ID: 903597032

View in Genome Browser
Species Human (GRCh38)
Location 1:24502843-24502865
Sequence GAGGGGACGAGGCGGGCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 1, 2: 0, 3: 59, 4: 640}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903597027_903597032 -10 Left 903597027 1:24502830-24502852 CCTGCCAGAACAGGAGGGGACGA 0: 1
1: 0
2: 0
3: 13
4: 130
Right 903597032 1:24502843-24502865 GAGGGGACGAGGCGGGCGCGCGG 0: 1
1: 1
2: 0
3: 59
4: 640
903597020_903597032 5 Left 903597020 1:24502815-24502837 CCGCCGTGCGCGCGCCCTGCCAG 0: 1
1: 0
2: 2
3: 17
4: 146
Right 903597032 1:24502843-24502865 GAGGGGACGAGGCGGGCGCGCGG 0: 1
1: 1
2: 0
3: 59
4: 640
903597026_903597032 -9 Left 903597026 1:24502829-24502851 CCCTGCCAGAACAGGAGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 169
Right 903597032 1:24502843-24502865 GAGGGGACGAGGCGGGCGCGCGG 0: 1
1: 1
2: 0
3: 59
4: 640
903597021_903597032 2 Left 903597021 1:24502818-24502840 CCGTGCGCGCGCCCTGCCAGAAC 0: 1
1: 0
2: 1
3: 9
4: 71
Right 903597032 1:24502843-24502865 GAGGGGACGAGGCGGGCGCGCGG 0: 1
1: 1
2: 0
3: 59
4: 640
903597018_903597032 25 Left 903597018 1:24502795-24502817 CCTGGGCTCTGGCGCCTGCGCCG 0: 1
1: 0
2: 1
3: 34
4: 337
Right 903597032 1:24502843-24502865 GAGGGGACGAGGCGGGCGCGCGG 0: 1
1: 1
2: 0
3: 59
4: 640
903597019_903597032 11 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597032 1:24502843-24502865 GAGGGGACGAGGCGGGCGCGCGG 0: 1
1: 1
2: 0
3: 59
4: 640

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903597032 Original CRISPR GAGGGGACGAGGCGGGCGCG CGG Intronic