ID: 903597019

View in Genome Browser
Species Human (GRCh38)
Location 1:24502809-24502831
Sequence GGGCGCGCGCACGGCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 1, 2: 8, 3: 48, 4: 425}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903597019_903597031 4 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597031 1:24502836-24502858 AGAACAGGAGGGGACGAGGCGGG 0: 1
1: 0
2: 5
3: 47
4: 568
903597019_903597032 11 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597032 1:24502843-24502865 GAGGGGACGAGGCGGGCGCGCGG 0: 1
1: 1
2: 0
3: 59
4: 640
903597019_903597028 0 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597028 1:24502832-24502854 TGCCAGAACAGGAGGGGACGAGG 0: 1
1: 0
2: 3
3: 18
4: 247
903597019_903597023 -8 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597019_903597033 17 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597033 1:24502849-24502871 ACGAGGCGGGCGCGCGGCGCCGG 0: 1
1: 0
2: 3
3: 34
4: 304
903597019_903597030 3 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597030 1:24502835-24502857 CAGAACAGGAGGGGACGAGGCGG 0: 1
1: 0
2: 5
3: 54
4: 490
903597019_903597025 -6 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173
903597019_903597024 -7 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597024 1:24502825-24502847 CGCGCCCTGCCAGAACAGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903597019 Original CRISPR GGGCGCGCGCACGGCGGCGC AGG (reversed) Intronic