ID: 903597023

View in Genome Browser
Species Human (GRCh38)
Location 1:24502824-24502846
Sequence GCGCGCCCTGCCAGAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 77}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903597011_903597023 23 Left 903597011 1:24502778-24502800 CCGGGTCCCCGCCTTGTCCTGGG 0: 1
1: 0
2: 0
3: 34
4: 299
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597019_903597023 -8 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597007_903597023 28 Left 903597007 1:24502773-24502795 CCCGCCCGGGTCCCCGCCTTGTC 0: 1
1: 1
2: 2
3: 24
4: 223
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597017_903597023 12 Left 903597017 1:24502789-24502811 CCTTGTCCTGGGCTCTGGCGCCT 0: 1
1: 0
2: 0
3: 40
4: 339
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597018_903597023 6 Left 903597018 1:24502795-24502817 CCTGGGCTCTGGCGCCTGCGCCG 0: 1
1: 0
2: 1
3: 34
4: 337
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597013_903597023 17 Left 903597013 1:24502784-24502806 CCCCGCCTTGTCCTGGGCTCTGG 0: 1
1: 1
2: 3
3: 51
4: 491
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597008_903597023 27 Left 903597008 1:24502774-24502796 CCGCCCGGGTCCCCGCCTTGTCC 0: 1
1: 0
2: 1
3: 38
4: 366
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597006_903597023 29 Left 903597006 1:24502772-24502794 CCCCGCCCGGGTCCCCGCCTTGT 0: 1
1: 0
2: 1
3: 8
4: 175
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597015_903597023 16 Left 903597015 1:24502785-24502807 CCCGCCTTGTCCTGGGCTCTGGC 0: 1
1: 0
2: 4
3: 59
4: 524
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597016_903597023 15 Left 903597016 1:24502786-24502808 CCGCCTTGTCCTGGGCTCTGGCG 0: 1
1: 0
2: 3
3: 58
4: 757
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77
903597009_903597023 24 Left 903597009 1:24502777-24502799 CCCGGGTCCCCGCCTTGTCCTGG 0: 1
1: 0
2: 6
3: 24
4: 306
Right 903597023 1:24502824-24502846 GCGCGCCCTGCCAGAACAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903597023 Original CRISPR GCGCGCCCTGCCAGAACAGG AGG Intronic