ID: 903597031

View in Genome Browser
Species Human (GRCh38)
Location 1:24502836-24502858
Sequence AGAACAGGAGGGGACGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 568}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903597016_903597031 27 Left 903597016 1:24502786-24502808 CCGCCTTGTCCTGGGCTCTGGCG 0: 1
1: 0
2: 3
3: 58
4: 757
Right 903597031 1:24502836-24502858 AGAACAGGAGGGGACGAGGCGGG 0: 1
1: 0
2: 5
3: 47
4: 568
903597020_903597031 -2 Left 903597020 1:24502815-24502837 CCGCCGTGCGCGCGCCCTGCCAG 0: 1
1: 0
2: 2
3: 17
4: 146
Right 903597031 1:24502836-24502858 AGAACAGGAGGGGACGAGGCGGG 0: 1
1: 0
2: 5
3: 47
4: 568
903597019_903597031 4 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597031 1:24502836-24502858 AGAACAGGAGGGGACGAGGCGGG 0: 1
1: 0
2: 5
3: 47
4: 568
903597015_903597031 28 Left 903597015 1:24502785-24502807 CCCGCCTTGTCCTGGGCTCTGGC 0: 1
1: 0
2: 4
3: 59
4: 524
Right 903597031 1:24502836-24502858 AGAACAGGAGGGGACGAGGCGGG 0: 1
1: 0
2: 5
3: 47
4: 568
903597021_903597031 -5 Left 903597021 1:24502818-24502840 CCGTGCGCGCGCCCTGCCAGAAC 0: 1
1: 0
2: 1
3: 9
4: 71
Right 903597031 1:24502836-24502858 AGAACAGGAGGGGACGAGGCGGG 0: 1
1: 0
2: 5
3: 47
4: 568
903597017_903597031 24 Left 903597017 1:24502789-24502811 CCTTGTCCTGGGCTCTGGCGCCT 0: 1
1: 0
2: 0
3: 40
4: 339
Right 903597031 1:24502836-24502858 AGAACAGGAGGGGACGAGGCGGG 0: 1
1: 0
2: 5
3: 47
4: 568
903597013_903597031 29 Left 903597013 1:24502784-24502806 CCCCGCCTTGTCCTGGGCTCTGG 0: 1
1: 1
2: 3
3: 51
4: 491
Right 903597031 1:24502836-24502858 AGAACAGGAGGGGACGAGGCGGG 0: 1
1: 0
2: 5
3: 47
4: 568
903597018_903597031 18 Left 903597018 1:24502795-24502817 CCTGGGCTCTGGCGCCTGCGCCG 0: 1
1: 0
2: 1
3: 34
4: 337
Right 903597031 1:24502836-24502858 AGAACAGGAGGGGACGAGGCGGG 0: 1
1: 0
2: 5
3: 47
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903597031 Original CRISPR AGAACAGGAGGGGACGAGGC GGG Intronic