ID: 903614772

View in Genome Browser
Species Human (GRCh38)
Location 1:24643613-24643635
Sequence CTCGCTGCCCGCCTGCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903614763_903614772 13 Left 903614763 1:24643577-24643599 CCGGAAAATGGCGGCGGGAATGG 0: 1
1: 0
2: 3
3: 80
4: 2325
Right 903614772 1:24643613-24643635 CTCGCTGCCCGCCTGCCTGGCGG 0: 1
1: 0
2: 2
3: 27
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903614772 Original CRISPR CTCGCTGCCCGCCTGCCTGG CGG Intronic
900188322 1:1343122-1343144 CTAGCTGTCCTCCTACCTGGGGG - Intronic
900396582 1:2455517-2455539 CTGGCAGCCCGCCTTCCTGCAGG + Intronic
900479823 1:2892676-2892698 CCTGCTGCCCGCCTGCCCGGAGG - Intergenic
901217287 1:7561845-7561867 CTGCCTGCACGCCGGCCTGGAGG + Intronic
902407361 1:16191968-16191990 CTCCCTGCCCACCTGCCCAGGGG - Intergenic
902410745 1:16210198-16210220 CTCTCTGCCCAGCTGGCTGGGGG + Intronic
902511445 1:16969097-16969119 CTGGCTGTCCTCCTGCCAGGTGG + Exonic
903614772 1:24643613-24643635 CTCGCTGCCCGCCTGCCTGGCGG + Intronic
903754569 1:25651945-25651967 CCTGCTGCCTGCCTGCCTGCCGG + Intronic
903830201 1:26169995-26170017 CTCGGTGCGCGCCTGTCCGGCGG - Exonic
903842608 1:26254691-26254713 CTCGTTGCTCACCTTCCTGGGGG + Intronic
903925199 1:26826846-26826868 CCCGCTGCCCGCCTCCCCGGGGG + Exonic
904042658 1:27593414-27593436 CTGGGTCCCAGCCTGCCTGGGGG - Intronic
904181323 1:28668812-28668834 CTCGCCGCCCGCCCGCCCGACGG + Exonic
904441839 1:30536791-30536813 CCGGCTGCCCGGCTGTCTGGTGG - Intergenic
904855217 1:33492733-33492755 ATCGCTGCACTCCAGCCTGGCGG + Intronic
905018474 1:34793051-34793073 CTCACCGCCTGCCTGCCGGGCGG - Exonic
905165390 1:36079016-36079038 CTCACTGCACTCCAGCCTGGGGG + Intergenic
905512187 1:38530314-38530336 GTCAGTGCCTGCCTGCCTGGTGG + Intergenic
905797327 1:40823049-40823071 CTTGATGCCCGCCTGCCCGTGGG - Intronic
905973486 1:42157864-42157886 CTGGCTTCCCACCTGCCTGCTGG + Intergenic
906480984 1:46198610-46198632 TTCGCAGCCCGGCTGGCTGGTGG + Intronic
908441855 1:64163044-64163066 CTGGCTCCTCACCTGCCTGGAGG + Intronic
908642968 1:66245598-66245620 CTGCTTGCCAGCCTGCCTGGAGG - Intronic
910105473 1:83627256-83627278 CTGTCTGCCAGCCTGCCAGGTGG - Intergenic
913212670 1:116594726-116594748 ATCCCTGCCAGCTTGCCTGGGGG + Intronic
915085557 1:153386232-153386254 TTTTCTGCCCTCCTGCCTGGGGG - Intergenic
915161323 1:153922685-153922707 CTGGCCGCCCGCCCGCCCGGGGG - Intronic
915195099 1:154183272-154183294 CTGCCTTCCCGCCTGCCTGGCGG - Intronic
915558536 1:156673565-156673587 CTTGCTGCCTGCAGGCCTGGGGG - Intronic
915559377 1:156677443-156677465 CCCTCTTCCCGCCCGCCTGGCGG - Intergenic
915589053 1:156860462-156860484 CTCGCGGCGCGCGTGCCTAGGGG - Intronic
918039725 1:180906683-180906705 CTTCCTGCCTGCCAGCCTGGGGG + Intergenic
919945950 1:202319029-202319051 ATGGCTGCCCTCCAGCCTGGGGG - Exonic
922905236 1:229169009-229169031 CTGGCTGCTCCCCTCCCTGGGGG + Intergenic
923128274 1:231051742-231051764 ATCACTGCCCTCCAGCCTGGGGG - Intergenic
923168258 1:231388417-231388439 CTCTCTGCCAGCCTGCCAGGAGG + Intronic
923458787 1:234188721-234188743 CTGGTTGCCCTCCTGCCAGGAGG - Intronic
1063440277 10:6067339-6067361 ACCGCTGCACGCCAGCCTGGGGG + Intergenic
1064050252 10:12053846-12053868 GCCGCTGCACTCCTGCCTGGGGG - Intergenic
1065874964 10:29989709-29989731 GCCGCTGCACGCCAGCCTGGGGG - Intergenic
1067135732 10:43606087-43606109 CTCGCTGCTTGCCTGCCCTGTGG - Intergenic
1067714676 10:48681438-48681460 CCCACTGCCCTCCAGCCTGGAGG + Intergenic
1069486629 10:68827845-68827867 CGCGCCCCCCGCCTGCCTGCAGG + Exonic
1069486716 10:68828181-68828203 CGCGCCCCCCGCCTGCCTGCAGG + Intronic
1070781374 10:79139343-79139365 CTCCCTGTCACCCTGCCTGGGGG + Intronic
1071071227 10:81696854-81696876 CTCACTGCCTCCTTGCCTGGGGG - Intergenic
1071451099 10:85791981-85792003 CTCCCTGGCCTCCTGCCTGGGGG - Intronic
1072421134 10:95291143-95291165 CGCCCTGCGCGCCGGCCTGGGGG + Intergenic
1072619815 10:97072520-97072542 CCTGCTGCCTGCCTGCCTGGGGG - Intronic
1073068898 10:100781157-100781179 CTCTCTGCCCCCCAGCCTTGGGG + Intronic
1073251076 10:102120604-102120626 CTCGCCGCCCGCCCGCCGCGCGG - Intergenic
1073702854 10:105949360-105949382 CTTCCTGCCTGCCTGCCTTGTGG + Intergenic
1073930126 10:108566367-108566389 CCTGCAGCCCGCCTCCCTGGGGG + Intergenic
1075105680 10:119538603-119538625 CTTGCTGCCCCACTGCCTGGTGG - Intronic
1075895962 10:125994731-125994753 TGTGCTGCCCGCCTGCCTGTTGG + Intronic
1076149827 10:128153107-128153129 ATCCCTGCTCTCCTGCCTGGAGG + Intergenic
1076368176 10:129935583-129935605 CCTGCTGCCCGCCAGCCTTGTGG - Intronic
1076882860 10:133248047-133248069 CTCGCCGCCCGCCCGCCCGGCGG - Intergenic
1077161302 11:1113795-1113817 CCGGCTGCCCACCTGGCTGGCGG - Intergenic
1078667534 11:13339093-13339115 CTAGCTGCCCCCTTGGCTGGGGG + Intronic
1079128886 11:17736095-17736117 CACGCGGCTCGCCTGGCTGGCGG + Exonic
1080834293 11:35926204-35926226 CTCTGTGCCCTGCTGCCTGGAGG + Intergenic
1081559864 11:44203727-44203749 CTGCCTGCCTGCCTGCCTGCTGG + Intronic
1084212308 11:67629890-67629912 CATGCTGCCCGACTGCCTGTCGG - Exonic
1084493733 11:69491949-69491971 CTCTGTGCCCTCCTGCCTCGGGG - Intergenic
1089146377 11:116332299-116332321 CCTGCTGCCCTCCTGTCTGGTGG - Intergenic
1089367959 11:117932507-117932529 CTGGCTGCCCTCAGGCCTGGAGG - Intergenic
1091779405 12:3204500-3204522 CTGGGTGCCTGCCTGCCTGTGGG + Intronic
1092194258 12:6539911-6539933 CACGCTGTCCACCTGCCAGGTGG - Exonic
1096086027 12:48865592-48865614 CTCCCTGCCTGCCCGCCTTGGGG - Intronic
1096980250 12:55724473-55724495 CTACCTGCCAGCCAGCCTGGTGG + Exonic
1097036662 12:56128840-56128862 CCCGCTAGCCGCCTGCCTGCTGG + Intronic
1097295525 12:57958406-57958428 CTGGCTGGCCTCCTGCCAGGAGG - Intergenic
1098977623 12:76919812-76919834 CCTGCTGCCCGCCGGGCTGGTGG + Intergenic
1102302293 12:111779677-111779699 CTCTCTGCCTGCCTTCCTTGGGG - Intronic
1104376541 12:128268404-128268426 CTTGCTCCCCGCCTGCCCCGCGG - Intronic
1104731004 12:131105316-131105338 CTCTCTGCCCTGCTGCCTCGTGG - Intronic
1104810593 12:131617914-131617936 CTGGCTCCCTGCGTGCCTGGAGG - Intergenic
1105215917 13:18285349-18285371 ATCCCTGCCAGCTTGCCTGGGGG + Intergenic
1112444397 13:99450983-99451005 CTCTCTTCCCTCCTCCCTGGAGG + Intergenic
1112768531 13:102772614-102772636 GCCGCTGCACTCCTGCCTGGGGG - Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113727580 13:112616701-112616723 CTCGCTTCCTCCGTGCCTGGAGG + Intergenic
1116795120 14:49381962-49381984 CTGGCTGGCCTACTGCCTGGGGG - Intergenic
1117913730 14:60656788-60656810 CTCGCAGCCCGCCTGCTTGCTGG - Intronic
1119239766 14:73049415-73049437 CTCACTGCACTCCAGCCTGGGGG + Intergenic
1119290478 14:73491395-73491417 CGCGCCGCCCGCGCGCCTGGTGG + Exonic
1119787336 14:77323385-77323407 GTCACTGCCCTCCAGCCTGGGGG - Intronic
1120957026 14:90091965-90091987 ATCGCTGCACTCCAGCCTGGGGG - Intronic
1121411059 14:93748577-93748599 CTCTCTGCCCCCCTGGCTGGTGG + Intronic
1121665313 14:95667526-95667548 CTTCCTGCCTGCCTCCCTGGGGG + Intergenic
1122125604 14:99576938-99576960 CTCGCCCCCAGGCTGCCTGGGGG + Intronic
1122854744 14:104554688-104554710 CTCGCTGCCCTCCTGCAGGCCGG + Intronic
1122959666 14:105088558-105088580 CTCCCAGGCAGCCTGCCTGGAGG + Intergenic
1123009939 14:105344329-105344351 ATCACTGCACGCCAGCCTGGGGG - Intronic
1123016482 14:105377974-105377996 CTGGCTGCCCTGCCGCCTGGTGG + Intronic
1123796935 15:23781819-23781841 CCCCCTCCCCGCCTGCCAGGGGG - Intergenic
1123880499 15:24674940-24674962 CTCACTGCACTCCAGCCTGGGGG - Intergenic
1124629244 15:31327562-31327584 CTCGCTCCACGCCGGGCTGGGGG - Exonic
1126168266 15:45672199-45672221 GCCTCTGCCCACCTGCCTGGGGG - Intronic
1127922378 15:63504084-63504106 CCCGCTGCCCGCCTCCCCCGGGG + Intergenic
1128090795 15:64917375-64917397 CACCCTGCCCACCTGCCCGGAGG - Exonic
1128152631 15:65372765-65372787 CTCCCTGCCCGTGTGCCTGCCGG - Intronic
1130991310 15:88877592-88877614 CTCCCTGCCCCTCAGCCTGGGGG - Exonic
1131963671 15:97814953-97814975 CTTTCTGCCTGCCTGCCTTGTGG + Intergenic
1132248348 15:100315153-100315175 CACGCTGCCTGCCTGCCTCCCGG - Intronic
1133054934 16:3141197-3141219 CTCGCTGCGCTCCTACCTGCTGG + Exonic
1133322899 16:4925219-4925241 CTGGCGTCCTGCCTGCCTGGAGG + Intronic
1134032444 16:11003341-11003363 CTCGCTGGCGGGCTGGCTGGCGG - Intronic
1134502112 16:14777394-14777416 CACTCTGGCCGCCTGGCTGGGGG + Intronic
1134848377 16:17460418-17460440 CTCCCTCCCCGCCTAGCTGGTGG - Intronic
1135303114 16:21347551-21347573 CTGACTGCCCGCCTGCCTGCTGG - Intergenic
1136299854 16:29326743-29326765 CTGACTGCCCGCCTGCCTGCTGG - Intergenic
1136591081 16:31218118-31218140 CTCTGTGCCTGCCTGTCTGGTGG + Intronic
1137683247 16:50368887-50368909 CGCGCCGCCCCCCTGCCTCGCGG - Intronic
1139229172 16:65266119-65266141 CTGGCTGCCCACCTGCCTGGTGG + Intergenic
1140116451 16:72045866-72045888 GTCCCTGCACTCCTGCCTGGGGG + Intronic
1140890223 16:79278787-79278809 CTCCCTGCCTTCCTGCCTGCTGG + Intergenic
1141511540 16:84515222-84515244 CTGCCTGCCTGCCTGCTTGGAGG - Intronic
1141651118 16:85393790-85393812 CCCACTGCCCCCCAGCCTGGTGG + Intergenic
1142061587 16:88033505-88033527 CTGACTGCCCGCCTGCCTGCTGG - Intronic
1143518580 17:7432482-7432504 CTGGCTGCCTGCCCGCCAGGAGG - Intergenic
1144298025 17:13897821-13897843 CGTGCTCCCTGCCTGCCTGGAGG + Intergenic
1144339974 17:14302689-14302711 CGCGCCGCCCGCCCGCCAGGCGG - Intronic
1144721193 17:17470929-17470951 CTGGCTGCCCTCCTTCCTGCTGG - Intergenic
1144993746 17:19252165-19252187 CTCCCTGCACTGCTGCCTGGTGG + Intronic
1145264339 17:21372385-21372407 GACCCTGGCCGCCTGCCTGGAGG + Intergenic
1145406916 17:22607855-22607877 GTCACTGCCCTCCAGCCTGGGGG - Intergenic
1146127129 17:30238493-30238515 CGCCCTGCTCCCCTGCCTGGCGG + Intergenic
1147573484 17:41585791-41585813 CTCCATGCCCGCCTGGCTGTGGG + Intronic
1147620644 17:41864677-41864699 CTCGCTGAGCGCCTGCTTGGGGG - Intronic
1148857854 17:50588737-50588759 CTGGCTGTCTGCCTGCCTGCTGG + Intronic
1149575216 17:57707157-57707179 CTCCCTGCCTGCCTGCCCTGGGG + Intergenic
1150335484 17:64327516-64327538 CTCGCCTCCCCCCTTCCTGGAGG - Intronic
1151364869 17:73610600-73610622 CTCACTCCCCGCCTCCCTCGTGG - Intronic
1151478090 17:74354980-74355002 TTCTCTGCTCCCCTGCCTGGTGG - Intronic
1152144485 17:78560104-78560126 CTCCCCGCCCTCCTGCCTGGAGG + Intronic
1152350143 17:79779493-79779515 GGCGCTGCTCGCCTGCCGGGAGG + Intronic
1152394537 17:80024179-80024201 CCCGCTGCAGTCCTGCCTGGTGG - Intronic
1152537668 17:80959975-80959997 CTTGCTGCCTGCCTGGCTGTGGG - Intronic
1152610653 17:81313701-81313723 CTCGCTGGCAGCCTGCGGGGTGG - Exonic
1152848709 17:82618542-82618564 CTCGCTGCTGCCCTGGCTGGCGG - Intronic
1153688224 18:7567311-7567333 CTTGCTCCCCGACTGACTGGCGG - Exonic
1156389635 18:36638491-36638513 CTATCTGCCTGCCTGCTTGGTGG + Intronic
1157359496 18:46964500-46964522 CTCGCTGCCCGGTCGCCAGGCGG + Intronic
1157361090 18:47024019-47024041 CTCGCTGCCCGGTCGCCAGGCGG + Intronic
1157362080 18:47029934-47029956 CTCGCTGCCCGGTCGCCAGGCGG + Exonic
1157413702 18:47485030-47485052 CTGCCTGCCTGCCTGCCTGCCGG - Intergenic
1157492736 18:48135946-48135968 CCCGCTGCCCACCCGCCTGCCGG + Intronic
1157834113 18:50883365-50883387 CTCCCTGGCCCCCTACCTGGAGG - Intronic
1158459755 18:57635862-57635884 ATCACTGCCCTCCAGCCTGGGGG - Intergenic
1158974832 18:62702329-62702351 CTTGCTGCATGCCTGCCTGCAGG + Intergenic
1159023032 18:63158473-63158495 CTGGCTGTCAGGCTGCCTGGGGG - Intronic
1160449820 18:78954992-78955014 CAGGCTGCTCCCCTGCCTGGTGG - Intergenic
1160702276 19:513382-513404 GTCGCTGCCCTCCTGCCTCTGGG + Intronic
1161297201 19:3526098-3526120 CTCTCTGCTCTCCTGCCTGCAGG + Exonic
1161604484 19:5207049-5207071 CTCTCCTCCCGTCTGCCTGGAGG + Intronic
1161607263 19:5222086-5222108 CTGCCTGCCTGCCTGCCTGCTGG + Intronic
1162130154 19:8521469-8521491 CTATCTGCCTGCCGGCCTGGTGG - Exonic
1162799713 19:13103771-13103793 CTGGGTGCCTGCCTGCCTGGGGG - Intergenic
1163545094 19:17936598-17936620 CCCGCGGCCCGCATGCCTTGTGG + Intronic
1164898407 19:31897345-31897367 CTGCCTGCCTGCCTGCCTGCTGG + Intergenic
1165328312 19:35126700-35126722 CTGGCTGCCCGCCTGTGGGGGGG - Exonic
1165430236 19:35767944-35767966 CTCGCCGCCAGCCTTCCAGGTGG + Exonic
1166948910 19:46413486-46413508 CTGGGTGGCGGCCTGCCTGGGGG - Exonic
1167121083 19:47517122-47517144 CTCACTGCACTCCAGCCTGGGGG + Intergenic
1168288371 19:55345552-55345574 CTCGCCACCTGCCTGCCTGACGG - Intronic
1168323656 19:55525899-55525921 GTCCCTGCCTGCCTGCCTGCCGG + Intergenic
1168398882 19:56071734-56071756 TTTGCTCCCCGCCTGCCTGTTGG + Intergenic
1202686813 1_KI270712v1_random:56333-56355 CTCGCTGGCTGGCTGGCTGGTGG + Intergenic
926284152 2:11474205-11474227 CTGGCCGCTTGCCTGCCTGGTGG + Intergenic
926915964 2:17892902-17892924 CTGGTTGGCCGCCTGCCAGGAGG + Intronic
927698188 2:25251692-25251714 CTTTCTGGCGGCCTGCCTGGAGG + Intronic
927982649 2:27384081-27384103 CTCGCTGCATTCCTGCCAGGGGG + Exonic
929777622 2:44938734-44938756 CTGGCTCCCCGCCGGGCTGGGGG - Intergenic
930005024 2:46889733-46889755 CTCACTGCACTCCAGCCTGGGGG + Intergenic
930656218 2:54009531-54009553 ATCACTGCACGCCAGCCTGGGGG + Intronic
931228236 2:60352168-60352190 CTGGCTGCCAGCCTGCCTCTGGG + Intergenic
933958952 2:87396735-87396757 CTCGCTGGCTGGCTGGCTGGCGG - Intergenic
934265082 2:91505579-91505601 CTCGCTGGCTGGCTGGCTGGCGG + Intergenic
934265722 2:91508409-91508431 CTCGCTGGCTGGCTGGCTGGCGG + Intergenic
934266077 2:91509995-91510017 CTCGCTGGCTGGCTGGCTGGCGG + Intergenic
934266256 2:91510844-91510866 CTCGCTGGCTGGCTGGCTGGCGG + Intergenic
934266504 2:91511945-91511967 CTCGCTGGCTGGCTGGCTGGCGG + Intergenic
934267339 2:91515648-91515670 CTCGCTGGCTGGCTGGCTGGCGG + Intergenic
934267573 2:91516716-91516738 CTCGCTGGCTGGCTGGCTGGCGG + Intergenic
934267756 2:91517556-91517578 CTCGCTGGCTGGCTGGCTGGCGG + Intergenic
934268972 2:91522943-91522965 CTCGCTGGCTGGCTGGCTGGCGG + Intergenic
934269723 2:91526268-91526290 CTCGCTGGCTGGCTGGCTGGTGG + Intergenic
934298411 2:91761377-91761399 ATCCCTGCCAGCTTGCCTGGGGG - Intergenic
934716789 2:96549326-96549348 CCCGCTCCCCGCCTGCCTCGGGG - Exonic
937572514 2:123381193-123381215 CTGGCTGGCCTCCTGCCAGGAGG - Intergenic
938072827 2:128317500-128317522 GGCTCTGCCCGCCTGCCTGCCGG - Intronic
939956231 2:148529839-148529861 CTCACTGCCAGCCTTCTTGGTGG + Intergenic
940898943 2:159108723-159108745 CTGGCTGCCCCTCTGCCTGGAGG - Intronic
944965490 2:204927358-204927380 CTCGCTGCACCCTTGCATGGTGG - Intronic
945188872 2:207166374-207166396 CGCGCTGCCCGGCCGCCGGGCGG - Intronic
948118488 2:235511384-235511406 CTGGCTGCCCCCCTCCCTGAGGG - Intronic
948824802 2:240568937-240568959 CCCGCTGCCCGCCTTCCCCGAGG + Exonic
949050406 2:241894801-241894823 CACCCTGCCCGGCTGCCTGTGGG + Intronic
1171866667 20:30490892-30490914 CTGCCTGCCTGCCTGCCTGCCGG + Intergenic
1172631098 20:36378743-36378765 CTCTCTGCAGGCCTGGCTGGAGG + Intronic
1172774081 20:37397216-37397238 CTGGCTGTGCCCCTGCCTGGAGG + Intronic
1173807146 20:45933696-45933718 CTGGCTGCACGCCAGCGTGGGGG - Intergenic
1174173789 20:48632538-48632560 CAAGCTGCCCTCCCGCCTGGAGG - Exonic
1175185572 20:57177852-57177874 CTCGCGGCCTGCATGCCTTGTGG + Intronic
1175728032 20:61332679-61332701 CTGGCTGCCCTCCTCCCTGGGGG + Intronic
1176061724 20:63175553-63175575 CCCCCAGCCCGCCTGGCTGGGGG + Intergenic
1176187287 20:63787916-63787938 CTGCCTGCCCCCCTGGCTGGAGG - Intronic
1176236474 20:64056002-64056024 CTGCCAGCCCGCCAGCCTGGCGG - Intronic
1176411855 21:6453531-6453553 CCCTCTGCCCACCTGCTTGGGGG - Intergenic
1178900446 21:36593817-36593839 CAGGCTGCCAGCCTGCCAGGCGG + Intergenic
1179687349 21:43061853-43061875 CCCTCTGCCCACCTGCTTGGGGG - Intronic
1179842763 21:44087967-44087989 TCCGCCGCCCGCCTGCCTGCTGG + Intronic
1180136992 21:45868313-45868335 CTGCCTGCCCGGCTGCCTGGAGG + Intronic
1180559854 22:16607364-16607386 CTCTCTGCACTCTTGCCTGGTGG + Intergenic
1181028141 22:20137370-20137392 CTGGCTGCCAGCCTGCCTCCTGG - Intronic
1182575508 22:31270370-31270392 CTGCCTGCCTGCCTGCCTGAGGG - Intronic
1183732631 22:39627333-39627355 CTGGCCCCCCGCCTGCCTCGTGG - Intronic
1183734451 22:39636128-39636150 CTCGCTCCCAGCCTGCCTCTGGG - Intronic
1185268606 22:49918214-49918236 CTCGCCGCGCGCCCGCCTGAAGG + Intronic
949884333 3:8681722-8681744 CTCACTCCCCGCCTCCCAGGGGG - Intronic
950277528 3:11675303-11675325 CTCACTGCACTCCAGCCTGGGGG + Intronic
950533653 3:13567316-13567338 CTCCCTGCCCTCCTGCCTTCAGG - Intronic
952394506 3:32909324-32909346 CTCACTGCACGTCTGCCTCGCGG + Intergenic
954682220 3:52351862-52351884 CTGGCTGCCTGGGTGCCTGGTGG + Intronic
954784851 3:53085179-53085201 CTCACTGCCCACCAGCCTGAGGG + Intronic
958013849 3:87914866-87914888 CTGGCTGGCCTCCTGCCAGGGGG - Intergenic
960987723 3:123291613-123291635 CTCTCTGCCAGCCTCTCTGGGGG + Intronic
961340369 3:126213270-126213292 CTCGGAGCCCGGCGGCCTGGAGG + Intergenic
961664246 3:128486353-128486375 CCCGCAGCCCGCCTGACCGGAGG - Exonic
965550518 3:169960426-169960448 GTCGCTGCACTCCAGCCTGGGGG - Intergenic
966873730 3:184309335-184309357 CTCACTGCACTCCAGCCTGGGGG - Intronic
967955878 3:194876895-194876917 CTCCCTTCCCACCTGGCTGGGGG + Intergenic
967994349 3:195155302-195155324 CTCCCTGCCGACCTTCCTGGAGG - Intronic
968136036 3:196220150-196220172 CCCGCTGCGCGCCGGGCTGGCGG + Intronic
968578205 4:1377660-1377682 CTCTCAGCCCAACTGCCTGGGGG - Intronic
968658617 4:1789538-1789560 CTCCCTGCCCACCTCCCTGTCGG + Intergenic
968959006 4:3733400-3733422 GGCCCTACCCGCCTGCCTGGGGG + Intergenic
970325367 4:14918478-14918500 CTCCCTGACAGCCTGCTTGGGGG + Intergenic
971678777 4:29669992-29670014 TTCGCTGCACTCCAGCCTGGGGG - Intergenic
973532167 4:51844377-51844399 CTCGCTTCCCGCCGTCCGGGGGG - Intronic
975918659 4:79356290-79356312 CTCACTGCACTCCAGCCTGGGGG - Intergenic
976377751 4:84364367-84364389 CTGGCTGCCAGCCAGCCTGAAGG + Intergenic
980930061 4:139176703-139176725 CGCGCTGCGCGCCTGCCCGCGGG - Intronic
984743812 4:183193928-183193950 CTGCCTGCCTGCCTGCCTGCTGG + Intronic
984812415 4:183806913-183806935 CTCGAAGCCCCCATGCCTGGAGG + Intergenic
985606862 5:862465-862487 CACCCTGCCCGGCTTCCTGGTGG - Intronic
985644350 5:1078007-1078029 CCGCCTGCCCGCCTGCCTGCAGG - Exonic
985715887 5:1461186-1461208 ATGGCTGGCTGCCTGCCTGGTGG - Intronic
987393762 5:17401584-17401606 CACCCTGCACCCCTGCCTGGGGG + Intergenic
987675637 5:21069545-21069567 CCCACTGCCCGCCTCCTTGGAGG + Intergenic
990488457 5:56281167-56281189 CTCTGTGCCCACTTGCCTGGAGG - Intergenic
990587177 5:57223872-57223894 ATCGCTGCACTCCGGCCTGGGGG - Intronic
994175131 5:96702739-96702761 CTCCCCGCCCCCCTGCCCGGCGG - Intronic
998139093 5:139689958-139689980 CTCGCTCCCTGCCCTCCTGGGGG + Intergenic
998236975 5:140406203-140406225 CTCTCTGTCACCCTGCCTGGAGG - Intronic
998313568 5:141158052-141158074 CTCGCTCACCGTCTACCTGGTGG + Intergenic
998315059 5:141174881-141174903 CTCGCTCACCGTCTACCTGGTGG + Exonic
998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG + Exonic
999760334 5:154695269-154695291 CTCACTGCACTCCAGCCTGGGGG + Intergenic
1000286780 5:159833689-159833711 CTTGCTGTCTTCCTGCCTGGAGG - Intergenic
1000320090 5:160127629-160127651 CTGCCTGCCTGCCTGCCTGTTGG + Intergenic
1002191055 5:177477915-177477937 CTCGCTGACTGACAGCCTGGGGG - Intergenic
1002638984 5:180621686-180621708 CCCTCTGGCCGCCAGCCTGGAGG - Exonic
1003634538 6:7820565-7820587 CTTTCTGTCTGCCTGCCTGGAGG + Intronic
1004044596 6:12012141-12012163 CCGGCTGCCCGGCTCCCTGGCGG + Intronic
1004174521 6:13328377-13328399 AACGGTGCCCGCCTGCCCGGCGG - Intronic
1005989106 6:30892320-30892342 CTGGGAGCCCGTCTGCCTGGCGG + Exonic
1006136116 6:31897339-31897361 CCCGCTGCCCCCCAGCCCGGTGG + Intronic
1006523893 6:34588020-34588042 CTCTCTGCTCCCCTGCCTAGTGG - Exonic
1007162222 6:39800859-39800881 CAACCTGCCCTCCTGCCTGGAGG + Intronic
1007784827 6:44273570-44273592 CTCCCTCCCCACCTCCCTGGGGG + Intronic
1007820924 6:44559995-44560017 CTCACAGCCCGCCTGCCCGCTGG + Intergenic
1008765644 6:54910488-54910510 CTTGCTGCCTGCCTTTCTGGTGG + Intronic
1010757365 6:79681909-79681931 CCCGCTGCACTCCAGCCTGGGGG + Intronic
1012155998 6:95820146-95820168 CTCGTTGCCCTCCTGCCAGGAGG - Intergenic
1017753566 6:157510799-157510821 ATCCCTGGGCGCCTGCCTGGTGG - Intronic
1018019153 6:159741909-159741931 CACGCTGCACTCCAGCCTGGGGG + Intronic
1018893725 6:167999714-167999736 CTCACTGACTGCCTGCATGGCGG - Intronic
1019094139 6:169564994-169565016 CTCGCTGACAGCGTACCTGGTGG - Intronic
1019427629 7:984876-984898 CTTCCTGCCCACTTGCCTGGCGG + Intronic
1019711445 7:2519906-2519928 CGCGCTGCTCGCCTGCCTGCTGG + Exonic
1019780825 7:2938684-2938706 CTCGCAGCTCCTCTGCCTGGCGG + Exonic
1026773188 7:73214785-73214807 CTCCCTGCCAGCCTGGCTTGAGG + Intergenic
1027014050 7:74768181-74768203 CTCCCTGCCAGCCTGGCTTGAGG + Intergenic
1027073987 7:75177851-75177873 CTCCCTGCCAGCCTGGCTTGAGG - Intergenic
1029184988 7:98731901-98731923 ATGGCTGCGGGCCTGCCTGGGGG - Intergenic
1030059937 7:105614152-105614174 CTCGCTGCCCGGCGGCCCCGCGG - Exonic
1031353786 7:120765987-120766009 ATCCCTGCTCCCCTGCCTGGAGG + Intergenic
1032922605 7:136566790-136566812 GTGGTTGCCCTCCTGCCTGGAGG + Intergenic
1033159193 7:138981550-138981572 CTGCCTGCCTGCCTGCCTGCGGG + Intergenic
1034499974 7:151443842-151443864 ATCACTGCACTCCTGCCTGGGGG - Intergenic
1034617391 7:152430505-152430527 CTCTCTGCACTCTTGCCTGGTGG - Intronic
1034659886 7:152759891-152759913 CTCCCTGCCTCCCTGCGTGGTGG + Exonic
1035113792 7:156506102-156506124 AGCACTGCCCGCCTGCCCGGGGG - Intergenic
1035243964 7:157550484-157550506 CTCGCGCCCGGCCTCCCTGGTGG - Intronic
1035492610 7:159293529-159293551 CTCTCTGCATGCCAGCCTGGAGG - Intergenic
1035724916 8:1818293-1818315 CTCGCTCCCCGCCTGCGGAGTGG + Intergenic
1037444142 8:18947523-18947545 CTCCCTGACCCCTTGCCTGGAGG - Intronic
1037832660 8:22198589-22198611 CTCACTCCCGGCCTGCCTGCTGG + Intronic
1037881478 8:22575412-22575434 TGTGCTGCCCGCCTGCCTGCTGG + Exonic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1037942366 8:22961416-22961438 CTGCCTGCCTGCCTGCCTTGTGG + Intronic
1038798345 8:30728297-30728319 ATCACTGCACCCCTGCCTGGGGG - Intergenic
1039486332 8:37912983-37913005 ATCTCTGCCCTCCAGCCTGGGGG - Intergenic
1040530870 8:48265453-48265475 CTCCCTCCCAGCCTGTCTGGGGG - Intergenic
1041637144 8:60156692-60156714 CTGGCTGGCCTCCTGCCAGGAGG - Intergenic
1044306547 8:90646207-90646229 CGCGCTGCCCGCCAGGCTGCGGG + Intronic
1044518140 8:93164316-93164338 CTGACTGCCTACCTGCCTGGGGG + Intronic
1045965978 8:108024943-108024965 CTCGCTGCCCCTCTGCCTCCTGG - Intronic
1048999410 8:139815230-139815252 CTCCCTGCCCGCCTTCCCTGTGG + Intronic
1049056192 8:140239231-140239253 CCAGCTGCCCGCCTGCCTGTGGG - Intronic
1049100872 8:140578095-140578117 CTCGCAGCCCCCATGCCTCGGGG + Intronic
1049445249 8:142627443-142627465 CTTGCTGTCCGACTGCCAGGTGG - Intergenic
1049780850 8:144428205-144428227 CTCGGCGCTCTCCTGCCTGGCGG - Intronic
1052824730 9:33166773-33166795 GTCGCTGCCCGCCTGCCCTGAGG - Exonic
1054766611 9:69047571-69047593 CCCACTGCCTGCCTGCCTTGTGG - Intronic
1056350285 9:85742131-85742153 CTCTCTGCGCGCCTGACGGGAGG + Intergenic
1059414665 9:114155551-114155573 CTGCCTCCCCGCCGGCCTGGGGG - Exonic
1059481144 9:114590834-114590856 GCCACTGCCCTCCTGCCTGGGGG - Intronic
1060401406 9:123351604-123351626 CCCTCTGCACGCGTGCCTGGTGG - Intergenic
1061108759 9:128552419-128552441 CTCGCCGCCCGACCGCCCGGCGG - Intergenic
1061183114 9:129036705-129036727 CGCGCTGCCCGCCCGCCTTGGGG - Intronic
1061285627 9:129620705-129620727 CTCGCTGTCCGCCGGGCCGGTGG - Exonic
1061786274 9:133030480-133030502 CTTCCGGCCCGCCTGCTTGGTGG - Intergenic
1061875336 9:133540786-133540808 CTGACTGCCCGCCCGCCTGTGGG + Intronic
1061962566 9:133995551-133995573 CTCGCTGCCCACATGGCTGCCGG - Intergenic
1062384488 9:136303788-136303810 CACGCCGCCCACCTGCCTGGGGG - Exonic
1062407816 9:136405363-136405385 CTCCCTGCACGCCTGCCTGGTGG - Intronic
1185460116 X:329428-329450 CTGGCCGCACGCCTACCTGGCGG + Intergenic
1186182372 X:6985749-6985771 CTCAGTGCCCACCTTCCTGGAGG + Intergenic
1187946143 X:24427924-24427946 CTCTGTGCCCCCCTTCCTGGAGG - Intergenic
1190650505 X:52564071-52564093 GCCACTGCCCTCCTGCCTGGAGG - Intergenic
1190739400 X:53279567-53279589 CTCTCTGCCAGCCTGCCTGAGGG + Intronic
1192151906 X:68717889-68717911 CTGGCTGCCAGTCTGCCAGGCGG - Exonic
1196824278 X:119728670-119728692 CTCGCTGCCCTGCCACCTGGCGG - Intergenic
1199086504 X:143635029-143635051 GCCGCTGCCCGCCTGCCCGCCGG - Intronic
1201076582 Y:10194353-10194375 CTTTCTGCCTGCCTGCCTGCCGG - Intergenic