ID: 903608169

View in Genome Browser
Species Human (GRCh38)
Location 1:24590232-24590254
Sequence CACGGCAAACACTCAAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903608169 Original CRISPR CACGGCAAACACTCAAATGG TGG Intronic
903608169 1:24590232-24590254 CACGGCAAACACTCAAATGGTGG + Intronic
905338324 1:37260525-37260547 AACGGCAGGCACTCTAATGGAGG + Intergenic
916085514 1:161266251-161266273 CAAAGCAAACACTCAGCTGGAGG - Intronic
920979442 1:210819457-210819479 CACGGCAGACACTCAAATCTTGG - Intronic
921767552 1:218990229-218990251 CACTGCAAACACCCTGATGGAGG - Intergenic
923814317 1:237358675-237358697 CACTGCCAACAAGCAAATGGGGG - Intronic
1063269401 10:4489488-4489510 CTCTGTAAACACACAAATGGAGG + Intergenic
1065189054 10:23193883-23193905 CAGGACACAAACTCAAATGGTGG - Exonic
1066596559 10:37057329-37057351 CATGGCAAACAATCATATAGTGG - Intergenic
1071365968 10:84900958-84900980 CAGGGCCAACACTGAAATGTAGG + Intergenic
1072212402 10:93258560-93258582 CTTGGCAAAAACTAAAATGGAGG + Intergenic
1075670211 10:124259326-124259348 CACGGCACACACTCAAGGGGAGG + Intergenic
1085656358 11:78318740-78318762 CAGGGCAATCACTTAAAGGGAGG + Intronic
1088240212 11:107766264-107766286 TACAGCAAACACACAAATGAGGG + Intergenic
1090833076 11:130433052-130433074 CACAGCAAGCACTCAAAAGATGG - Intergenic
1091071775 11:132571455-132571477 CAAAGCAAACACTGCAATGGTGG - Intronic
1096516341 12:52157653-52157675 CACTTCAAATAATCAAATGGGGG - Intergenic
1098382223 12:69881289-69881311 AACTGTAAACACTCAAATGTGGG + Intronic
1107030941 13:35853205-35853227 TAGTGAAAACACTCAAATGGAGG + Intronic
1114617463 14:24075883-24075905 CACGGTAAAGACTCAGAGGGAGG + Exonic
1115776524 14:36721282-36721304 CATGTCAAACAGTCAAATGAGGG - Intronic
1122445548 14:101765195-101765217 CACTGAAAACACTGAAATGTTGG + Intronic
1123697813 15:22891683-22891705 AACGGCAAACACCCAAATCAGGG - Intronic
1128772590 15:70293235-70293257 CACGGAAAAGAATCAAAAGGAGG + Intergenic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1134569479 16:15279225-15279247 CACGGCAGACAGTGAAATAGTGG + Intergenic
1134732898 16:16476824-16476846 CACGGCAGACAGTGAAATAGTGG - Intergenic
1134934541 16:18235147-18235169 CACGGCAGACAGTGAAATAGTGG + Intergenic
1138361373 16:56431372-56431394 CATGTCAAACCCTCACATGGTGG - Exonic
1144321503 17:14125975-14125997 CGTGGCAAACACTTTAATGGAGG - Intronic
1144365976 17:14545356-14545378 CACAGCAAACACACAAATGGAGG - Intergenic
1155051727 18:22153978-22154000 TACCACAAACACTCAATTGGTGG - Intergenic
1159088196 18:63818300-63818322 TATGGCTAACACTCAACTGGAGG - Intergenic
1159481738 18:68998122-68998144 TATGGCAAACACTGACATGGAGG - Intronic
1163227916 19:15978104-15978126 CAAGGCAAACTTTAAAATGGTGG - Intergenic
1164713626 19:30376288-30376310 CAGGGCAAAGACACAGATGGAGG - Intronic
1168063289 19:53906157-53906179 CAGGGGAAACAGGCAAATGGAGG - Intronic
935178820 2:100672658-100672680 CAGGGCAAGAACACAAATGGAGG + Intergenic
935306905 2:101745896-101745918 CACGGCAGAGAACCAAATGGGGG - Intronic
938213220 2:129485874-129485896 CAGGGCAAGAACACAAATGGAGG + Intergenic
945121552 2:206462665-206462687 CCCGGCAAATCCTTAAATGGGGG - Intronic
947723942 2:232385842-232385864 CACGGCAAAAACCCATCTGGTGG - Intergenic
948024848 2:234768832-234768854 CATGACTAACTCTCAAATGGTGG - Intergenic
948946890 2:241224934-241224956 CCCAGCAAGCACCCAAATGGGGG + Exonic
1172714620 20:36953466-36953488 CACGAGAATCACTCAAATGTGGG + Intergenic
1175446747 20:59025695-59025717 CTCGGCAACCATTCAAATGCAGG + Exonic
1176960682 21:15155452-15155474 CAGGGCAAAAGCACAAATGGAGG - Intergenic
1177061140 21:16375643-16375665 CACTGCCAAAACTCAAAAGGTGG - Intergenic
1179533043 21:42033084-42033106 CCCGGCAAACACTGGGATGGTGG - Intergenic
1181490730 22:23259333-23259355 CAGGACACAGACTCAAATGGAGG - Intronic
950422441 3:12906847-12906869 CACTGCACAAACTCAAACGGAGG + Intronic
951152878 3:19313187-19313209 CAAGGCAGGCACTCAAAAGGGGG + Intronic
954309386 3:49753059-49753081 CATGGCAAAAAGTGAAATGGCGG - Intronic
955043446 3:55337955-55337977 CACGGCAAAAACTCATAAGCTGG - Intergenic
964946393 3:162231072-162231094 CAGGGCAAACCCCCAAATTGGGG - Intergenic
965879235 3:173368752-173368774 AACAGCAGACACTCAAATAGTGG + Intergenic
975843875 4:78505252-78505274 CAAGGCCAACATTCAAATTGAGG - Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
976494544 4:85712346-85712368 CACCCTAAACACTCAAATGCTGG - Intronic
977401087 4:96533261-96533283 CTCAGCAAACACTCAAAAGCAGG - Intergenic
983155813 4:164347030-164347052 CCCAGCAAACACTCAGTTGGAGG - Intronic
990191351 5:53263638-53263660 CAAGGAATATACTCAAATGGTGG + Intergenic
991192541 5:63892061-63892083 CACAGTAAGCACTCAAATGTTGG - Intergenic
995984743 5:118156382-118156404 GTAGGCAAACACTCAAATCGTGG + Intergenic
998519722 5:142788840-142788862 CACAGAAAACACTTAAATGGTGG - Intronic
999129732 5:149273285-149273307 CACAGCAAACAGGCAGATGGGGG - Intronic
1014195591 6:118554784-118554806 CATGGCAGACAATCAAAAGGTGG + Intronic
1017743447 6:157426848-157426870 CACGGAAAACGCTCTTATGGAGG - Intronic
1020501158 7:8922478-8922500 CACTGCAAACACTGAAACAGTGG + Intergenic
1021415051 7:20374536-20374558 TATGGTAAACACTAAAATGGTGG + Intronic
1029103308 7:98152617-98152639 CACAGCAAACAGTCAATTGTGGG + Intronic
1033285597 7:140038151-140038173 CACGGCAGCCATTCAAATGCCGG + Intronic
1044154645 8:88828771-88828793 CATAGCAAAAAATCAAATGGAGG - Intergenic
1051507113 9:17839472-17839494 CACGGCAAATAAACAAATGATGG - Intergenic
1186481317 X:9898096-9898118 CAAGGCAAACCCACAAATGAGGG + Intronic
1186745999 X:12570021-12570043 TAAGGCAAACACTCAAACAGAGG - Intronic
1191207824 X:57853132-57853154 CACTGCAAACATCCACATGGTGG - Intergenic
1192953015 X:76038127-76038149 GAAGGCAAACATTCAAATTGAGG - Intergenic
1199435451 X:147807337-147807359 CACTGCAAAAACTACAATGGTGG + Intergenic
1199499007 X:148488519-148488541 CAGAGCCAACACTCAAATTGAGG - Intergenic