ID: 903605611

View in Genome Browser
Species Human (GRCh38)
Location 1:24573071-24573093
Sequence GGGCCTGGCTTTCCTAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903605611_903605615 6 Left 903605611 1:24573071-24573093 CCAGGTCTAGGAAAGCCAGGCCC 0: 1
1: 0
2: 1
3: 10
4: 169
Right 903605615 1:24573100-24573122 CACACCTCCACGCCTGTCTATGG 0: 1
1: 0
2: 3
3: 17
4: 137
903605611_903605617 8 Left 903605611 1:24573071-24573093 CCAGGTCTAGGAAAGCCAGGCCC 0: 1
1: 0
2: 1
3: 10
4: 169
Right 903605617 1:24573102-24573124 CACCTCCACGCCTGTCTATGGGG 0: 1
1: 0
2: 0
3: 10
4: 127
903605611_903605616 7 Left 903605611 1:24573071-24573093 CCAGGTCTAGGAAAGCCAGGCCC 0: 1
1: 0
2: 1
3: 10
4: 169
Right 903605616 1:24573101-24573123 ACACCTCCACGCCTGTCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 88
903605611_903605622 18 Left 903605611 1:24573071-24573093 CCAGGTCTAGGAAAGCCAGGCCC 0: 1
1: 0
2: 1
3: 10
4: 169
Right 903605622 1:24573112-24573134 CCTGTCTATGGGGCAGACCTGGG 0: 1
1: 0
2: 2
3: 23
4: 169
903605611_903605620 17 Left 903605611 1:24573071-24573093 CCAGGTCTAGGAAAGCCAGGCCC 0: 1
1: 0
2: 1
3: 10
4: 169
Right 903605620 1:24573111-24573133 GCCTGTCTATGGGGCAGACCTGG 0: 1
1: 0
2: 0
3: 18
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903605611 Original CRISPR GGGCCTGGCTTTCCTAGACC TGG (reversed) Intronic
900116832 1:1032707-1032729 GGTCCTTGCTTTCCTGGAGCTGG + Intronic
901044868 1:6389989-6390011 GGGCTTGGCTGTGCTAGGCCAGG + Intronic
901664502 1:10818766-10818788 GGGCAGGGCTTGCCCAGACCTGG + Intergenic
902282464 1:15384440-15384462 GGGCCTGGCCTGCCAAGCCCTGG - Intronic
902643033 1:17778949-17778971 GGGCCTGGCTTCTCATGACCCGG - Intronic
903605611 1:24573071-24573093 GGGCCTGGCTTTCCTAGACCTGG - Intronic
904034407 1:27551164-27551186 GGGCCTGGCTCTCCAGGCCCTGG - Exonic
907730409 1:57060488-57060510 GTACCTGGCTTTCATATACCAGG + Intronic
911199512 1:95030746-95030768 GGAGATAGCTTTCCTAGACCTGG + Intronic
915302426 1:154959236-154959258 GACCCTGGCTTTCCTGGCCCTGG - Exonic
916560956 1:165933847-165933869 AGGGCGGCCTTTCCTAGACCTGG - Intergenic
918276163 1:182955485-182955507 GGGCCTAGCTTTCCTTGTCCTGG - Intergenic
918545649 1:185680727-185680749 GGCCCTGGCTTTACTTTACCTGG + Intergenic
919811553 1:201412001-201412023 GGGTCTGACTGTCCTAGAGCAGG - Intronic
919892900 1:201988963-201988985 GGGCCAGGCTGTCCTAAACCGGG + Exonic
920552673 1:206877056-206877078 GGGCCTGTCTTTCCTACAGATGG + Intergenic
1063834247 10:9994573-9994595 GGGACTGGCTTCCTTGGACCTGG - Intergenic
1066393603 10:34998320-34998342 GGGCCTGGCTTGCCCATTCCGGG + Intergenic
1066654695 10:37686966-37686988 GGGCCTGGGTCTCCTAGTGCAGG - Intergenic
1072281763 10:93871941-93871963 GTGCTTGGCTTTGCTATACCAGG + Intergenic
1074770550 10:116730890-116730912 CCTCCTGGCTTTCCCAGACCAGG + Intronic
1076304256 10:129452752-129452774 CTGCCTGGCTGTCCTTGACCTGG + Intergenic
1076306289 10:129467484-129467506 GGGCCTGGGGTTCCTGGACTAGG + Intronic
1076540119 10:131208351-131208373 GAGCCTGGCTTTCCTTAACATGG + Intronic
1077141156 11:1025516-1025538 GGGCCTGGCATGCCTGGAACAGG + Intronic
1077284585 11:1759987-1760009 AGGCCGGGCTTTCCTGCACCCGG - Intronic
1081348682 11:42022039-42022061 GGGCCTGGCTGACATAGCCCTGG - Intergenic
1082767812 11:57182538-57182560 GGGCCTGGCCTTCCTCAGCCTGG + Exonic
1083190366 11:61047577-61047599 AGGACTGGCTTTTCTAAACCTGG - Intergenic
1083692763 11:64420402-64420424 TGGCCTTCCTTTCCAAGACCTGG - Intergenic
1083804630 11:65066574-65066596 GGGCCTGGCTTTCCTCCTGCAGG + Intronic
1083822311 11:65180348-65180370 GGGTCTTGCTTTCATTGACCAGG - Exonic
1084970847 11:72771315-72771337 GGGGCTGGCTTGCCTAGAGCTGG + Intronic
1089422836 11:118344438-118344460 GGGCCTGGCTGTCCTCATCCTGG + Exonic
1089517074 11:119039904-119039926 GTACCTGGCTTTCCTAGGCAGGG + Intergenic
1090237559 11:125160599-125160621 GGGCCTGGCGATCCCAGAGCTGG + Intergenic
1091903572 12:4164902-4164924 GGGCCAGGCTTTGCTTGGCCGGG - Intergenic
1092278013 12:7076840-7076862 GGGCCTTGGTTTCCTGGATCTGG + Intergenic
1105029808 12:132874577-132874599 GGGCCTGGCTTTCCCACGCTGGG - Intronic
1109561735 13:64058457-64058479 GGGACTGCCTGGCCTAGACCAGG - Intergenic
1110911204 13:80966331-80966353 GGGCCAAGCTTTCCCACACCTGG + Intergenic
1113636420 13:111921872-111921894 GGTCCTGGCTTCCCTAGACCTGG + Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1117974112 14:61281000-61281022 GGGCCTGGCCTTCATCGGCCTGG - Exonic
1117984909 14:61377705-61377727 GGGCCTGGGTATCCTAGATCAGG - Intronic
1118164369 14:63321573-63321595 GGGACTGCCTTCCCTGGACCAGG - Intergenic
1118609086 14:67526111-67526133 GGTTCTGGATTTCCTAGTCCAGG - Intronic
1118784751 14:69037019-69037041 GGGGCTGGCTAACCTAGATCAGG + Intergenic
1121960433 14:98254534-98254556 GGGCCTGGCTTCCGGTGACCTGG - Intergenic
1123078051 14:105679365-105679387 GGGCCTTCCTTTCCTTGTCCCGG + Intergenic
1124661502 15:31554095-31554117 GGGCCTGGCTTTCCTGGCAGAGG - Intronic
1125893318 15:43281937-43281959 GGGCCAGGATTTCCTGGGCCTGG + Exonic
1128532991 15:68467745-68467767 AGGCTTGGCTTTCCTAGATCTGG - Intergenic
1128729226 15:70009516-70009538 GAGGCTGGCTGGCCTAGACCAGG + Intergenic
1129377858 15:75145439-75145461 GGGCCTGGCATTCCTGGGCGTGG - Intergenic
1136270212 16:29144088-29144110 GGGCCTGGCTGGCCTGGCCCAGG + Intergenic
1137725721 16:50655366-50655388 GGGGCTGGTTTTCCAAGAACTGG - Intergenic
1138690901 16:58767633-58767655 GGGCTGGGCTCTGCTAGACCAGG + Intergenic
1139532558 16:67549635-67549657 AGGCCTGGCTTTTCTGGGCCTGG + Intergenic
1141301548 16:82820783-82820805 TGTCCTGGATTTCCTAGATCTGG + Intronic
1141891522 16:86929636-86929658 GGGTCTGGCTGCCCTAGCCCGGG + Intergenic
1142073803 16:88105922-88105944 GGGCCTGGCTGGCCTGGCCCAGG + Intronic
1142993441 17:3747080-3747102 GGGCATGGCTTTCACAGCCCAGG - Intronic
1144676571 17:17165995-17166017 GGGCCTGACTATTCTTGACCTGG - Intronic
1147473198 17:40684153-40684175 GGTCATTGCTTTCCTAGAGCTGG + Intergenic
1149833450 17:59891753-59891775 GAGCCTGGCTGTTCCAGACCTGG + Intronic
1151850658 17:76687881-76687903 GGGCTTGGCTTTCCCATCCCGGG - Intronic
1152371333 17:79890544-79890566 GGGCCAGACTTCCTTAGACCTGG + Intergenic
1152794911 17:82302023-82302045 GCGCCTGCCTTTCCCACACCTGG - Intergenic
1152942742 17:83181520-83181542 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942757 17:83181558-83181580 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942773 17:83181596-83181618 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942789 17:83181634-83181656 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942805 17:83181672-83181694 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942821 17:83181710-83181732 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942837 17:83181748-83181770 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942853 17:83181786-83181808 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942869 17:83181824-83181846 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942885 17:83181862-83181884 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942901 17:83181900-83181922 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942917 17:83181938-83181960 GGGCCTGGCTTTCCACGCCTGGG + Intergenic
1152942934 17:83181977-83181999 GGGCCTGGCTTTCCACACCCGGG + Intergenic
1153119122 18:1700170-1700192 GGGCCTCCCTTTCCTAGCCAAGG + Intergenic
1157384108 18:47247644-47247666 GCGCCAGGCCTTCCTGGACCTGG - Intronic
1158295599 18:55993761-55993783 GGGCCTGGCATTGCTAGTCTAGG + Intergenic
1159983886 18:74819596-74819618 GGGCATGGCATTCCTAGGACGGG + Intronic
1161723690 19:5916815-5916837 GGCCCTGTCTGTCCTAGGCCTGG - Exonic
1162096828 19:8315159-8315181 ATGCCTGGCTTTCCTAGGCAGGG - Intronic
1162746963 19:12804201-12804223 GGGCCCGGTTTTCATGGACCCGG + Intronic
1162789260 19:13054623-13054645 TGGCCTGCCTGTCCTAGGCCTGG + Intronic
1163015246 19:14450739-14450761 GGGCCTGGTTTTCCCAGAGGTGG + Intronic
1168214124 19:54912733-54912755 GGGCCTGGCCTTTCTAGTCCTGG + Exonic
925434509 2:3825325-3825347 GAGCCTGGCTTCCCTAGGGCAGG - Intronic
925584766 2:5453565-5453587 GTTCCTGCCTTTCCTAGACCTGG + Intergenic
925923714 2:8655548-8655570 GGGTCTGAATTTCCTAGACATGG + Intergenic
927842412 2:26454083-26454105 GGGCAAGGCTCTCCAAGACCTGG - Intronic
929639560 2:43563730-43563752 GTTTCTGCCTTTCCTAGACCAGG - Intronic
937262296 2:120594331-120594353 TAGCTTGGCTATCCTAGACCTGG + Intergenic
937291245 2:120783370-120783392 TGGCCTGGCTTTGTGAGACCAGG - Intronic
937703220 2:124887784-124887806 GGGCCTGGCTCTGCAAGACCAGG - Intronic
940445648 2:153773116-153773138 TGGCCTGGTATTCCTTGACCAGG + Intergenic
944814399 2:203360778-203360800 GGACATGGCTTTCCAAGATCAGG + Intronic
947060000 2:226153605-226153627 GGGCCTGGGTTTCTCAGCCCTGG - Intergenic
947926318 2:233925525-233925547 GGACCTGGCTTTCCTAGCTGGGG - Intronic
948191436 2:236062269-236062291 AGGCCTGAGTTTCCTAGCCCAGG - Intronic
948625161 2:239264088-239264110 GGGGCTGACTTTCCCAGGCCAGG + Intronic
1172101129 20:32484267-32484289 GTGCCTGGCTTTCCCAGCCCGGG - Intronic
1174069590 20:47890136-47890158 GGTCCTGTTTTTCCTGGACCAGG - Intergenic
1174452047 20:50626391-50626413 AGGGCTGTCTTTCCTAGACTAGG + Intronic
1175215735 20:57391103-57391125 GGGCCTGGCCTCCCTAGTTCAGG + Intergenic
1175259229 20:57664232-57664254 GGGCGTGGCTGTCCCAGGCCAGG - Intronic
1178953794 21:37006295-37006317 GGGCCTCGCTTTCCTCTCCCGGG + Intronic
1179791709 21:43759688-43759710 GGACCTGGCTTTCTGAGTCCAGG + Exonic
1180696270 22:17753471-17753493 GGGAGTGGCATTCCTAGGCCTGG + Intronic
1180899265 22:19358994-19359016 GTGCCTGGCTCACCTTGACCTGG - Intronic
1182520390 22:30881565-30881587 GGGCCTGGCTGACCCAGCCCAGG - Intronic
1183806943 22:40219667-40219689 GGGTCTGTCTTTCCTCTACCTGG + Intronic
949930684 3:9075990-9076012 GGGCCTTGCTTTTCTAACCCAGG + Intronic
950365987 3:12484526-12484548 GGGCCGCGCTTTCCTCGCCCAGG - Exonic
951801502 3:26601706-26601728 AGGCCTGGCTTCCCTAGAAGTGG - Intergenic
954423301 3:50430188-50430210 TGGCCTTGCTGTCCTAGCCCTGG + Intronic
955379080 3:58422304-58422326 GGGTCTGGCCTTCCTTGCCCTGG + Intronic
958698403 3:97556048-97556070 GGCCCTAGTTTTCCTATACCTGG - Intronic
958892161 3:99794838-99794860 TGGCCTGGCTTTCCAATTCCGGG - Exonic
960644445 3:119863370-119863392 GGGTGTAGCTTTCCTAGAACTGG + Intronic
961557532 3:127706894-127706916 CGGCCGAGCTTTCCAAGACCCGG + Intronic
962987402 3:140548026-140548048 GGGCCTGCCTCTCCTGGACAGGG + Intronic
965500726 3:169453395-169453417 GGGCCTTGCTGTCCTAAAACTGG + Intronic
969446075 4:7245283-7245305 CGGCTTGGCTTACCTGGACCTGG + Intronic
972274702 4:37546315-37546337 GGGCCTGCCTGGCCTAAACCTGG + Intronic
976748386 4:88429128-88429150 GGGACTGGCTGACCTAGGCCTGG + Intronic
983549952 4:169007892-169007914 AGGCCTGGCTTTCATAGAGTTGG + Intronic
984862064 4:184250295-184250317 GGGCATTGCTTACCTAGACAAGG - Intergenic
985644526 5:1078766-1078788 GGACCTGCCTTTCCTTGACGAGG - Intronic
985784359 5:1886340-1886362 GGGCCTTTCTTTCTGAGACCTGG + Intronic
986980296 5:13439819-13439841 GGATCTGGATTTCCTGGACCTGG + Intergenic
988367660 5:30321961-30321983 GGGCCAAGATTCCCTAGACCAGG + Intergenic
988544758 5:32145028-32145050 GGGCCAGGCCTTCCTAATCCTGG - Intronic
994017540 5:94985647-94985669 GGGCCTGGCTTTTATACACCAGG + Intronic
994267829 5:97738871-97738893 GGGCCTGCCTTCCCTTGATCTGG - Intergenic
994369642 5:98953657-98953679 GGGTCTGCCTTTCCCAGCCCCGG + Intergenic
999150825 5:149424761-149424783 GAGCCTCGCTGTCCTTGACCTGG - Intergenic
1000960643 5:167596977-167596999 GAGCCTGGCTTTTCTAAATCCGG + Intronic
1001104684 5:168843120-168843142 GGTCCTGTCTTTTCTGGACCGGG + Intronic
1001250148 5:170140856-170140878 GGGCCTGGCACTCCTGGGCCTGG + Intergenic
1001575175 5:172758521-172758543 GGTCCTGGCTATTCAAGACCGGG - Intergenic
1002449623 5:179311218-179311240 GGGCCTGGCGCTCCTGGCCCAGG + Intronic
1007429992 6:41771089-41771111 GGGCTTGGCTTTCCCACACAGGG + Exonic
1007430847 6:41775992-41776014 GGGCTTGACTTTCCTAGGTCAGG - Intronic
1015649522 6:135440228-135440250 GGGCCTGCCTTTATTTGACCTGG + Intronic
1016634630 6:146273326-146273348 GGGCATGTCTTTCCCAGAGCAGG - Intronic
1018089292 6:160331831-160331853 GGGCCCCTCTTTCCTAGTCCCGG + Intergenic
1019406479 7:886792-886814 GGGCCTGGCTCACTGAGACCGGG - Intronic
1019714133 7:2530564-2530586 GGGCCTGGCTGGGCTAGACTGGG - Intergenic
1019926575 7:4196928-4196950 GGGCCTGACTTTCCTAGCTATGG - Intronic
1021468839 7:20978578-20978600 GGGCATGGCTGTGCTAGCCCAGG - Intergenic
1023958894 7:44910595-44910617 GGGCCTAGCCTCCCAAGACCAGG - Intergenic
1024585204 7:50836052-50836074 GGGCCAGGCTATCCTCGACTGGG + Intergenic
1032387513 7:131534606-131534628 GGGCCTGGCTTTCCTCCTCAGGG + Intronic
1035477053 7:159151283-159151305 CCTCCTGGCTTTCCTAGAACCGG - Intergenic
1037689206 8:21168687-21168709 GGGCCCAGCTTCCCTAGGCCCGG + Intergenic
1039722483 8:40179631-40179653 GGGCCTGTGTTCTCTAGACCTGG + Intergenic
1041016169 8:53594761-53594783 GGGCGTGGCTTCCCGACACCAGG - Intergenic
1041808935 8:61886754-61886776 GGCCCTGGATCTCCTAGAGCAGG + Intergenic
1052894421 9:33734101-33734123 GTGCCTCCATTTCCTAGACCTGG + Intergenic
1052965884 9:34340384-34340406 GGGCAGGGCCTTCTTAGACCAGG + Intronic
1057040664 9:91845248-91845270 GGGCCTGGCTTCCCCAGGACAGG - Intronic
1057272697 9:93659697-93659719 GGCACTGGCCTTCCCAGACCTGG - Intronic
1058963353 9:110013067-110013089 GGGCTTGGCTGATCTAGACCTGG + Intronic
1060661071 9:125405565-125405587 GGGCCTGGGTGTCCTGGGCCAGG + Intergenic
1060714518 9:125910984-125911006 GGGTCTGCCTTTCCTGGACTTGG + Intronic
1060942687 9:127552097-127552119 GGGCCTGTCTTCCCCAGACAGGG + Intronic
1061149945 9:128822906-128822928 GTGCCTGGCTGCCCGAGACCTGG + Intronic
1062023171 9:134328715-134328737 GGGCCTGGCTTGTCTTGGCCCGG + Intronic
1062083212 9:134635439-134635461 AGGCCTGGTTTTACTGGACCTGG - Intergenic
1186448923 X:9655873-9655895 GAGCCTGGGTTTCCTTGCCCAGG + Intronic
1189104667 X:38222822-38222844 TGGCCAGGCTATCCTGGACCTGG - Intronic
1190713385 X:53084991-53085013 GGGCCTGGGGTTCCTGGCCCCGG - Exonic
1198618833 X:138484829-138484851 GGCCCTGGCTCTCCCACACCAGG - Intergenic
1198959558 X:142169900-142169922 GGCTCTGGCTCTCCTAGGCCAGG + Intergenic
1200046872 X:153407881-153407903 GGGCCTCTCTTTCCTTGAGCAGG + Intergenic