ID: 903627181

View in Genome Browser
Species Human (GRCh38)
Location 1:24739622-24739644
Sequence CACAGTATGGTGCAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903627176_903627181 -5 Left 903627176 1:24739604-24739626 CCGGGAGCCTACGGCCTCCACAG No data
Right 903627181 1:24739622-24739644 CACAGTATGGTGCAGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903627181 Original CRISPR CACAGTATGGTGCAGTGATC AGG Intergenic
No off target data available for this crispr