Intergenic
1178581099 21:33839360-33839382 TCAGAGAACCTTCAGGGGGTGGG + Intronic
1179232682 21:39519333-39519355 TAGGCTTACAATCAGGGTGTGGG + Intergenic
949690925 3:6638162-6638184 GAGGATTAAATTCAGTGGGTAGG + Intergenic
955055501 3:55451774-55451796 TAGGAGTTCCTTGAGGGAGTTGG - Intergenic
956698042 3:71935318-71935340 TGTGATTACCTGGAGGGGGTTGG - Intergenic
974388766 4:61236541-61236563 TAGAATAACATTCAGGGGGAGGG - Intronic
975493894 4:75017039-75017061 TAGGATTACTTTGAGGGTTTTGG - Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977471657 4:97450988-97451010 TAGAATTACCTTCTGGAGGCAGG + Intronic
978294148 4:107183516-107183538 TGGGATTTCCATCAGGAGGTAGG - Intronic
983969683 4:173856607-173856629 TTTGATTTCCTTAAGGGGGTAGG - Intergenic
987301893 5:16604687-16604709 TAGGATTACCGTCAGGAGCGTGG + Intronic
988157792 5:27477139-27477161 TAGGATTAGGTTCAGGGGAAGGG + Intergenic
988194376 5:27983669-27983691 TAGCAGGGCCTTCAGGGGGTGGG + Intergenic
999621622 5:153480257-153480279 TTGGATGTCCTTCAAGGGGTGGG - Intergenic
1000605981 5:163327960-163327982 AAGGATTACCCTAAGGGAGTTGG - Intergenic
1000997375 5:167973335-167973357 TGGGATTACCAACAGGAGGTGGG - Intronic
1001358064 5:171051402-171051424 TAGTATTATCTTCAAGGGGCAGG - Intronic
1001588415 5:172849185-172849207 AAGCATTACTTTCTGGGGGTCGG - Intronic
1004083965 6:12425731-12425753 TAGGCTTACCCTAAGGTGGTGGG - Intergenic
1005340859 6:24842511-24842533 TAGGATCCCTCTCAGGGGGTCGG - Intronic
1005463609 6:26091317-26091339 CAGGATGACCTGCAGGGTGTGGG - Exonic
1027257469 7:76440260-76440282 TAGGGTGACCTTCAGGTGGCAGG - Exonic
1027281378 7:76611781-76611803 TAGGGTGACCTTCAGGTGGCAGG + Exonic
1027956288 7:84882654-84882676 TATTATTTCCTTCAGGGAGTGGG + Intergenic
1044631976 8:94289044-94289066 TTGGAGTACCTTAATGGGGTTGG - Intergenic
1058473092 9:105301112-105301134 CAGGGTTACATTCAGGGAGTGGG - Intronic
1187824900 X:23325079-23325101 TAGAATGAACTTCTGGGGGTGGG + Intergenic
1191871796 X:65752366-65752388 TAGGGCTACCTGGAGGGGGTTGG - Intergenic
1194915518 X:99702842-99702864 AAGGCTTTCCTTTAGGGGGTAGG - Intergenic
1195062440 X:101209512-101209534 TAGGACTACCTTGAGGGTCTTGG - Intergenic
1200164238 X:154025242-154025264 TAGGATTTCCTCCAGGGTCTGGG + Intronic
1201980116 Y:19898198-19898220 TAGGAATACCTTCACATGGTTGG + Intergenic