ID: 903597033

View in Genome Browser
Species Human (GRCh38)
Location 1:24502849-24502871
Sequence ACGAGGCGGGCGCGCGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 304}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903597027_903597033 -4 Left 903597027 1:24502830-24502852 CCTGCCAGAACAGGAGGGGACGA 0: 1
1: 0
2: 0
3: 13
4: 130
Right 903597033 1:24502849-24502871 ACGAGGCGGGCGCGCGGCGCCGG 0: 1
1: 0
2: 3
3: 34
4: 304
903597021_903597033 8 Left 903597021 1:24502818-24502840 CCGTGCGCGCGCCCTGCCAGAAC 0: 1
1: 0
2: 1
3: 9
4: 71
Right 903597033 1:24502849-24502871 ACGAGGCGGGCGCGCGGCGCCGG 0: 1
1: 0
2: 3
3: 34
4: 304
903597026_903597033 -3 Left 903597026 1:24502829-24502851 CCCTGCCAGAACAGGAGGGGACG 0: 1
1: 0
2: 0
3: 3
4: 169
Right 903597033 1:24502849-24502871 ACGAGGCGGGCGCGCGGCGCCGG 0: 1
1: 0
2: 3
3: 34
4: 304
903597029_903597033 -8 Left 903597029 1:24502834-24502856 CCAGAACAGGAGGGGACGAGGCG 0: 1
1: 0
2: 3
3: 9
4: 104
Right 903597033 1:24502849-24502871 ACGAGGCGGGCGCGCGGCGCCGG 0: 1
1: 0
2: 3
3: 34
4: 304
903597019_903597033 17 Left 903597019 1:24502809-24502831 CCTGCGCCGCCGTGCGCGCGCCC 0: 1
1: 1
2: 8
3: 48
4: 425
Right 903597033 1:24502849-24502871 ACGAGGCGGGCGCGCGGCGCCGG 0: 1
1: 0
2: 3
3: 34
4: 304
903597020_903597033 11 Left 903597020 1:24502815-24502837 CCGCCGTGCGCGCGCCCTGCCAG 0: 1
1: 0
2: 2
3: 17
4: 146
Right 903597033 1:24502849-24502871 ACGAGGCGGGCGCGCGGCGCCGG 0: 1
1: 0
2: 3
3: 34
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903597033 Original CRISPR ACGAGGCGGGCGCGCGGCGC CGG Intronic