ID: 903597025

View in Genome Browser
Species Human (GRCh38)
Location 1:24502826-24502848
Sequence GCGCCCTGCCAGAACAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 173}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903597019_903597025 -6 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173
903597016_903597025 17 Left 903597016 1:24502786-24502808 CCGCCTTGTCCTGGGCTCTGGCG 0: 1
1: 0
2: 3
3: 58
4: 757
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173
903597013_903597025 19 Left 903597013 1:24502784-24502806 CCCCGCCTTGTCCTGGGCTCTGG 0: 1
1: 1
2: 3
3: 51
4: 491
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173
903597011_903597025 25 Left 903597011 1:24502778-24502800 CCGGGTCCCCGCCTTGTCCTGGG 0: 1
1: 0
2: 0
3: 34
4: 299
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173
903597015_903597025 18 Left 903597015 1:24502785-24502807 CCCGCCTTGTCCTGGGCTCTGGC 0: 1
1: 0
2: 4
3: 59
4: 524
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173
903597017_903597025 14 Left 903597017 1:24502789-24502811 CCTTGTCCTGGGCTCTGGCGCCT 0: 1
1: 0
2: 0
3: 40
4: 339
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173
903597009_903597025 26 Left 903597009 1:24502777-24502799 CCCGGGTCCCCGCCTTGTCCTGG 0: 1
1: 0
2: 6
3: 24
4: 306
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173
903597007_903597025 30 Left 903597007 1:24502773-24502795 CCCGCCCGGGTCCCCGCCTTGTC 0: 1
1: 1
2: 2
3: 24
4: 223
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173
903597008_903597025 29 Left 903597008 1:24502774-24502796 CCGCCCGGGTCCCCGCCTTGTCC 0: 1
1: 0
2: 1
3: 38
4: 366
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173
903597018_903597025 8 Left 903597018 1:24502795-24502817 CCTGGGCTCTGGCGCCTGCGCCG 0: 1
1: 0
2: 1
3: 34
4: 337
Right 903597025 1:24502826-24502848 GCGCCCTGCCAGAACAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903597025 Original CRISPR GCGCCCTGCCAGAACAGGAG GGG Intronic