ID: 903596775

View in Genome Browser
Species Human (GRCh38)
Location 1:24501648-24501670
Sequence GCCTCTGAAAGGTCTTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903596771_903596775 10 Left 903596771 1:24501615-24501637 CCTTTGATGTTAAGCTTCACTGT 0: 1
1: 0
2: 0
3: 15
4: 157
Right 903596775 1:24501648-24501670 GCCTCTGAAAGGTCTTGAGTGGG 0: 1
1: 0
2: 3
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903596775 Original CRISPR GCCTCTGAAAGGTCTTGAGT GGG Intergenic
900093694 1:931656-931678 GCCACCGAAAGTTCTTGAGCAGG + Intronic
902255463 1:15186231-15186253 GCCACTGAAAGTTCTTGAGCAGG + Intronic
902754365 1:18539512-18539534 TCCACTGAAAAGTCTTGAGGAGG + Intergenic
903596775 1:24501648-24501670 GCCTCTGAAAGGTCTTGAGTGGG + Intergenic
904045933 1:27608261-27608283 GCCACTGAAGGGTTTTGAGCAGG - Intergenic
904054095 1:27659024-27659046 GCCTCTGAATGGTTTTGTGCAGG + Intergenic
905492454 1:38355149-38355171 GCCATTGAAAGTTCTTGAGCAGG + Intergenic
905943578 1:41883651-41883673 GCCTCTGACAGGCATTGAGGGGG - Intronic
906030753 1:42718237-42718259 GCCTCTGAAGGATTTTGAGCAGG - Intergenic
907560374 1:55382185-55382207 GCCACTGAAGGTTCTTGAGAGGG - Intergenic
907700110 1:56777919-56777941 GCCTCTGGAAAGTCTTAAGCAGG - Intronic
907936401 1:59046092-59046114 GCCACTGAAGGCTCTTGAGGAGG - Intergenic
908481298 1:64542485-64542507 TCCTCAGAAAGCTCTTGAGGTGG + Intronic
910124957 1:83830210-83830232 GCCTCTGAATGGCATGGAGTGGG - Intergenic
910392722 1:86761421-86761443 GCCTCTGTGTGGTCTTGGGTAGG - Intergenic
912585578 1:110761962-110761984 GTCATTGAAAGTTCTTGAGTTGG + Intergenic
913314012 1:117534898-117534920 AGCTCTTAAAGGCCTTGAGTGGG + Intergenic
916270153 1:162932282-162932304 GCCACTGAAAGGATTTAAGTGGG - Intergenic
917431813 1:174977291-174977313 GCCCCTGAAAATTTTTGAGTAGG - Intronic
918441987 1:184576793-184576815 GCCTCTGAAGGGTTTTAAGCAGG - Intronic
919523836 1:198622549-198622571 GGCACTGAAAGATCTTGAATGGG - Intergenic
920091857 1:203459666-203459688 CCCACTGAAAGGTTTTGGGTTGG + Intergenic
921716637 1:218423741-218423763 GCCTCTGAAAGTTTTTGACAAGG + Intronic
922188295 1:223295510-223295532 ACCTCTGCAAAGCCTTGAGTGGG + Intronic
922303940 1:224328025-224328047 TCCACTGAAAGGTTTTGAGCAGG + Intronic
1063314063 10:4984509-4984531 GCCAATCAGAGGTCTTGAGTCGG - Intronic
1064782736 10:18860074-18860096 GCCTCTGAAAAGCCTTCAGGGGG + Intergenic
1065849772 10:29778071-29778093 CCCTCTGAAGGCTCTAGAGTAGG - Intergenic
1066056633 10:31687668-31687690 GACTCTGAAAGGTCTACAGAAGG + Intergenic
1067668154 10:48296139-48296161 CCCTCTGAGGGGTCTTCAGTTGG - Intergenic
1070126283 10:73625151-73625173 TCCTCTGAAGCGTATTGAGTTGG - Intronic
1071829348 10:89356296-89356318 GGTTCTGAGAGGTTTTGAGTTGG - Intronic
1071954363 10:90741772-90741794 TGCTCTGAAGGGTCTTGAGAGGG - Exonic
1073417206 10:103394457-103394479 GCCTCTGAAAGCCTTTGAATGGG - Intronic
1074160651 10:110833972-110833994 ACCACTGAGAGGCCTTGAGTTGG + Intronic
1074313313 10:112341004-112341026 TCCTCTGGAAGGTCTGGGGTAGG + Intergenic
1074892909 10:117750140-117750162 GTCCCTGATAGGACTTGAGTTGG + Intergenic
1075743371 10:124709532-124709554 GCCTCTGAAATGTGTTGGCTGGG - Intronic
1077435201 11:2535609-2535631 GGCTCTGAAAGGCAGTGAGTGGG - Intronic
1077770270 11:5210556-5210578 GCCTCTGATAGGCCCTGAGCTGG - Intergenic
1078340422 11:10494820-10494842 GCCTCGTAAAGGTCTAGAGAGGG + Intronic
1078643407 11:13116458-13116480 GCCTCTGAAAAGTTTTAAGCAGG - Intergenic
1083932172 11:65852072-65852094 GTCTCTGAAGGGCCTTGAGCAGG - Intronic
1084851068 11:71941075-71941097 GCCACTGAAGAGTCTTGAGCAGG + Intronic
1087644814 11:100796409-100796431 GCCACTGTAAGGTTTTTAGTTGG - Intronic
1088141509 11:106622394-106622416 GCCACAGAAGGGTCTTAAGTGGG - Intergenic
1090937950 11:131361885-131361907 GCCTATAAAAGGTGTTGAATTGG - Intergenic
1092099557 12:5871910-5871932 GCCTGTGAAAGATTCTGAGTAGG - Intronic
1092976101 12:13746353-13746375 GCCTCAGAAAGGACGTGGGTTGG - Intronic
1093962366 12:25288294-25288316 TAGTCTGAAAGGTCATGAGTAGG - Intergenic
1096651210 12:53062768-53062790 GGCACTGAAAGGCCTTGAGGTGG + Intronic
1097968188 12:65603589-65603611 TCCTCTGAATGGTCTGGACTGGG + Intergenic
1100184287 12:92122177-92122199 GTCTCTGAGAGTTCTTGAATAGG + Intronic
1101519423 12:105467801-105467823 GGGTCAGAAAGGTCCTGAGTGGG - Intergenic
1102201400 12:111060117-111060139 GCCACTGAAAGCTTTTCAGTTGG - Intronic
1104899464 12:132180893-132180915 GGCCCTGAAAGGTCTCGTGTTGG + Intergenic
1105295885 13:19087709-19087731 GCCTCAGCAAGGTCTTGGGAAGG - Intergenic
1106233957 13:27845710-27845732 GCCACTGAAAGGTAGTGAGCAGG - Intergenic
1106345689 13:28874884-28874906 CCCTCTAAGAGGTCTTGATTTGG + Intronic
1108201070 13:48043716-48043738 GCCTCTGTAGGGATTTGAGTTGG + Intronic
1109022165 13:57111476-57111498 GCTTCTGATGGTTCTTGAGTAGG - Intergenic
1110248646 13:73356577-73356599 GCCACTGAAGGGTTTTAAGTGGG + Intergenic
1110671868 13:78190059-78190081 ACCACTGAAGGGTCTTAAGTAGG + Intergenic
1111209148 13:85053085-85053107 GGCTATGAAAGGCTTTGAGTGGG + Intergenic
1111490691 13:88970575-88970597 GCTTCTGAGAGGTCTTGTGGGGG + Intergenic
1114264849 14:21067953-21067975 GCCACTGAAAGTTTTTGAGCTGG - Intronic
1116935897 14:50739905-50739927 GCCTATGAAAGCTTTTGAGTTGG - Intronic
1118797279 14:69154024-69154046 TCCTCTTAAAGGTCTCGAGTGGG + Intergenic
1118865522 14:69700404-69700426 GCCGCTGAAGGTTCTTGAGAAGG - Intronic
1118993026 14:70812727-70812749 ATCACTGAAAGGTTTTGAGTAGG + Intergenic
1119578565 14:75752451-75752473 GCCACTGAAAGCTCTTAATTTGG + Intronic
1120190157 14:81433396-81433418 GCCACTGAAGAGTTTTGAGTTGG - Intronic
1120530874 14:85629968-85629990 GCTACTAAAAGGTCTTCAGTTGG + Exonic
1121625547 14:95383246-95383268 GCTTCTGAAAGCTCATGGGTGGG + Intergenic
1121765323 14:96480907-96480929 GCCTCTGCAATGTCTGGAATGGG + Intronic
1121787608 14:96674197-96674219 GCCTGAGGAAGTTCTTGAGTGGG - Intergenic
1124119363 15:26875816-26875838 GCCACTGAGTGGTTTTGAGTAGG + Intronic
1126805510 15:52344710-52344732 TCCTCTGAAAGGTGTTAAGTAGG - Intronic
1127138793 15:55952879-55952901 GCCTCTGAAAAGGTTTGACTGGG - Intronic
1129612558 15:77072068-77072090 GCCTGGGAAAGGTGATGAGTGGG - Intronic
1129624541 15:77182855-77182877 GCCACTGAAGGGTCTTGAATAGG + Intronic
1129705447 15:77791608-77791630 GCCACTGAAGGTTCTTGAGGGGG + Intronic
1130132227 15:81153693-81153715 GCCTGTGAAAGGCTTTGAGGAGG + Intergenic
1130938180 15:88487629-88487651 GCCTCTGAAAGGTTTTAACAGGG + Intergenic
1131026377 15:89145570-89145592 TCCCCTGAAAGGTTTTGAGCTGG - Intronic
1133415922 16:5606970-5606992 GCCACTGAAAGGTTTTAAGCTGG + Intergenic
1137100228 16:36371390-36371412 GCCTCTTAGAGGCCTTCAGTTGG + Intergenic
1137480139 16:48845609-48845631 GCCTCTGAAGGGTCTGGCGTGGG + Intergenic
1138050831 16:53775550-53775572 GCCTCAGAAAGCTTTTGAGAAGG - Intronic
1139043387 16:63028081-63028103 GCCACTGAAAGGTTTTAAGCAGG - Intergenic
1139965696 16:70744250-70744272 GCCTCTGGGCGGTCTTGAGGTGG + Intronic
1140278724 16:73534386-73534408 GAAACTGAAAGGTCTGGAGTTGG - Intergenic
1140747322 16:77992547-77992569 ACCTTTTAAAGGTCTTGAGTAGG - Intergenic
1140806183 16:78534395-78534417 GCCTCTCAATGGTTTTCAGTTGG - Intronic
1141098920 16:81182695-81182717 CCCTCTCAAAGGACTTGAGAAGG - Intergenic
1141466482 16:84209185-84209207 ACATGTGAAAGGTCTTGTGTTGG + Intergenic
1142165865 16:88587581-88587603 GCCTCTGAATGGTATGGAATTGG - Intronic
1144057415 17:11555319-11555341 GGCTCAGAAAAATCTTGAGTTGG - Intronic
1146676942 17:34780275-34780297 GCCGCCGAAAGTTCTTGAGCAGG + Intergenic
1146912711 17:36658560-36658582 GCCTCTAAGAGGTTTGGAGTGGG + Intergenic
1147449926 17:40497822-40497844 GGCTCTGAAAAGTTTTGAGCTGG + Intronic
1149232260 17:54548354-54548376 GGCTGGGAAAGGTATTGAGTCGG - Intergenic
1149463190 17:56850665-56850687 GCCTCTAAAAGATCTTGTATAGG + Intronic
1153341441 18:3978731-3978753 GCCTTCGAAAGTTCTAGAGTGGG - Intronic
1155173304 18:23282848-23282870 GCCCCTTAAGGGTCATGAGTAGG + Intronic
1156276907 18:35592586-35592608 GCTGTTGAAAGGTTTTGAGTAGG + Intronic
1157995193 18:52546479-52546501 ACCTCTGACAGTTCTTGACTGGG + Intronic
1158954566 18:62525402-62525424 GCTTTTGAAAGGTGTTGATTTGG + Intronic
1160352783 18:78199078-78199100 CCCTCTGAGAGGTCTTGGGGAGG + Intergenic
1160403517 18:78628899-78628921 GCCACTGAAGGTTCTGGAGTAGG + Intergenic
1162557009 19:11393363-11393385 CCCTAAGAAAGGTGTTGAGTCGG - Intronic
1166157428 19:40924422-40924444 CCCTCAGAAAGGATTTGAGTAGG - Intergenic
1166166297 19:40991455-40991477 CCCTCAGAAAGGATTTGAGTAGG - Exonic
927478326 2:23431148-23431170 ACCTCTGAAATGTCTGGAATGGG - Intronic
927757402 2:25719978-25720000 TCCCCTGAATGGTTTTGAGTCGG - Intergenic
929376377 2:41291107-41291129 GCTTTTGAATGGTCTTAAGTCGG - Intergenic
929831383 2:45349508-45349530 GCCACTGGAACTTCTTGAGTAGG + Intergenic
929852384 2:45604235-45604257 GCCACTGGAAGGTTTTGGGTTGG - Intronic
932368285 2:71166955-71166977 GGCTCTGCAAGGTTTGGAGTGGG - Intergenic
935956893 2:108385856-108385878 GCTTCTGAAATGCCTTGAGCAGG + Intronic
936824337 2:116562376-116562398 AAGTCTGAAAGGGCTTGAGTGGG - Intergenic
939817910 2:146919305-146919327 GCGCCTGAAAGGTATTGAGTTGG - Intergenic
939932951 2:148256200-148256222 GCCTCCCAAATGTCTTGCGTGGG + Intronic
941356348 2:164497399-164497421 GCAACTGAAAGGGCTTCAGTGGG + Exonic
941631835 2:167892623-167892645 GCCTCTAAAGGGTTTTGAGTAGG + Intergenic
941999086 2:171628170-171628192 GCCACTGAAACCTCTGGAGTTGG + Intergenic
942367530 2:175243488-175243510 GCCTTTGAAAGGTTTTAAGCAGG - Intergenic
944206913 2:197166208-197166230 GATTCTGAAAGCTTTTGAGTTGG + Intronic
946054179 2:216886569-216886591 GCCTCTGAGAGCTCATGCGTGGG + Intergenic
946277194 2:218640482-218640504 GATTCTGACAGGTCTTCAGTGGG + Intronic
947698547 2:232213399-232213421 GACTCTGAAACGGCCTGAGTTGG + Intronic
948638243 2:239354476-239354498 GCCTCTGAAAGCACTTGAGCTGG - Intronic
1170152301 20:13238300-13238322 GGCTCTGAAAGTTCTTGAGAAGG + Intronic
1170163321 20:13337709-13337731 ACCTTTGACAGTTCTTGAGTGGG + Intergenic
1170359031 20:15524262-15524284 GCCCCTGAAAGGGCTGGAGTTGG - Intronic
1170944577 20:20879678-20879700 GCCTCTGAAGGGTTTTGAGTAGG + Intergenic
1171113087 20:22501965-22501987 CCCTCTGAAGGCTGTTGAGTAGG + Intergenic
1171768306 20:29301849-29301871 GCCTCTGACAGGTTGTGTGTGGG - Intergenic
1171811012 20:29744093-29744115 GCCTCCGACAGGTTTTGTGTGGG - Intergenic
1173793684 20:45844048-45844070 TCCTCAGAAAGGCCTTGTGTCGG + Intronic
1174270621 20:49365719-49365741 GACTTTCAAAGGTCTTGAGTGGG + Exonic
1174283382 20:49455194-49455216 GCCACTGGAAGGCTTTGAGTGGG + Intronic
1175966152 20:62661170-62661192 GCCTCTGTAAGGACCGGAGTCGG + Exonic
1180579502 22:16818324-16818346 GACTCTGAAAGGTCTTGTCTAGG + Intronic
1180741903 22:18059313-18059335 GCCTCTGAGAGGTTTTAAATAGG + Intergenic
1182295620 22:29309960-29309982 GCCGGTGAAAGGTCATGTGTGGG + Intronic
1183814389 22:40287480-40287502 GCCTCTCCAAGGTCTTGCCTGGG + Intronic
1184254110 22:43277298-43277320 GCCATGGGAAGGTCTTGAGTGGG + Intronic
951599891 3:24362159-24362181 GCCACTGAAGGGTTTTGAGGAGG - Intronic
951766358 3:26204007-26204029 GTCTCTAAGAGGTCTGGAGTAGG + Intergenic
952500123 3:33953862-33953884 GCCTGTGAAAGGTGTTGAGTTGG - Intergenic
956064057 3:65378582-65378604 GCTTTCGAAAGGTCTTGAATAGG - Intronic
956205302 3:66749015-66749037 GCATCTGGAATGTCTTGGGTGGG - Intergenic
957290836 3:78276340-78276362 GTCACTGAAAGGTCTCAAGTAGG - Intergenic
958699916 3:97575687-97575709 GCCTTTGAAAGGTTTTAAGCAGG + Intronic
960942643 3:122944638-122944660 CCCTTTGAAAGGCCTTGATTGGG - Intronic
962066649 3:131988353-131988375 GCCTTTGAAAGGGCTTAAGCAGG + Intronic
962207226 3:133444929-133444951 GCCTTTGAAAGGGCTTGAGCAGG - Intronic
965529949 3:169761428-169761450 TCCTTTGTAAGGTCTGGAGTTGG - Intergenic
966347564 3:178996318-178996340 ATTTCTGTAAGGTCTTGAGTGGG + Intergenic
966747697 3:183294280-183294302 GCCTTTTAAAGGTCCTGAATGGG + Intronic
967112575 3:186307209-186307231 GCCCTTGAATGGTTTTGAGTAGG - Intronic
969975590 4:11098096-11098118 GCCAAAGAAAGGTATTGAGTGGG - Intergenic
970539113 4:17059728-17059750 GCCTCTGATAGTGCATGAGTTGG + Intergenic
970800212 4:19964631-19964653 GAGTCTGAAAAGTCTTGAGGTGG + Intergenic
970849269 4:20582088-20582110 CCCACTGAAAGGTTTTGAGTCGG - Intronic
972349855 4:38226430-38226452 GCCACTGGAAGGTTTTGAGCAGG - Intergenic
972452682 4:39218986-39219008 CCCACTGAAAGGTCTTCAGCGGG + Intronic
973656351 4:53052078-53052100 GCTTCTGAAAGGTTTTAAGAAGG - Intronic
974099772 4:57403754-57403776 GACACTGAAAGGTTTTGAGTAGG + Intergenic
975094433 4:70441634-70441656 GCTTCTGAAAGGCATTGAGAAGG + Intronic
975913991 4:79300748-79300770 TCCTCTAAAAGGTTTTGAATAGG + Intronic
977752914 4:100631412-100631434 GCCTCTGCAAGCACTTGAGCTGG + Intronic
978502012 4:109419796-109419818 GCCTCTGGAATTTCTTAAGTAGG - Intergenic
978612505 4:110559042-110559064 GCCGCTGAAAGGGCATGTGTGGG + Intronic
979442637 4:120769556-120769578 GCCACTGAAAGGTTTTAAGTAGG + Intronic
981051305 4:140312179-140312201 GCCTCTGGAAGGTCTTGACATGG + Intronic
986256309 5:6103802-6103824 GCATCTGAAAGGCCTGGTGTGGG - Intergenic
987886759 5:23823281-23823303 TCCTCTGCAGAGTCTTGAGTTGG - Intergenic
989051497 5:37324830-37324852 GGCTCTTAAAGTTCATGAGTTGG - Intronic
989411708 5:41126934-41126956 GACAATGAAAGGTCTTGAATTGG - Intergenic
990602683 5:57376918-57376940 GCCATTGAAAGTTGTTGAGTGGG - Intergenic
991053561 5:62298230-62298252 GCCTCTTATTGGTCTGGAGTGGG + Intergenic
991717786 5:69468056-69468078 GCGTCTGATAGGTCTTGGTTTGG + Intergenic
992491293 5:77247281-77247303 GCCTCTGAAAGGGCTGGCATTGG - Intronic
994515937 5:100773044-100773066 GCAGCTGAAAGGTTTTGATTTGG + Intergenic
996491653 5:124105220-124105242 GCCTTTGACAGGTTTTAAGTAGG + Intergenic
997418770 5:133749837-133749859 GCCTTAGAAATGACTTGAGTAGG + Intergenic
999225992 5:150025130-150025152 TCCTCTGAAGAATCTTGAGTTGG + Intronic
999737043 5:154520864-154520886 GCCTCTGAAAAATCCTGAGGTGG + Intergenic
1000909139 5:166999750-166999772 GATTTTGAGAGGTCTTGAGTAGG + Intergenic
1002421780 5:179152758-179152780 GGCTCTGGAAAGGCTTGAGTAGG - Intronic
1004228661 6:13811932-13811954 GCCTCTGAAAGGTCGACAGAAGG + Intronic
1005249123 6:23924330-23924352 GCCTCTAGAAGGTCTGAAGTAGG + Intergenic
1012290347 6:97447933-97447955 GCCTCTGTAAGGTTTTGAGTTGG - Intergenic
1016403545 6:143706097-143706119 GCCTTTGGAAACTCTTGAGTGGG + Intronic
1016699623 6:147039405-147039427 GCCTCTGAATGGTATTATGTAGG - Intergenic
1019278682 7:189072-189094 GCCTCTGTAAGGTCTGCAGGTGG - Intergenic
1019870370 7:3755261-3755283 TCCTCTGATTGGCCTTGAGTTGG + Intronic
1020351793 7:7227803-7227825 TCCTCTGAAGAGTCTTGAGGTGG - Intronic
1022067488 7:26874524-26874546 GCCTCTGACAAGTCTGGAATGGG - Intronic
1023467189 7:40469104-40469126 CCCTCTGAAACTTTTTGAGTTGG + Intronic
1026617539 7:71919239-71919261 GCCTTTAAAAGATTTTGAGTGGG - Intronic
1026729129 7:72895939-72895961 GCCACTGAAAGTTTTTGAGCAGG - Intronic
1027114877 7:75471175-75471197 GCCACTGAAAGTTTTTGAGCAGG + Intronic
1027147162 7:75703778-75703800 GCCACTGGAAGGTTTTTAGTAGG - Intronic
1031411359 7:121443097-121443119 TCCCCTGAAAGGCCTTGATTAGG + Intergenic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1037808737 8:22073307-22073329 ATCTCTAAAAGGTCTAGAGTTGG - Intronic
1038656700 8:29459328-29459350 GCTTCTGAAAGGCCTTTAGGCGG + Intergenic
1044001076 8:86882091-86882113 GCCTCTGAATGGTATTGCCTAGG - Intronic
1046591229 8:116209694-116209716 GTCTCTGTAAGTTCTTGACTAGG - Intergenic
1049229853 8:141476291-141476313 GCCTCTGCAGGGCCTTGAGCTGG + Intergenic
1049409553 8:142466405-142466427 GCCTCTGTGAGGCCGTGAGTGGG + Intronic
1050622184 9:7465783-7465805 CTCTCAGAAAGGTTTTGAGTTGG - Intergenic
1055108301 9:72535513-72535535 GCCACTGAAAGTTCTTGAGGAGG - Intronic
1057040703 9:91845478-91845500 GCTTCTGAAAGGTGCTGACTGGG - Intronic
1057263915 9:93601664-93601686 GCCTCAGCAAGGTCTTGGGAAGG + Intronic
1057754641 9:97822399-97822421 ACCTCTTAAAGGTCTTGCCTCGG + Intergenic
1058001612 9:99871611-99871633 GATTCTGATAGTTCTTGAGTTGG - Intergenic
1059087664 9:111321602-111321624 GCCATTGAAATGGCTTGAGTGGG - Intergenic
1186132533 X:6483750-6483772 GCCTCTGAAGGGGGTTGAGATGG + Intergenic
1188334888 X:28918913-28918935 GCCACTGAAAGGTTTTTAGCAGG + Intronic
1188533237 X:31165312-31165334 ACATATGAAAGGTCCTGAGTAGG + Intronic
1189698235 X:43688055-43688077 GCCGTTGGAAGGTCTTGAGCAGG - Intronic
1189718222 X:43886329-43886351 TCCTGTGAAAGGCCTTGACTTGG - Intergenic
1190292327 X:49001138-49001160 GCCTCTACAAGGCCTTGGGTAGG + Intronic
1190762452 X:53447884-53447906 GACTGAGGAAGGTCTTGAGTGGG - Intergenic
1193655219 X:84189257-84189279 ACCTCTCCAAGGTCCTGAGTTGG - Intergenic
1195271121 X:103232056-103232078 GCCTCTCAAATGTCTTTTGTAGG + Intergenic
1196649031 X:118149996-118150018 GCCTCTGAAAGTTTTGGGGTTGG - Intergenic
1201612657 Y:15860671-15860693 GCCTCTGTAAGGTCCCTAGTAGG - Intergenic
1202025670 Y:20520141-20520163 TCCTGTGTCAGGTCTTGAGTTGG + Intergenic