ID: 903627176

View in Genome Browser
Species Human (GRCh38)
Location 1:24739604-24739626
Sequence CTGTGGAGGCCGTAGGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903627176_903627183 22 Left 903627176 1:24739604-24739626 CCGGGAGCCTACGGCCTCCACAG No data
Right 903627183 1:24739649-24739671 TCAAAGCTACTGTTCTGTTCTGG No data
903627176_903627182 -4 Left 903627176 1:24739604-24739626 CCGGGAGCCTACGGCCTCCACAG No data
Right 903627182 1:24739623-24739645 ACAGTATGGTGCAGTGATCAGGG No data
903627176_903627181 -5 Left 903627176 1:24739604-24739626 CCGGGAGCCTACGGCCTCCACAG No data
Right 903627181 1:24739622-24739644 CACAGTATGGTGCAGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903627176 Original CRISPR CTGTGGAGGCCGTAGGCTCC CGG (reversed) Intergenic
No off target data available for this crispr